Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 16501543 - 16502406


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
16501543  TTGCACAACATGTCTGCAATATTGTCTCTTATTTGTTTCATAAGTTCTCCATCTGCTACATCATTTGCTTCTTTGTCATC  chr1.fa
16501543  NNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNNNNNNNNRNRRRRNNNNNNNNNNNNRNNNNNNN  bay-0.fa
16501543  NNNNNNNACANGTRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNTCCATCTRCRRRRNCATTTGCTTNNRNNTCATC  bor-4.fa
16501543  TTGCACAACATGTRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNTCCATCTRCRRRRTCNTTTGCTNCNRNNNCATC  br-0.fa
16501543  NNNNNCAACATGNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNTCCATCNRCRRRRNCATTTGCTTCNRTGNCATC  bur-0.fa
16501543  TTGCACAACANNNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNNNNNNNNRNRRRRNCNTTTGCTNNNRNNNCATC  c24.fa
16501543  TTGCACAACATGTRRRRRRRRRRRRRRRRRRNNNNNRNNNNNARTTCTCCATCTRCRRRRTCATTTGCTNNNRNNNCATC  col-0.fa
16501543  NNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNNNNNNNNRNRRRRNNNNNNNNNNNNRNNNNNNN  cvi-0.fa
16501543  NNNNNCAACATNNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNTCCANCTRCRRRRTCATTTGCTTNNRNNNCATC  est-1.fa
16501543  NNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNNNNNNNNRNRRRRNNNTTTGCTNNNRNNNNNNC  fei-0.fa
16501543  NNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNTCCANNNRCRRRRTCATTTGCNTNNRNNNCNNN  got-7.fa
16501543  NNNNNNAACANGNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNTCCANCTRCRRRRTCATTTGCTTNNRTGTCATC  ler-1.fa
16501543  NNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNTCCANCNRCRRRRTCATTTGCTTNNRNNNCATC  lov-5.fa
16501543  NNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNTCCANNNRCRRRRNCNTTTGCTNNNRNNNCATC  nfa-8.fa
16501543  NNGCACAACATGTRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNCTCCATCTRCRRRRTCATTTGCTTCTRTGTCATC  rrs-10.fa
16501543  TTGCACAACATGNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNTCCATCTRCRRRRTCATTTGCTTCNRNNTCATC  rrs-7.fa
16501543  NNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNTCCANNNRNRRRRNCNTTTGCTNNNRNNNCNTC  sha.fa
16501543  NTNCACAACANGTRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNTCCATCTRCRRRRTCATTTGCTNNNRNNNCATC  tamm-2.fa
16501543  TTGCACAACANGNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNTCCATCTRCRRRRTCNTTTGCTNNNRNNTCATC  ts-1.fa
16501543  NNNNNNAACATGNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNNNNNNNNRNRRRRNNNNNNNNNNNNRNNNNNNN  tsu-1.fa
16501543  NNNNACAACANGNRRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNTCCATNTRCRRRRTNATTTGCTNNNRTGTCATC  van-0.fa
 
16501623  TAACTCAGGCTCCCAATCTGTATTGTTTATGAAATTGTGTAATCTCATTGTAGTCATTACCACTCTCTTTTGTATTTGAA  chr1.fa
16501623  NNNNNRNRRRRNNNRRRRNGNNTTNNNNNNNAAANTNRRRRANRRRRRRRTNRRRRRRRRRRRNNNRRRRTNNNNNNNNN  bay-0.fa
16501623  TAACTRARRRRCCCRRRRNNNNNNNNNNNNNNNNNNNRRRRNNRRRRRRRTNRRRRRRRRRRRNCNRRRRNNNNNNNNNN  bor-4.fa
16501623  TAACTRARRRRCCCRRRRTGTNNNNNNNNNNAAANNNRRRRATRRRRRRRNNRRRRRRRRRRRNNNRRRRNNNNNNNNNN  br-0.fa
