Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 18381591 - 18386021


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
18381591  GAATAGCAGACCATGTATCTTCATAGGCAGCCGGAACCGGATCTTCCGGTGCACGGCGGTATTGAACCGAGACGGCGAGG  chr1.fa
18381591  GAATAGCAGACCATGTATCTTCATAGGCAGCCGGAACCNNNRRRRRNGNNNNNNGGCGGTATTGAACCGAGACGNCRANG  bay-0.fa
18381591  GAATAGCAGACCATGTATCTTCATAGGCAGCCGGAACCGGARRRRRCGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  bor-4.fa
18381591  GAATAGCAGACCATGTATCTTCATAGGCAGCCGGAACCGGARRRRRNGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  br-0.fa
18381591  GAATAGCAGACCATGTATCTTNNNNCNNNGCCGGAACCGGARRRRRNGNTGCACGGCGGTATTGAACCGAGACGGCRNGG  bur-0.fa
18381591  GAATAGCAGACCATGTATCTTCATAGGCAGCCGGAACCNNNRRRRRCGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  c24.fa
18381591  GAATAGCAGACCATGTATCTTCATAGGCAGCCGGAACCGNARRRRRCGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  col-0.fa
18381591  GAATAGCAGACCATGTNNNNNNNNNCNNNNNNGNAACCGGARRRRRCGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  cvi-0.fa
18381591  GAATAGCAGACCATGTATCTTCATAGGCAGCCGGAACCGGNRRRRRCGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  est-1.fa
18381591  GAATAGCAGACCATNNNNNNNNNNNCNNNNCCGNAACCGNNRRRRRNGNNGCACGGCGGTATTGAACCGAGACGGCRAGG  fei-0.fa
18381591  GAATAGCAGACCANNNNNNNNNNNNCNNNNCCGGAACCGGARRRRRCGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  got-7.fa
18381591  GAATAGCAGACCATGTNNNNNNNNNCNNNNCCGGAACCGNARRRRRCGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  ler-1.fa
18381591  GAATNGCAGACCATGNNNNNNNNNNCNNNNCCGNAACCNNNRRRRRCGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  lov-5.fa
18381591  GAATAGCAGACCATGTNNNNNNNNNCNNNGCCGNAACCGNNRRRRRCGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  nfa-8.fa
18381591  GAATAGCAGACCATGTATNTTCANNCNNNGCCGGAACCGGARRRRRNGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  rrs-10.fa
18381591  GAATAGCAGACCATGTNNNNNNNNNCNNNGCCGGAACCGGARRRRRCGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  rrs-7.fa
18381591  GAATAGCAGACCATGTATCNNNNNNCNNAGCCGGAACCNNARRRRRNGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  sha.fa
18381591  GAATAGCAGACCATGTNNNNNNNNNCNNNGCCGNAACCGGNRRRRRNGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  tamm-2.fa
18381591  GAATAGCAGACCATGTATCTTCATAGGCAGCCGNAACCGNNRRRRRCGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  ts-1.fa
18381591  GAATAGCAGACCATGTATCNNNNNNCNNNGCCGGAACCGGARRRRRNGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  tsu-1.fa
18381591  GAATAGCAGACCATGTATCTTCNNNCNCAGCCGGAACCGGARRRRRNGNTGCACGGCGGTATTGAACCGAGACGGCRAGG  van-0.fa
 
18381671  CAGTTAGCGGATTTAACTACCTCCGTGAGGAAATTGTGGTAGATTGGGGAGAAAGGGGATTCGTTTATCCAAGCTCCGCC  chr1.fa
18381671  RRGTTNRRGGATTTAACTACCTCCGTGAGGAAATTGTGGNNNNRNNNNNNGAAAGNNNNTTCGTTTNTCCAAGCTCCGRR  bay-0.fa
18381671  RRGTTARRGGATTTAACTACCNCCGTGAGGAAATTGTGGTNNNRNNNNNNNAAAGGGGATTCGTTTATCCAAGCTCCGRR  bor-4.fa
18381671  RRGTTARRGGNTTTAACTACCTCCGTGAGGAAATTGTGNNNNNRNNNNGAGAAAGGGGATTCGTTTATCCAAGCTCCGRR  br-0.fa
18381671  RRGTTNRRGGATTTAACTACCTCCGTGAGGAAATTGTGGTNNNRNNNGGAGAAAGGGGATTCGTTTATCCAAGCTCCGRR  bur-0.fa
