Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 1 - 400


Display:      Gene:      
   Chromosome:      Coordinates:       
  
 
1  CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAATCTTTAAATCCTACATCCATG  chr1.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bay-0.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNNNNNNNCTGAATCCTTAANCCCTAAANCNNNNNNNNNNNNNATCCTACATCCANN  fei-0.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
1  NNNNNNNNNNNNRRRRRRRRRCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
1  NNNNNNNNNNNNRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
81  AATCCCTAAATACCTAATTCCCTAAACCCGAAACCGGTTTCTCTGGTTGAAAATCATTGTGTATATAATGATAATTTTAT  chr1.fa
81  NNNNNNNNNNNNNNNNNNNNNNNAAACNNNNNNNNNNNNNNNNNNNNNGAAAANNNNNNNRNNNNNNNNNNNNNNNNNNN  bay-0.fa
81  NNNNNNNNNNNNNNNNNNNNNNNNAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  bor-4.fa
81  NNNNNNNNNNNNNNNNNNNNNNNAAACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  br-0.fa
81  NNNNNNNNNNNNNNNNNNNNNNNNAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  bur-0.fa
81  NNNNNNNNNNNNNNNNNNNNNNNAAACCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  c24.fa
81  NNNNNNNNNNNNNNNNNNNNNNNNAACCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  col-0.fa
81  NNNNNNNNNNNNNNNNNNNNNNNNAACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  cvi-0.fa
81  NNNNNNNNNNNNNNNNNNNNNNNAAACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  est-1.fa
81  NNNNNNNNNNNNNNNNNNNNNNNAAACCCGAAANNNNNNNCTCTGGTTGAAAATCNNNNNRNNNNNNNNNNNNNNNNNNN  fei-0.fa
81  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  got-7.fa
81  NNNNNNNNNNNNNNNNNNNNNNNAAACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  ler-1.fa
81  NNNNNNNNNNNNNNNNNNNNNNNNAACCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  lov-5.fa
81  NNNNNNNNNNNNNNNNNNNNNNNAAACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  nfa-8.fa
81  NNNNNNNNNNNNNNNNNNNNNNNAAACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  rrs-10.fa
81  NNNNNNNNNNNNNNNNNNNNNNNAAACCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  rrs-7.fa
81  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  sha.fa
81  NNNNNNNNNNNNNNNNNNNNNNNAAACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  tamm-2.fa
81  NNNNNNNNNNNNNNNNNNNNNNNAAACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  ts-1.fa
81  NNNNNNNNNNNNNNNNNNNNNNNNAACCCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  tsu-1.fa
81  NNNNNNNNNNNNNNNNNNNNNNNNNACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNN  van-0.fa
 
161  CGTTTTTATGTAATTGCTTATTGTTGTGTGTAGATTTTTTAAAAATATCATTTGAGGTCAATACAAATCCTATTTCTTGT  chr1.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bay-0.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
161  NNNNNNNNNNNNNNNNNNTNTTGTTGTNNGTANNNRNNNNRNNNNNNNNATNTGAGGTCAATACAAATNNNNNNNNNNNN  fei-0.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
161  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
241  GGTTTTCTTTCCTTCACTTAGCTATGGATGGTTTATCTTCATTTGTTATATTGGATACAAGCTTTGCTACGATCTACATT  chr1.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCNACGATCNNNNNN  bay-0.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTTTNNNNNNNNNNNNNNN  bor-4.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTTTNNNNNNATCTNNNNN  br-0.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGATACAAGCTTTGCTACGATCTACATT  bur-0.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCNACGATCNANNNN  col-0.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATACAAGCTTTGCTACGATCTACATT  cvi-0.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNNN  est-1.fa
241  NNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCNNNNNNNNNNNNNNTGGATACAAGCTTTGCTACGATCTACATT  fei-0.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTTGCTACGATCTACATT  got-7.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAAGCTTTGCTACGATCTACATT  lov-5.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCNNNNNNNNNNNNNNNNNN  nfa-8.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTTGCNACNNNNNNNNNN  rrs-7.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
241  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGCTACGATCTNNNNN  van-0.fa
 
321  TGGGAATGTGAGTCTCTTATTGTAACCTTAGGGTTGGTTTATCTCAAGAATCTTATTAATTGTTTGGACTGTTTATGTTT  chr1.fa
321  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bay-0.fa
321  NNGGAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
321  NNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
321  TGGGAATGTGAGTNNNNNNNNNNNNNNNNNNNGTTGGTTTATCTCNNNNNNNNNNTTAATTGTTTGGACTGTTTNTGTTT  bur-0.fa
321  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
321  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
321  TGGGANTGTGAGNNNNNNNNGNNNNNNNNNNNNNNNNNTTNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  cvi-0.fa
321  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
321  TGGGAATGTGAGTCTCTTATTGTAACCTTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTTTGGANTGNNNNNNNTT  fei-0.fa
321  TGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
321  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
321  TGGGAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNTGTTN  lov-5.fa
321  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
321  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
321  NNNNNNTNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGTNN  rrs-7.fa
321  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
321  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
321  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
321  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
321  TGGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
visited.