16501623  TAACTRARRRRCCCRRRRTGNNTTGTTTNTGAAATTGRRRRANRRRRRRRTNRRRRRRRRRRRNCNRRRRNNNNNNNNNN  bur-0.fa
16501623  TAACTRARRRRCCNRRRRNNNNNNNNNNNNNNAANNGRRRRNNRRRRRRRNNRRRRRRRRRRRNNNRRRRNNNNNNNNNN  c24.fa
16501623  TAACTRARRRRCCCRRRRTGNNNNNNNNNNNNNANNGRRRRATRRRRRRRTARRRRRRRRRRRTNTRRRRNNNNNNNNNN  col-0.fa
16501623  NNNNNRNRRRRNNNRRRRNNNNNNNNNNNNNNNNNNNRRRRNNRRRRRRRNNRRRRRRRRRRRNNNRRRRNNNNNNNNNN  cvi-0.fa
16501623  TAACTRARRRRCCCRRRRNNNNNNNNNNNNNNNNNNNRRRRNNRRRRRRRNNRRRRRRRRRRRNNNRRRRNNNNNNNNNN  est-1.fa
16501623  TAACNRNRRRRNCNRRRRNNNNNNNNNNNNNNNNNNNRRRRNNRRRRRRRNNRRRRRRRRRRRNNNRRRRNNNNNNNNNN  fei-0.fa
16501623  NNNNNRARRRRNNNRRRRNNNNNNNNNNNNNNNNNNNRRRRNNRRRRRRRNNRRRRRRRRRRRNNNRRRRNNNNNNNNNN  got-7.fa
16501623  TAACTRARRRRCCNRRRRNNNNNNNNNNNNNAAATNGRRRRNNRRRRRRRNNRRRRRRRRRRRNNNRRRRNNNNNNNNNN  ler-1.fa
16501623  TAACTRARRRRCCCRRRRNNNNNNNNNNNNNNNNNNNRRRRNNRRRRRRRNNRRRRRRRRRRRNNNRRRRNNNNNNNNNN  lov-5.fa
16501623  TAACTRARRRRCCCRRRRNNNNNNNNNNNNNNNANNNRRRRNNRRRRRRRTNRRRRRRRRRRRNNNRRRRNNNNNNNNNN  nfa-8.fa
16501623  TAACTRARRRRCCCRRRRNGNNNNNNNNNNNNNNNNNRRRRNNRRRRRRRTNRRRRRRRRRRRNNNRRRRNNNNNNNNNN  rrs-10.fa
16501623  TAACTRARRRRCCCRRRRTNNNNNNNNNNNNNNNNNNRRRRNTRRRRRRRTARRRRRRRRRRRNCNRRRRNNNNNNNNNN  rrs-7.fa
16501623  TAACTRARRRRCCCRRRRNNNNNNNNNNNNNNNNNNNRRRRNNRRRRRRRNNRRRRRRRRRRRNNNRRRRNNNNNNNNNN  sha.fa
16501623  TAACTRARRRRCCCRRRRNGNNNNNNNNNNGAAANNNRRRRNTRRRRRRRNNRRRRRRRRRRRNNNRRRRNNNNNNNNNN  tamm-2.fa
16501623  TAACTRARRRRCCCRRRRTGNNNNNNTTNTGAAATNNRRRRNNRRRRRRRNNRRRRRRRRRRRTNNRRRRNNNNNNNNNN  ts-1.fa
16501623  NANNNRARRRRCCNRRRRTGNNNNNNNNNNNNNNNNNRRRRNTRRRRRRRTNRRRRRRRRRRRNNNRRRRNNNNNNNNNN  tsu-1.fa
16501623  TAACTRARRRRCCCRRRRNNNNNNNNNNNNNNNNNNNRRRRNTRRRRRRRNNRRRRRRRRRRRNNNRRRRNNNNNNNNNN  van-0.fa
 
16501703  TATTATATCTTGCGAAATCTCAAAGAATTCTCCATTTCTTCAACAAACTCCAAAAGTTCTCTTAATACTAAACGTAATGA  chr1.fa
16501703  NNNNNTATCTTGCGAAATCTCANNNNNNNNNNNATTNCTTCAACAAANTCCANARNNNCNCTNNNNNNNNAACGTAANGA  bay-0.fa
16501703  NNNNNNNNNNTGCGAAATCTCANNNNNNNNNNNNNNNNTTCANCAAACTCCNAARNNNNNNNNNNNNNNNNNCGTAANGA  bor-4.fa
16501703  NNNNNNNNCTTGCGAAATCTCAANNNNNNNTCCATTTCTTCAACAAACTCCAAARGNNCNNNNNNNNNNAAACGTAANGA  br-0.fa
16501703  NNNNNNNTCTTGCGAAATCTCAANNNNNNNTCCATTTCTNCAACAAACTCCAAARGNNCTNNNNNNNNNNAACGTAATGA  bur-0.fa
16501703  NNNNNNNNNNTGCGAAATCTCANNNNNNNNNNNATTTCTNCAACAAACTCCANNRNNNNNNNNNNNNNNNAACGTAANGA  c24.fa
16501703  NNNNNNNNCTTGCGAAATCTCANNNNNNNNNCCATTTCTTCAACAAACTCCAAARGNNNNNNNNNNNNNNNNCGTAATGA  col-0.fa
16501703  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
16501703  NNNNNNNNNNTGCGAAATCTCANNNNNNNNNNNNNTNCTTCAACAAACTCCNNNRNNNNNNNNNNNNNNNNACGTAANGA  est-1.fa
16501703  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCNNNRNNNNNNNNNNNNNNNNNNNNNANNN  fei-0.fa
16501703  NNNNNNNNNNNNNNNAATCNCNNNNNNNNNNNNNNNNNNNNNACNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNAANGN  got-7.fa
16501703  NNNNNNNNCTTGCGAAATCTCANNNNNNNNNNNNTTTCTTCAACAAACTCCNNNRNNNNNNNNNNNNNNNNACGTAANGA  ler-1.fa