18381671  RRGTTNRRGGATTTAACTACCTCCGTGAGGAAATTGTNNNNNNRNGNGGAGAAAGGGGATTCGTTTATCCAAGCTCCGRR  c24.fa
18381671  RRGTTARRGGATTTAACTACCTCCGTGAGGAAATTGTGGNNNNRNNNNNNGAAAGGGGATTCGTTTATCCAAGCTCCGRR  col-0.fa
18381671  RRGTTARRGGATTTAACTACCTCCGTGAGGAAATTGTGGTNNNRNNNGGAGAAAGGGGATTCGTTTATCCAAGCTCCGRR  cvi-0.fa
18381671  RRGTTARRGGATTTAACTNNNNNNNTGAGGAAATTGNNNNNNNRNNNNNNNAAAGGGGANTCGTTTATCCAAGCTCCGRR  est-1.fa
18381671  RRGTTNRRGGATTTAACNNNNNNNNNGAGGAAATTGTNNNNNNRNNNNNNGAAAGGGGATTCGTTTATCCAAGCTCCGRR  fei-0.fa
18381671  RRGTTARRGGATTTAACNNNNNNNNNGAGGAAATTGTGNNNNNRNNNNNNNNNAGGGGANTCGTTTATCCAAGCTCCGRR  got-7.fa
18381671  RRGTTARRGGATTTAACTACCTCCGTGAGGAAATTGTGGTNNNRNNNGGAGAAAGGGGATTCGTTTATCCAAGCTCCGRR  ler-1.fa
18381671  RRGTTARRGGATTTAACTNNNNNNNTGAGGAAATTGNNNNNNNRNNNGGAGAAAGGNNNNNNGTTTATCCAAGCTCCGRR  lov-5.fa
18381671  RRGTTNRRGGATTTAACTACCTCCGTGAGGAAATTGTGGTNNNRNNNNNNGAAAGGGGATTCGTTTATCCAAGCTCCGRR  nfa-8.fa
18381671  RRGTTARRGGATTTAACTACCTCCGTGAGGAAATTGTGGNNNNRNNNGGAGAAAGGGGNTTCGTTTATCCAAGCTCCGRR  rrs-10.fa
18381671  RRGTTARRGGATTTAACTACCNCCGTGAGGAAATTGTGGNNNNRNNNNNAGAAAGGGGATTCGTTTATCCAAGCTCCGRR  rrs-7.fa
18381671  RRGTTNRRGGATTTAACTACCTCCGTGAGGAAATTGTGGTNNNRNNNGGAGAAAGGGGATTCGTTTATCCAAGCTCCGRR  sha.fa
18381671  RRGTTARRGGATTTAACTNNNNNNNNGAGGAAATTGTGNNNNNRNNNNNNNNAAGGNGATTCGTTTATCCAAGCTCCGRR  tamm-2.fa
18381671  RRGTTNRRGGATTTAACTANNNNNGTGAGGAAATTGTNNNNNNRNNNNNNNNNANGGGATTCGTTTATCCAAGCTCCGRR  ts-1.fa
18381671  RRGTTARRGGATTTAACTACCTCCGTGAGGAAATTGTNNNNNNRNNNNNNNAAAGGGGATTCGTTTATCCAAGCTCCGRR  tsu-1.fa
18381671  RRGTTNRRGGATTTAACTACCTCCGTGAGGAAATTGTNNNNNNRNNNGGAGAAAGGGGATTCGTTTATCCAAGCTCCGRR  van-0.fa
 
18381751  GTGGAAGTAGATAAGTAGAGGGAGTTTGTTACCGGCGGCGAGTTGTGTTGATTTGTGAGGGAGAAAGAGACGAACGGAGA  chr1.fa
18381751  RRRRRRRRRRRRNNNNNGRRRRRRRRTNNTACCGGCGNRGNNNNRNNNTGATTTNNNRRRRRRRRRRRRRRRRRRRNNGA  bay-0.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRTGNTACCGGCGGRGANNNRNGTTGATTTNNNRRRRRRRRRRRRRRRRRRRGAGA  bor-4.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRTGTTACCGGCGGRGNNTNRNGNTGATTTGNGRRRRRRRRRRRRRRRRRRRGAGA  br-0.fa
18381751  RRRRRRRRRRRRNNNNNGRRRRRRRRTGTTACCGGCGGRGNNNNRNNNTGATTTGNGRRRRRRRRRRRRRRRRRRRGAGA  bur-0.fa
18381751  RRRRRRRRRRRRNNNNNGRRRRRRRRTGTTACCGGCGGRGANNNRNGNTGATTTGNGRRRRRRRRRRRRRRRRRRRGAGA  c24.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRTGTTACCGGCGGRGANNNRNGNTGNTTTNNNRRRRRRRRRRRRRRRRRRRGAGA  col-0.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRTGTTACCGGCGGRGANNNRNGNTGATTTNNGRRRRRRRRRRRRRRRRRRRGAGA  cvi-0.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRTGTTACCGGCGGRGANTNRNNNTGNTTTNNNRRRRRRRRRRRRRRRRRRRGNGA  est-1.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRNGNTACCGGNGGRGNNNNRNGNTGNTTTNNNRRRRRRRRRRRRRRRRRRRGNGA  fei-0.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRTGTTACCGGCGGRGANTNRNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRGAGA  got-7.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRNGNTACCGGCGGRGANNNRNNNTGATTTNTNRRRRRRRRRRRRRRRRRRRGAGA  ler-1.