16501703  NNNNNNNNNTTGCGAAATCTCNNNNNNNNNNNNNNNTCTTCAACAAACTCCNNNRNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
16501703  NNNNNNNNNNNGCGAAATCTCNNNNNNNNNNNNNNNNNNTCAACAAACTCCNNNRNNNNNNNNNNNNNNNNNCGTAANGN  nfa-8.fa
16501703  NNNNNNNNNNTGCGAAATCTCAANNNNNNNNNCATTTCTTCAACAAACTCCAAARNNNNNNNNNNNNNNNNNCGTAATGA  rrs-10.fa
16501703  NNNNNNNNNNNNCGAAATCTCANNNNNNNNNNNATTTCTTCAACAAACTCCAANRNNNNNNNNNNNNNNNNNCGTAATGA  rrs-7.fa
16501703  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCCNNNRNNNNNNNNNNNNNNNNNNNNNANNN  sha.fa
16501703  NNNNNNNNCTTGCGAAATCTCAANNNNNNNNNCATTTCTTCAACAAACTCCAAARNNNNNNNNNNNNNNNNACGTAATGA  tamm-2.fa
16501703  NNNNNNNTCTTGCGAAATCNCANNNNNNNNNNNNTNNCNTCAACAAACTCCAAARNNNNNNNNNNNNNNNNNCGTAANGA  ts-1.fa
16501703  NNNNNNNNCTTGCGAAATCNCNNNNNNNNNNNNNNNNNNNCAACAAACTCCANNRNNNNNNNNNNNNNNNNACGTAANGA  tsu-1.fa
16501703  NNNNNNNNCTTGCGAAATCNCANNNNNNNNNNNANNNNNTCAACAAACTCCNNNRNNNNNNNNNNNNNNNNNCGTAANGA  van-0.fa
 
16501783  TGCATGACATCGATTAAACAGTTGTTTCTTATTTCTTGTAGGTAGTCCGGAATAGAACTGCGACATATGATACCTAACAC  chr1.fa
16501783  RRRRRRRRRRRRRTNNAANANNTNNNNNNNNNNNNNNNNNNNNGNNNNNGAATNGARRRRRRRRRRRTGATACCTAACAC  bay-0.fa
16501783  RRRRRRRRRRRRRTNNANNNNNNNNNNNNNNNNNNNNNNNNNNGNNCCGGAATAGARRRRRRRRRRRTGATACCTAACAC  bor-4.fa
16501783  RRRRRRRRRRRRRTNAAACAGNNNNNNNNNNNNNNNNGTAGNNGNNNCGGAATAGARRRRRRRRRRRTGATACCTAACAC  br-0.fa
16501783  RRRRRRRRRRRRRTTAAACAGTTGNTTNTTNNNNNNNNTNNNNGGTCCGGAATAGARRRRRRRRRRRTGATACCTAACAC  bur-0.fa
16501783  RRRRRRRRRRRRRTNNAACANNNNNNNNNNNNNNNNNNNNNNNGNNNNNGAATNGARRRRRRRRRRRTGATACCTAACAC  c24.fa
16501783  RRRRRRRRRRRRRTTAAACAGNNNNNNNTTNNNNNTTGTAGGTAGTCCGGAATAGARRRRRRRRRRRTGATACCTAACAC  col-0.fa
16501783  RRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRNNNNNNNNNNNNN  cvi-0.fa
16501783  RRRRRRRRRRRRRTNAAACAGNNNNNNNNNNNNNNNNNNNNNNGGTCCGGAATAGARRRRRRRRRRRTGATACCTAACAC  est-1.fa
16501783  RRRRRRRRRRRRRNNNANNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNGGAATNGARRRRRRRRRRRTGATACCTAACAC  fei-0.fa
16501783  RRRRRRRRRRRRRTNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRTGATANNNNNNAC  got-7.fa
16501783  RRRRRRRRRRRRRTNNAACANNNNNNNNNNNNNNNNNNNNNNNGNNNCGGAATAGARRRRRRRRRRRTGATACCTAACAC  ler-1.fa
16501783  RRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNCCGGAATAGARRRRRRRRRRRTGATACCTAACAC  lov-5.fa
16501783  RRRRRRRRRRRRRTNANNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNGAATAGARRRRRRRRRRRTGATACCTAACAC  nfa-8.fa
16501783  RRRRRRRRRRRRRTNAANCANNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRTGATACCTAACAC  rrs-10.fa
16501783  RRRRRRRRRRRRRTNAAACNNNNNNNNNNNNNNNNNNNNNNNNGNTCCGGAATAGARRRRRRRRRRRTGATACCTAACAC  rrs-7.fa
16501783  RRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNGAATNGARRRRRRRRRRRTGATACCTNACAC  sha.fa
16501783  RRRRRRRRRRRRRTTAAACAGTTGNNNNTNNNNNNNNNNNNNTGGTCCGGAATAGARRRRRRRRRRRTGATACCTAACAC  tamm-2.fa
16501783  RRRRRRRRRRRRRTNAAACAGTNNNNNNNNNNNNNNNNNNNNNGGTCCGGAATAGARRRRRRRRRRRTGATACCTAACAC  ts-1.fa
16501783  RRRRRRRRRRRRRTNNANCNNNNNNNNNNNNNNNNNNNNNNNNGGTCCGGAATAGARRRRRRRRRRRTGATACCTAACAC  tsu-1.fa
16501783  RRRRRRRRRRRRRTNANNCNNNNNNNNNNNNNNNNNNNNNNNNGNNNCGGAATAGARRRRRRRRRRRTGATACCNAACAC  van-0.fa
 
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACATTTTGTCTGTTTGGATAGCAAGAATCAACGACGTAGTACTTTTCT  chr1.fa
16501863  TTCTACATCTTGATGAGCTGNAAAGAGCCAAAACATTTTNTCNGTTTNGRNAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  bay-0.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACATTTTGTCTGTTTGGRTANCRRRRRRRRRRRRRRRRRRRRRRRRRR  bor-4.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACATTTTGTCTGTTTGGRTAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  br-0.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACATTTTGTCTGTTTGGRTAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  bur-0.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACNNNNNNTCTGTTTGGRNAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  c24.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACATTTTGTCTGTTTGGRTAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  col-0.fa
16501863  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRRRRRRRRRRRRRRRRRRRRRRRRRR  cvi-0.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACATTTTGTCNGTTTGGRTAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  est-1.fa
16501863  TTCNNNNTNNNNNTGAGCTGNAAAGAGNNNNNNNNNNNNNNNNNTTNGGRNAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  fei-0.fa
16501863  TTCTACATCTTNATGAGCTGTAAAGAGCCAANNNNNNNNNNNTGTTNNGRTAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  got-7.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACATTTTGTCTGTTTGGRTAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  ler-1.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACNNNNNNNNTGTTNNNRTAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  lov-5.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACANTNTGTCTGTTNGGRNNGCRRRRRRRRRRRRRRRRRRRRRRRRRR  nfa-8.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACATTTTGTCTGTTTGGRTAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  rrs-10.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACATTTTGTCTGTTTGGRTAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  rrs-7.fa
16501863  TTCNACATCTTGANGAGCTGTAAAGAGCCAAAACANNNNNNNNGTTNNGRNAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  sha.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACATTTTGTCTGTTTGGRTAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  tamm-2.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACATTTTGTCTGTTTGGRTAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  ts-1.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACATTTTGTCTGTTTGGRTAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  tsu-1.fa
16501863  TTCTACATCTTGATGAGCTGTAAAGAGCCAAAACATTTTGTCTGTTTGGRTAGCRRRRRRRRRRRRRRRRRRRRRRRRRR  van-0.fa
 
16501943  AGCGGAAGCAAGGGAATATCAGAATCACTTCATTGTGTCATTGTAAGAACAGTTGTGTCGTGATATGATCCCATTGCTTC  chr1.fa