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRNGNTACCGGCGGRGANNTRNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRGAGA  lov-5.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRNGNTACCGGCGGRGANNNRNGNTGATTTNNGRRRRRRRRRRRRRRRRRRRGAGA  nfa-8.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRTGTTACCGGCGGRGANTNRNGNTGATTTNNGRRRRRRRRRRRRRRRRRRRGAGA  rrs-10.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRTGNTACCGGCGGRGANNNRNGNTGATTNNNNRRRRRRRRRRRRRRRRRRRGAGA  rrs-7.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRTGTTACCGGCGGRGANNNRNGNTGATTTGNGRRRRRRRRRRRRRRRRRRRGAGA  sha.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRTGNTACCGGCGGRGANNNRNNNTGATNNNNNRRRRRRRRRRRRRRRRRRRGAGA  tamm-2.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRNGNTACCGGCGGRGANNNRNNNTGATTNNNNRRRRRRRRRRRRRRRRRRRGNGA  ts-1.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRTGNTACCGGCGGRGANTNRNGNTGATTTNNGRRRRRRRRRRRRRRRRRRRGAGA  tsu-1.fa
18381751  RRRRRRRRRRRRNNNNNNRRRRRRRRTGNTACCGGCGGRGANNNRNGNTGNTTTNNGRRRRRRRRRRRRRRRRRRRGAGA  van-0.fa
 
18381831  GGTTATGCCCCGGTGAGTAGACAACGTCTTTTGAAACGACGTCGTTTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  chr1.fa
18381831  GGTTNTRCNNCGGTGAGTNNNRAACGNCTNNNRRRNNNRNNRNNNNNNGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  bay-0.fa
18381831  GGTTATRCCCCGGTGAGTAGNRNNNGNCTNNNRRRNNNRNNRNNNTTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  bor-4.fa
18381831  GGTTATRCCCCGGTGAGTAGARAACGTCTTTTRRRNNNRNNRNNNTTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  br-0.fa
18381831  GGTTATRCCCCGGTGAGTAGNRAACGTCTTNNRRRNNNRNNRNNNTTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  bur-0.fa
18381831  GGTTATRCCCCGGTGAGTAGNRAACGNCTNNNRRRNNNRNNRNNNNTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  c24.fa
18381831  GGTTATRCCCCGGTGAGTAGARAACGNCTTTTRRRNNNRNNRNNNTTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  col-0.fa
18381831  GGTTATRCCCCGGTGAGTAGNRANNGNCTNNNRRRNNNRNNRNNNNTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  cvi-0.fa
18381831  GGTTATRCCNCGGTGAGTNGNRANNGNCTNNNRRRNNNRNNRNNNNTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  est-1.fa
18381831  GGTTNTRCCCCGGTGAGTNGNRNNNNNNNNNNRRRNNNRNNRNNNNTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  fei-0.fa
18381831  GGTTATRCCCCGGTGAGTAGNRNNNNNNNNNNRRRNNNRNNRNNNNTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  got-7.fa
18381831  GGTTATRCCCCGGTGAGTAGNRANNNNNNNNNRRRNNNRNNRNNNTTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  ler-1.fa
18381831  GGTTATRCCCCGGTGAGTNNNRANNNNNNNNNRRRNNNRNNRNNNNTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  lov-5.fa
18381831  GGTTATRCCCCGGTGAGTAGNRANNGNCTNNNRRRNNNRNNRNNNTTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  nfa-8.fa
18381831  GGTTATRCCCCGGTGAGTAGARAACGTCTTTTRRRNNNRNNRNNNTTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  rrs-10.fa
18381831  GGTTATRCCCCGGTGAGTAGARNANNNNNNNNRRRNNNRNNRNNNTTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  rrs-7.fa
18381831  GGTTATRCCCCGGTGAGTAGARAANGNCTNNNRRRNNNRNNRNNNTTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  sha.fa