16501943  RRRRNNRNNNNNNNAARNNCANAATCACNTCRTTNTGTCATTGTAAGAACAGTTGTGTCGTGATATGATCCCATTGCTTC  bay-0.fa
16501943  RRRRGARGCAAGGGAARNTCAGAATCACNTNRNTNTGTCATTGTAAGAACAGTTGTGTCGTGATATGATCCCATTGCTTC  bor-4.fa
16501943  RRRRGARGCAAGGGAARANCAGAATCACTTCRTTGTGTCATTGTAAGAACAGTTGTGTCGTGATATGATCCCATTGCTTC  br-0.fa
16501943  RRRRGARGCAAGGGAARNTCAGAATCACTTCRTTGTGTCATTGTAAGAACAGTTGTGTCGTGATATGATCCCATTGCTTC  bur-0.fa
16501943  RRRRGARGCAAGGGAARNNCAGAATCACNTCRTTNTGTCATTGTAAGAACAGTTGTGTCGTGANATGATCCCATTGCTTC  c24.fa
16501943  RRRRGARGCAAGGGAARNNCAGAATCACTTCRTTGTGTCATTGTAAGAACAGTTGTGTCGTGATATGATCCCATTGCTTC  col-0.fa
16501943  RRRRNNRNNNNNNNNNRNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
16501943  RRRRGNRNNNNNNNNGRNNNNNNNNNACNNCRTTGTGTCATTGTAAGAACNNNNNNNNNGNNANATGATCCCATTGCTTC  est-1.fa
16501943  RRRRNNRCNNNNNNNNRNNNNNNNNNNCNNNRNNNTNTNNTNGTAAGAACAGTNGTGTCGTGATATGATCCCATTGCTTC  fei-0.fa
16501943  RRRRGARGCAAGGNNNRNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNACAGTTGTGTCGTGATATGATCCCATTGCTTC  got-7.fa
16501943  RRRRGARGCAAGGGNNRNNNNNNNNNNNNNNRNNNNNNNNNTGTAAGAACAGTTGTGTCGTGATATGATCCCATTGCTTC  ler-1.fa
16501943  RRRRGARGCAAGGGANRNNNAGANTCACNNCRTNNTNTCATTGTAAGAACAGTTGTGTCGTGATATGATCCCATTGCTTC  lov-5.fa
16501943  RRRRGARGCAAGGGAARNNCAGAATCACNNCRNTNTGTCATTGTAAGAACAGTTGTGTCGTGATATGATCCCATTGCTTC  nfa-8.fa
16501943  RRRRGARGCAAGGGAARNNCAGAATNNNNNNRNNNNNCNNNNNNNNNAACAGTTGTGTCGTGATATGATCCCATTGCTTC  rrs-10.fa
16501943  RRRRGARNNNNNNNNGRNNNNNNNNNACNNCRTTGTGTCATTGTAAGAANNNNNNNNNNNNNNNATGATCCCATTGCTTC  rrs-7.fa
16501943  RRRRGARNCAAGGNNNRNNNNNNNNNNCNNNRNNNTGTCATTGTAAGAACAGTTGTGTCGTGATATGATCCCATTGCTTC  sha.fa
16501943  RRRRNNRCNNNNGNNNRNNNAGAATCACTTCRTTGTGTCATTGTAAGAACAGTTGTGTCGTGATATGATCCCATTGCTTC  tamm-2.fa
16501943  RRRRGARGCAAGGGAARATCAGAATCACTTCRTTGTGTCATTGTAAGAACAGTTGTGTCGTGATATGATCCCATTGCTTC  ts-1.fa
16501943  RRRRNNRNNNAGGGAARANCAGAATCACTTCRTTGTGTCATTGTAAGAACAGTTGTGTCGTGATATGATCCCATTGCTTC  tsu-1.fa
16501943  RRRRGARGCAAGGGAARNNCANAATCACTNCRTTNTGTCATTGTAAGAACAGTTGTGTCGTGATATGATCCCATTGCTTC  van-0.fa
 
16502023  ATTCAAAATATATGTGAATAACATATTCAAAGATGCATTATCGTGTCGATTCAAATACATTTCTTGTAATTCAGGCTTCA  chr1.fa
16502023  ATTCAANNNNNRRRRRRRRRRNNNRNNNAAANNNRRRRRRRRRRRRRRRTTCRAANNNNNNNNTTNNNRTRRRRRRRRRR  bay-0.fa
16502023  ATTCNNNNNNNRRRRRRRRRRNNNRNNNNNNNNNRRRRRRRRRRRRRRRNNCRNNNNNNNNNNNNNNNRNRRRRRRRRRR  bor-4.fa
16502023  ATTCAANNNNNRRRRRRRRRRNNNRNNNAAAGATRRRRRRRRRRRRRRRTTCRNNNNNNNNNNNNNNNRNRRRRRRRRRR  br-0.fa
16502023  ATTCAANNNNNRRRRRRRRRRNNNRNNNAAAGNTRRRRRRRRRRRRRRRTTCRAANACNNNNNNTGNARTRRRRRRRRRR  bur-0.fa
16502023  ATTCAANNNNNRRRRRRRRRRNNNRNNNNNNNNTRRRRRRRRRRRRRRRNNNRNNNNNNNNNNNNNNNRNRRRRRRRRRR  c24.fa
16502023  ATTCAANNNNNRRRRRRRRRRNNNRNNNAAAGATRRRRRRRRRRRRRRRTTCRANNNNNNNNNNTGNARTRRRRRRRRRR  col-0.fa
16502023  NNNNNNNNNNNRRRRRRRRRRNNNRNNNNNNNNNRRRRRRRRRRRRRRRNNNRNNNNNNNNNNNNNNNRNRRRRRRRRRR  cvi-0.fa
16502023  ATTCANNNNNNRRRRRRRRRRNNNRNNNNNANNTRRRRRRRRRRRRRRRTTCRNANNNNNNNNNNNNNRTRRRRRRRRRR  est-1.fa
16502023  ATNNNNNNNNNRRRRRRRRRRNNNRNNNNNNNNNRRRRRRRRRRRRRRRNNNRNNNNNNNNNNNNNNNRNRRRRRRRRRR  fei-0.fa
16502023  NNNNNNNNNNNRRRRRRRRRRNNNRNNNNNNNNNRRRRRRRRRRRRRRRNNNRNNNNNNNNNNNNNNNRNRRRRRRRRRR  got-7.fa
16502023  ATTCANNNNNNRRRRRRRRRRNNNRNNNNAANNTRRRRRRRRRRRRRRRNNNRNNNNNNNNNNNNNNNRTRRRRRRRRRR  ler-1.fa
16502023  ATNNNNNNNNNRRRRRRRRRRNNNRNNNNNNNNNRRRRRRRRRRRRRRRTNNRNNNNNNNNNNNNNNNRNRRRRRRRRRR  lov-5.fa
16502023  ATTCAANNNNNRRRRRRRRRRNNNRNNNNNANNTRRRRRRRRRRRRRRRNTNRNNNNNNNNNNNNNNNRNRRRRRRRRRR  nfa-8.fa
16502023  ATTCANNNNNNRRRRRRRRRRNNNRNNNNAAGATRRRRRRRRRRRRRRRTTCRNNNNNNNNNNNNNNNRTRRRRRRRRRR  rrs-10.fa
16502023  ATTCANNNNNNRRRRRRRRRRNNNRNNNNNNGNTRRRRRRRRRRRRRRRTNNRNNNNNNNNNNNNNNNRTRRRRRRRRRR  rrs-7.fa
16502023  ATNNNNNNNNNRRRRRRRRRRNNNRNNNNNNNNTRRRRRRRRRRRRRRRNNNRNNNNNNNNNNNNNNNRNRRRRRRRRRR  sha.fa
16502023  ATTCAAANNNNRRRRRRRRRRNNNRNNNNNANNTRRRRRRRRRRRRRRRNNNRNNNNNNNNNNNTNNNRTRRRRRRRRRR  tamm-2.fa
16502023  ATTCAANNNNNRRRRRRRRRRNNNRNNNNNANNTRRRRRRRRRRRRRRRNNNRNNNNNNNNNNNNNNNRNRRRRRRRRRR  ts-1.fa
16502023  NTTCAANNNNNRRRRRRRRRRNNNRNNNNNNNATRRRRRRRRRRRRRRRTNCRNNNNNNNNNNNNNNNRTRRRRRRRRRR  tsu-1.fa
16502023  ATTNNNNNNNNRRRRRRRRRRNNNRNNNNNNNATRRRRRRRRRRRRRRRNNNRNNNNNNNNNNNNNNNRNRRRRRRRRRR  van-0.fa
 
16502103  CTTTTACACAAACATGAGTCCCATCCATAGCTCCAACAAATCCACTAAAATATGGCCAATATCTTTGATCTACTTGAAGT  chr1.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNGNNRR  bay-0.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNNNNRR  bor-4.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNNAARR  br-0.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGRNNNNNRTGAARR  bur-0.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNGNNRR  c24.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNCRTGNARR  col-0.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNNNNRR  cvi-0.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNNNNRR  est-1.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNNNNRR  fei-0.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNNNNRR  got-7.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNGNNRR  ler-1.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNNNNRR  lov-5.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNNNNRR  nfa-8.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNNNNRR  rrs-10.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNGNNRR  rrs-7.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNNNNRR  sha.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNGANRR  tamm-2.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNNNNRR  ts-1.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNNNNRR  tsu-1.fa
16502103  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNRNNNNNRNNNNRR  van-0.fa
 
16502183  CTTTCAGGAATTCGATGTAGATCTTGAGTTATTGGAGTTCTAATATAATCACATGCTAGTAATTCAATTGCCGTAAGAAA  chr1.fa
16502183  RRRRRRGGAATTCGNRRRNGRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNR  bay-0.fa
16502183  RRRRRRGGAATTCGARRRNNRTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNR  bor-4.fa