18381831  GGTTATRCCCCGGTGAGTAGARNNNGNCTNNNRRRNNNRNNRNNNTTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  tamm-2.fa
18381831  GGTTATRCCCCGGTGAGTAGNRAANNNNNNNNRRRNNNRNNRNNNTTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  ts-1.fa
18381831  GGTTATRCCCCGGTGAGTAGNRAANGNCTNTNRRRNNNRNNRNNNTTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  tsu-1.fa
18381831  GGTTATRCCCCGGTGAGTAGARAACGNCTTTNRRRNNNRNNRNNNTTCGTGGGTTTAGAGAAGCCGGGACTGTTTCGGTG  van-0.fa
 
18381911  CCGGAAAGACGTTCGATACGACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGATGAAGAGTG  chr1.fa
18381911  CCGGAAAGACGTTCGANACGACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGATGAAGAGTG  bay-0.fa
18381911  CCGGAAAGACGTTCGANACGACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCNGATGAANNGTG  bor-4.fa
18381911  CCGGAAAGACGTTCGATACGACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGATGAAGAGTG  br-0.fa
18381911  CCGGAAAGACGTTCGATACGACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGATGAAGAGTG  bur-0.fa
18381911  CCGGAAAGACGTTCGATNCGACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGATGAAGAGTG  c24.fa
18381911  CCGGAAAGACGTTCGATNCGACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGATGAAGAGTG  col-0.fa
18381911  CCGGAAAGACGTTCNNNNNNACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGATGAAGAGTG  cvi-0.fa
18381911  CCGGAAAGACGTTCNNNNNGACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGNNNNAGANTG  est-1.fa
18381911  CCGGAAAGACGTTCNNNNNNNCCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGNNNNNNNNNNNAGAGTG  fei-0.fa
18381911  CCGGAAAGACGTTCNNNNNNACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTNNNNNNNNNNNNTG  got-7.fa
18381911  CCGGAAAGACGTTCGATNCGACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGATGAAGAGTG  ler-1.fa
18381911  CCGGAAAGACGTTCNNNNNNNCCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGANNNNNNNNNNNNNNNN  lov-5.fa
18381911  CCGGAAAGACGTTCNNNNNNACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGATGAAGAGTG  nfa-8.fa
18381911  CCGGAAAGACGTTCGATACGACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGATGAAGAGTG  rrs-10.fa
18381911  CCGGAAAGACGTTCGATNCGACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCNGATGAAGAGTG  rrs-7.fa
18381911  CCGGAAAGACGTTCGANACGACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGATGAAGAGTG  sha.fa
18381911  CCGGAAAGACGTTCNNNNNNACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTNNNNNGAAGAGTG  tamm-2.fa
18381911  CCGGAAAGACGTTCNNNNNNACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGNNNNNGAGTG  ts-1.fa
18381911  CCGGAAAGACGTTCGANACGACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGNTGAAGAGTG  tsu-1.fa
18381911  CCGGAAAGACGTTCGATACGACCGTCTTTGTAAACCCTGACGAACGGAGGATGCTCGGAGATGATTTCAGATGAAGAGTG  van-0.fa
 
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGGTGAGG  chr1.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATNGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGNNNNNN  bay-0.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGGTGAGG  bor-4.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGNTGAGG  br-0.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGNTGAGG  bur-0.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGNTGAGG  c24.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGNTGAGG  col-0.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGGTGAGG  cvi-0.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGNGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGGTGAGG  est-1.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCNGAGACGGCGATGGTGGTCGNTGAGG  fei-0.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGGTGAGG  got-7.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGGTGAGG  ler-1.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGNTGAGG  lov-5.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGNTGAGG  nfa-8.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGNTGAGG  rrs-10.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGNTGAGG  rrs-7.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGNTGAGG  sha.fa
18381991  TGANCAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGNTGAGG  tamm-2.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGGTGAGG  ts-1.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGGTGAGG  tsu-1.fa
18381991  TGAACAAATGCAACGAAGAGTGGTTGGAGTTGATAGTCGGCGAATGTTGCGGCCTGAGACGGCGATGGTGGTCGNTGAGG  van-0.fa
 
18382071  AGTAAGAGCGAGGGAGTTGGCGAAAGAAGCGGAGGAAGAGAGAGGGTGAAGCAAGTGAAGAAGAACAAGTGATTCTTCGG  chr1.fa
18382071  NNNAAGAGCGNNNNNNNTGGCGAAAGAAGCNNNNNNNNNNNNNNNNNGAAGCAAGTGAAGAANNNNNNNNGATTCTTCGG  bay-0.fa
18382071  AGTAAGNGCGAGGGAGTTGGCGAAAGAAGCNNNNNNNNNNNNNNNNNGAAGCAANTGANGNNNNNNNNNNGATTCTTCGG  bor-4.fa
18382071  AGTAAGAGCGNNNNNANNNGCGAAAGAAGCGGNGGAANNNNNNNNNNNNAGCAAGTNANNNNNNNNNNNNNATTCTTCGG  br-0.fa
18382071  AGTAAGAGCGAGGNAGTTGGCGAAAGAAGCGGNGNNNNNNNNNNGGTGAAGCAAGTGANGANGANCAAGTGATTCTTCGG  bur-0.fa
18382071  AGTAAGAGCGAGGNAGTTGGCGAAAGAAGCNNNNNNNNNNNNNNGGTGAAGCAAGTGAAGANNNNNNNNNGATTCTTCGG  c24.fa
18382071  AGTAAGAGCGAGGNAGTTGGCGAAAGAAGCNNNNNNNNNNNNNNNNTGAAGCAAGTGANGANNNNNNNGTGATTCTTCGG  col-0.fa
18382071  AGTAAGAGCGAGGNAGTTGGCGAAAGAAGCNNNNNNNNNNNNNNNNTGAAGCAAGTGANGANNNNNNNNTGATTCTTCGG  cvi-0.fa
18382071  AGTAAGNGCGAGGNAGTTGGCGAAAGAAGCNNNNNNNNNNNNNNNNTGAAGCAAGTGAAGANNNNNNNNNNATTCTTCGG  est-1.fa
18382071  AGTAAGAGCGAGGNNNNTGGCGAAAGAAGCNNNNNNNNNNNNNNNNNGAAGCAAGTGANGNNNNNNNNNNNNTTCTTCGG  fei-0.fa
18382071  AGTAAGAGCGAGGGAGTTGGCGAAAGAAGCNNNNNNNNNNNNNNNGTGAAGCAAGNNNNNNNNNNNNNNNNNTTCTTCGG  got-7.fa
18382071  AGTAAGAGCGAGGNAGTTGGCGAAAGAAGCNNNNNNNNNNNNNNNNNGAAGCAAGTGANGANNNNNNNNNNATTCTTCGG  ler-1.fa
18382071  AGTAAGAGCGAGGGAGTTGGCGAAAGAAGCNNNNNNNNNNNNNNNNNNAAGCAAGNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
18382071  AGTAAGAGCGAGGNAGTTGGCGAAAGAAGCNNNNNNNNNNNNNNNGTGAAGCAAGTGANGNNNNNNNNNNGATTCTTCGG  nfa-8.fa
18382071  AGTAANNNNNNNNNNANNNGCGAAAGAAGCGGNGGNNNNNNNNNNNNNNNNCAAGNNNNNNNNNNNNNNNNNTTCTTCGG  rrs-10.fa
18382071  AGTAAGAGCGAGGGAGTTGGCGAAAGAAGCNNNNNNNNNNNNNNNNTGAAGCAAGTGAAGAANNNNNNGTGATTCTTCGG  rrs-7.fa
18382071  AGTAAGAGCGAGGNAGTTGGCGAAAGAAGCNNNNNNNNNNNNNNNNTGAAGCAAGTGANGNNNNNNNNGTGATTCTTCGG  sha.fa