16502183  RRRRRRGGAATTCGARRRAGRTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTTGCCGTAAGAAR  br-0.fa
16502183  RRRRRRNNNNNNNNNRRRNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTTGCCGTAANAAR  bur-0.fa
16502183  RRRRRRGGAATTCGARRRNGRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTNGCCGTAAGAAR  c24.fa
16502183  RRRRRRGGAATTCGARRRAGRTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTTGCCGTAAGAAR  col-0.fa
16502183  RRRRRRNNNNNNNNNRRRNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNR  cvi-0.fa
16502183  RRRRRRGGAATTCGARRRNGRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNGCCGTAAGNAR  est-1.fa
16502183  RRRRRRGGAATTNGNRRRNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCCGTAANNNR  fei-0.fa
16502183  RRRRRRGGNATNCNARRRNGRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNGCCGTAANANR  got-7.fa
16502183  RRRRRRGGAATTCGARRRNGRTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTNNCCNNNNNNNR  ler-1.fa
16502183  RRRRRRGGAATTCNARRRANRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTNGCCGTAANAAR  lov-5.fa
16502183  RRRRRRGGAATTNGARRRNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCCGNAAGNAR  nfa-8.fa
16502183  RRRRRRGGAATTCGARRRAGRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTTGCCGTAAGAAR  rrs-10.fa
16502183  RRRRRRGGAATTCGARRRAGRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTTGCCGTAAGAAR  rrs-7.fa
16502183  RRRRRRGGNATTNGNRRRNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCCGTAAGANR  sha.fa
16502183  RRRRRRGGAATTCGARRRNGRTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTNGCCGTAAGANR  tamm-2.fa
16502183  RRRRRRGGAATTCGARRRNGRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTTGCCGTAAGAAR  ts-1.fa
16502183  RRRRRRGGAATTCGARRRNGRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNR  tsu-1.fa
16502183  RRRRRRGGAATTCGARRRNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNGCCGTAAGAAR  van-0.fa
 
16502263  TTCCCCAAATTTTCTCTTCCATGGTCTCCTGATTTCGTCCAAAATGCAAACCAACATCTCTTTATGAACTTCGTTATGCC  chr1.fa
16502263  NNNRNNNAANTTTCTCTTCNNNNNTCTCCTGATTTCGTCCAANNNNNNAACCNNNNNNTCTTTNTGAACTTCGNTNRRRR  bay-0.fa
16502263  NNNRNNNNNNTTTCTCTTCCATNGTCTCCTGATTTCGTCCAAAATGCAAACCAACANNNNNNNNNNNNCTTCGTTARRRR  bor-4.fa
16502263  TTCRNNNAATTTTCTCTTCCATGGTCTCCTGATTTCGTCCAAAANGCAAACCAACANCTCTTTATGAACTTCGTTARRRR  br-0.fa
16502263  TTNRNCNANTTTTCTCTTCCATGGTCTCCTGATTTCGTCCAAAATGCAAACCAACATCTCTTTATGAACTTCGTTARRRR  bur-0.fa
16502263  NTCRNNNAANTTTCTCTTNNNNNNTCTCCTGATTTCGTCCAAAATGCAAACCAACNNNNNNNNNNNNACTTCGTTARRRR  c24.fa
16502263  TTNRNNNAANTTTCTCTTCCATGGTCTCCTGATTTCGTCCAAAATGCAAACCAACATCTCTTTNTGAACTTCGTTARRRR  col-0.fa
16502263  NNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRR  cvi-0.fa
16502263  NTCRNNNAATTTTCTCNNNNNNNGTCTCCTGATTTCGTCCAAAATGCAAACCAACATCNCTTTATGAACTTCGTTARRRR  est-1.fa
16502263  NNNRNNNNNNNNNNNNNNNNNNNNNNTCCTGATTTCGTCCAAAANGCAANNNNNNNNNNNNNNNNNNNCTTCGNTNRRRR  fei-0.fa