18382071  AGTAAGAGCGNNNNNGTTGGCGAAAGAAGCNNNNNNNNNNNNNNNNNNAAGCAAGTGANNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
18382071  AGTAAGAGCGNNNNNGTTGGCGAAAGAAGCNNNNNNNNNNNNNNNNNGAAGCAAGNGAAGAANNNNNNNNNNTTCTTCGG  ts-1.fa
18382071  AGTAAGAGCGAGGGAGTTGGCGAAAGAAGCNNNNNNNNNNNNNNNNTGAAGCAAGTGAAGAANNNNNNNTGATTCTTCGG  tsu-1.fa
18382071  AGTAAGAGCGAGGGAGTTGGCGAAAGAAGCGGNGGNNNNNNNNNNNTGAAGCAAGTGAAGANNNNNNNGTGATTCTTCGG  van-0.fa
 
18382151  AGCATGGTTCCCGGAATATTTTCTACGGCGAAAGAGGTTGCACTTTTTTGGATAAGGATTTTTATGAAGATAGATAAACC  chr1.fa
18382151  AGCATGGTTRCCGGAATATTTTCTACGGCGAAAGAGGTTGCACTTTTTTGGNNNNNNATTNNNNNNAAGATAGATAAACC  bay-0.fa
18382151  AGCATGGTTRCCGGAATATTTTCTACGGCGAAAGAGGTTGCACTTTTTTGNNNNNNNNNNNNNNNNNNNNNNNATAAACC  bor-4.fa
18382151  AGCATGGTTACNNGAATATTTTCTACGGCGAAAGAGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAACC  br-0.fa
18382151  AGCATGGTTANNGGAATATTTTCTACGGCGAAAGAGGTTGCACTTTTTTGGATAAGGATTTTTNTGAAGATAGATAAACC  bur-0.fa
18382151  AGCATGGTNANNGGAATATTTTCTACGGCGAAAGAGGTTGCACTTTTTTNNNNNNNNNNNNNNNNNNNNNTAGATAAACC  c24.fa
18382151  AGCATGGTTRCCGGAATATTTTCTACGGCGAAAGAGGTTGCACTTTTTTGGNNNNNNNNNNNNNNNNNNNTAGATAAACC  col-0.fa
18382151  AGCATGGNNANNNGNATATTTTCTACGGCGAAAGAGGTTGCACTTTTTTGGNNNNNNNNNNNNNNNNNNNNAGATAAACC  cvi-0.fa
18382151  AGCATGGTTRCCGGAATATTTTCTACGGCGAAAGAGGTTGCACTTTTTTGGNNNNNNNNNNNNNNNNNNNNNNATAAACC  est-1.fa
18382151  NGCATNNNNANNNNNNNATTTTCTACGGCGAAAGAGGTTGCACTTTTTTGGNNNNNNNNNNNNNNNNNNNNNGATAAACC  fei-0.fa
18382151  AGCATGNNNANNNNNNNNTTTTCTACGGCGAAAGAGGTTGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAACC  got-7.fa
18382151  AGCATGNTTACNNGANTATTTTCTACGGCGAAAGAGGTTGCACTTTTTTNNNNNNNNNNNNNNNNNNNNNNNGATAAACC  ler-1.fa
18382151  NNNATGNNNRNNNNNNNNTTTTCTACGGCGAAAGAGGTTGCACTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNTAAACC  lov-5.fa
18382151  AGCATGGTNANNNGAATATTTTCTACGGCGAAAGAGGTTGCACTTTTTNNNNNNNNNNNNNNNNNNNNNNNAGATAAACC  nfa-8.fa
18382151  AGCATGNNNACNNGAATATTTTCTACGGCGAAAGAGGTTNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNTAAACC  rrs-10.fa
18382151  AGCATGGNNANNNNNNNNTTTTCTACGGCGAAAGAGGTTGCACTTTTTTGGNNNNNNNNNNNNNNNNNNNNNNATAAACC  rrs-7.fa
18382151  AGCATGGNNANNNGNATATTTTCTACGGCGAAAGAGGTTGCACTTTNNNNNNNNNNNNNNNNNNNNNNNNTAGATAAACC  sha.fa
18382151  NNNATGNNNRNNNNNNNATTTTCTACGGCGAAAGAGGTTGCACTTTTTTNNNNNNNNNNNNNNNNNNNNNNAGATAAACC  tamm-2.fa
18382151  AGCATGGTTRCCGGAATATTTTCTACGGCGAAAGAGGTTGCACTTTTTTGNNNNNNNNNNNNNNNNNNNANAGATAAACC  ts-1.fa
18382151  AGCATGGTNANNNGAATATTTTCTACGGCGAAAGAGGTTGCACTTTTNNNNNNNNNNNNNNNNNNNNNNNNNGATAAACC  tsu-1.fa
18382151  AGCATGGTTACNNGAATATTTTCTACGGCGAAAGAGGTTGCACTTTTTTGGNNNNNNNNNNNNNNNNNNNNNNATAAACC  van-0.fa
 
18382231  GACCGACAAGATAAAAATCTAATAAGAATTTGAATACAAAAAAAAACAAATTAATATTTTACACATATTTTTTTCTCATG  chr1.fa
18382231  GACCGACANNNNNANANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNTTTTTNNNNNN  bay-0.fa
18382231  GACCGACAAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
18382231  GACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
18382231  GACCGACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNTTTTNNNNNN  bur-0.fa
18382231  GACCGACAAGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
18382231  GACCGACAAGATAANNNNNNNNNNNNNNNNNNNNNNNNNAAANNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
18382231  GACCGACAAGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
18382231  GACCGACAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
18382231  GACCGACAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
18382231  GACCGACAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
18382231  GACCGACAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
18382231  GACCGACAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
18382231  GACCGACAAGATAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
18382231  GANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
18382231  GACCGACAAGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
18382231  GACCGACAAGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
18382231  GACCGACAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
18382231  GACCGACAAGATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
18382231  GACCGACAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
18382231  GACCGACAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
18382311  TTGAAGAAAATAATAACACACATTTAACAGGTTCATATAACTCTCACACAGTCTGAAATTCATGTATTTTATTTCTTAAA  chr1.fa
18382311  NNNNAGAANNNNNNNNNNNANANNTNACAGGTTCATATAACTCTCACACAGTCTGAAANNNNNNNNNNNNRNNNRNNNRN  bay-0.fa
18382311  NNNNNNNNNNNNNNNNNNNNNNNTTAANNNNNNNATATAACTCTCACACAGTCTGANNNNNNNNNNNNNNRNNNRNNNRN  bor-4.fa
18382311  NNNNNNNNNNNNNNNNNNNNNNTTTAACAGGTTCATATAACTCTCACACAGTCTGAAATTNNNNNNNNNNRNNNRNNNRN  br-0.fa
18382311  NNNNNNNAAATANNAACACNCATTTAACAGNTTCATATAACTCTCACACAGTCTGAAATTCNNNNNNNNNRNNNRNNNRN  bur-0.fa
18382311  NNNNNNNNNANNNNNNNACACATTTAACAGGTTCATATAACTCTCACACAGTCTGAAATTNNNNNNNNNNRNNNRNNNRN  c24.fa
18382311  NNNNNNNNNNNNNNNNNNNNNNTTTAACAGGNTCATATAACTCTCACACAGTCTGANNNNNNNNNNNNNNRNNNRNNNRN  col-0.fa
18382311  NNNNNNNNNNNNNNNNNNNNNATTTAACAGGTTCATATAACTCTCACACAGTCTGAANNNNNNNNNNNNNRNNNRNNNRN  cvi-0.fa
18382311  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATAACTCTCACACAGTCTGAANNNNNNNNNNNNNRNNNRNNNRN  est-1.fa
18382311  NNNNNNNNNNNNNNNNNNNNNNNNTAACAGGTTNATATAACTCTCACACAGTCTGNNNNNNNNNNNNNNNRNNNRNNNRN  fei-0.fa
18382311  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAANNNNCACACAGTCTNNNNNNNNNNNNNNNNRNNNRNNNRN  got-7.fa
18382311  NNNNNNNNNNNNNNNNNNNNNNNTTAACAGGNTCATATAACTNTCACACAGTCTGAANNNNNNNNNNNNNRNNNRNNNRN  ler-1.fa
18382311  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATAACTNNNNNACAGTCTNNNNNNNNNNNNNNNNRNNNRNNNRN  lov-5.fa
18382311  NNNNNNNNNNNNNNNNNNNNCATTTAACAGGTTCATATAACTCTCACACAGTCTGAANNNNNNNNNNNNNRNNNRNNNRN  nfa-8.fa
18382311  NNNNNNNNNNNNNNNNNNNNNNTTTAACAGGTTCATATAACTCTCACACAGTCTGAAATTNNNNNNNNNNRNNNRNNNRN  rrs-10.fa
18382311  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAACTCTCACACAGTCTGAANNNNNNNNNNNNNRNNNRNNNRN  rrs-7.fa
18382311  NNNNNNNNAATAANANNNCACATTTAACAGGTTCATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNRNNNRN  sha.fa
18382311  NNNNNNNNNNNNNNNNNNNNNNTTTAANNNNNNNATATAACTCTCACACAGTCTGAAANNNNNNNNNNNNRNNNRNNNRN  tamm-2.fa