16502263  NNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTNARRRR  got-7.fa
16502263  NNNRNNNNNNNNNCTCTTCCATGGTCTCCTGATTTCGTCCAAAATGCAAACCNACATCTCTTTNTGAACTTCGTTARRRR  ler-1.fa
16502263  NNNRNNNNNTNTTCTCTTCCATGGTCTCCTGATTTCGTCCAAAATGCAAACCAACATCTCTTTNTGAACTTCGTTARRRR  lov-5.fa
16502263  NNNRNNNNNTNTTCTCNNNNNNNGTCTCCTGATTTCGTCCAAAATGCAAACCAACNNNNNNNNNNNNACTTCGTTARRRR  nfa-8.fa
16502263  TTCRCNNAATTTTCTCTTCCATGGTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTTCGTTARRRR  rrs-10.fa
16502263  TTNRNNNAATTTTCTCTTCCATGGTCTCCTGATTTCGTCCAAAATGCAAACCAACATCTCTTTANGAACTTCGTTARRRR  rrs-7.fa
16502263  NNNRNNNNNNNNNNNNNNNNNNNNTCTCCTGATTTCGTCCAAAANGNNANNNNNNNNNNNNNNNNNNNCTTCGTTNRRRR  sha.fa
16502263  NNNRNNNAATTTTCTCTTCCATGGTCTCCTGATTTCGTCCAAAANGCAAACCNNNNNNNNTTTATGAACTTCGTTNRRRR  tamm-2.fa
16502263  NNNRNNNAANNNNNTCTTCCATGGTCTCCTGATTTCGTCCAAAANGCAAACCAACATCNCNNTNTGAACTTCGTTARRRR  ts-1.fa
16502263  NNNRNNNNNTTTTCTCTTCCNTGGTCTCCTGATTTCGTCCAAAATGCAAACCAACNNNNNNNTATGAACTTCGTTARRRR  tsu-1.fa
16502263  NTCRNNAAANTTTCTCTTCCATGGTCTCCTGATTTCGTCCAAAATGCAAACCAACATNNCTTTATNAACTTCGTTARRRR  van-0.fa
 
16502343  CACATATTCGTAAAAACATAGCCACACTTTTCTCTTTGAACTTTGTTGTAGACCGTAATTTGTT   chr1.fa
16502343  RRRRRRRRRRRRRRRRRRNNNCCNCACTTTTCTCTNNNNNNNNNNNNNNANNNRRRRRRRRRTT   bay-0.fa
16502343  RRRRRRRRRRRRRRRRRRNNGCCNCACTTTTCTCNNNNNNNNNCNNNNNNNNNRRRRRRRRRTN   bor-4.fa
16502343  RRRRRRRRRRRRRRRRRRNNNCCNCACTTTTCNNNNNNNNNNNCNNNNNAGNCRRRRRRRRRTT   br-0.fa
16502343  RRRRRRRRRRRRRRRRRRNNGNNNCACTTTTCTCTTTGANCTTTGTTGTAGACRRRRRRRRRTT   bur-0.fa
16502343  RRRRRRRRRRRRRRRRRRNNNNCNCACTTTTNNNNNNNNNNNNCNNNNNNNNNRRRRRRRRRNT   c24.fa
16502343  RRRRRRRRRRRRRRRRRRTAGCCACACTTTTCTCTTNNNNNNNTGTTGTAGACRRRRRRRRRTT   col-0.fa
16502343  RRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRNN   cvi-0.fa
16502343  RRRRRRRRRRRRRRRRRRNNNCCACACTTTTCTCNNNNNNNNNCNNNNNANACRRRRRRRRRTT   est-1.fa
16502343  RRRRRRRRRRRRRRRRRRNNNCCNCACTNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRNN   fei-0.fa
16502343  RRRRRRRRRRRRRRRRRRNNNCCACACTTTNNNNTNNNNNNNNNGTTGTANNNRRRRRRRRRNN   got-7.fa
16502343  RRRRRRRRRRRRRRRRRRNNNCCNCACTTTTCTNNNNNNNNNNCNNNNNNNNNRRRRRRRRRTT   ler-1.fa
16502343  RRRRRRRRRRRRRRRRRRNNNCCNCACTTTTCTCNNNNNNNNNCNNNNNNNNCRRRRRRRRRTN   lov-5.fa
16502343  RRRRRRRRRRRRRRRRRRNNGCCACACTTTTCNNNNNNNNNNNCNNNNNNNNNRRRRRRRRRTN   nfa-8.fa
16502343  RRRRRRRRRRRRRRRRRRTAGCCNCACTTTTCTCTTNNNNNNNTGTTGTAGACRRRRRRRRRTT   rrs-10.fa
16502343  RRRRRRRRRRRRRRRRRRNNNCCACACTTTTCTCTNNNNNNNNCNNNNNNGNCRRRRRRRRRTT   rrs-7.fa
16502343  RRRRRRRRRRRRRRRRRRNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRTN   sha.fa
16502343  RRRRRRRRRRRRRRRRRRNAGCCNCACTTTTNNNNNNNNNNNNCNNNNNNNACRRRRRRRRRTT   tamm-2.fa
16502343  RRRRRRRRRRRRRRRRRRNNGCCNCACTTTTCTNNNNNNNNNNCNNNNNNNNNRRRRRRRRRTT   ts-1.fa
16502343  RRRRRRRRRRRRRRRRRRNNGCCNCACTTTTCTCTNNNNNNNNCNNNNNNNNCRRRRRRRRRTT   tsu-1.fa
16502343  RRRRRRRRRRRRRRRRRRNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRTT   van-0.fa
 
visited.