18382311  NNNNNNNNNNNNNNNNNNNNNATTTAACAGGTTCATATAACTCTCACACAGTCTGAANNNNNNNNNNNNNRNNNRNNNRN  ts-1.fa
18382311  NNNNNNNNNNNNNNNNNNNNNNTTTAACAGNTTCATATAACTCTCACACAGTCTGAAATNNNNNNNNNNNRNNNRNNNRN  tsu-1.fa
18382311  NNNNNNNNNNNNNNNNNNNNNNNNTAACAGGTTNATATAACTCTCACACAGTCTGAANNNNNNNNNNNNNRNNNRNNNRN  van-0.fa
 
18382391  AACAAGATTACATGATCATGAAGAACATTTACACAAAAAACATTCTTTCAAGTTTCAACCAATAATAAACTCGACAAACT  chr1.fa
18382391  RNNNANATNNNNNNNNNNNNNNNANNNNNNNNNNNAAAAANATTCTTTCAAGTTTCAACCAANNNNAAACTCNNNNNACT  bay-0.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNCAAACT  bor-4.fa
18382391  RNNNNNATTNNNNNNTCATGAAGAANNNNNNNNNNNNNNNNNNNNTTTCAAGTTNNNNNNNANNNNAAACTCGACAAACT  br-0.fa
18382391  RNNNAGATTACNNNNNNNTGAAGAACATTTACACAAANNNNNNNNNNNNNNNNNNNNNNNNNNNATAAACTCGNCAAACT  bur-0.fa
18382391  RNNNAGATTNNNNNNNNNNGAAGAANNNNNNNNNNNNNNNNNNNNNNTCAAGTNNNNNCNAANNNNAAACTCGNCAAACT  c24.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNGAANNNNNNNNNNNNNNNNNNNNTTTCAAGTTTCNACCAANNNNAAACTCGNCAAACT  col-0.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNN  cvi-0.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTNNNNNNNNNNNNNNNNNNNNNCNNNNN  est-1.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGTNNNNNNNNNNNNNANNCNNNNCNAACT  fei-0.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCGNCANNNN  ler-1.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAAGTNNNNNCNAANNNNAAACTCNACAAACN  nfa-8.fa
18382391  RNNNNNNNNNNNNNNNNNNGAAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCGACAAACN  rrs-10.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTNNNNNNNNNNNNNNNNCTCGACAAACT  rrs-7.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNGAACNNNNNNNNNNNNNNNNNNCTTTCAAGTNNNNNNNAATNNTAAACTCGACAAACN  sha.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTTCAACCAANNNNAAACTCGNCNNNNN  ts-1.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTNNNNNNNNNNNNNNNCNNNNNNNACT  tsu-1.fa
18382391  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTTNNNNNNNNNNNANNCNNNNCAAACT  van-0.fa
 
18382471  TCTTCAAGAATTTCAAAGCCTTATCAGATTTAGGATTCTGCAAATGAAACACATGGTCCTCACCTTCTTCCTCAACCACC  chr1.fa
18382471  TCTTCAANAATTTCAAAGCCTTATCAGATTTAGGATTCTGCAAANGAAACACATGNTCCTCANCTTCTNNNNNRNRNNNN  bay-0.fa
18382471  NNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAGGATTCTGCAAATGAAACACATGGTCCTCACCTTCTTCNNNRARNANC  bor-4.fa
18382471  TCTTCAAGAATTTCAAAGCCTTNTCAGATTTAGGATTCTGCAAATGAAACACATGGTCCTCACCTTCTNNNNCRNRCNCC  br-0.fa
18382471  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAATGAANNNNNNNNNNNNNNNNNNNNNNNNNRNRNNNN  bur-0.fa
18382471  TCTTCAAGAATTTCAAAGCCTTATCAGATTTAGGATTCTGCAAATGAAACACATGGTCCTCACCTTCTTCNNCRNRCNNC  c24.fa
18382471  TCTTCAAGAATTTCAAAGCCTTATCAGATTTAGGATTCTGCAAATGAAACACATGGTCCTCACCTTCTTCNNCRARCANC  col-0.fa
18382471  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNNNN  cvi-0.fa
18382471  NNNTNNNNNATTNNNNNNNNNNNNNNNNNNNNGGATTCTGCAAATGAAACACATGGTCCTCACCTTCTTCNNNRNRNNCC  est-1.fa
18382471  NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTGCAANNNNNACACATGGTCCTCACCTTCTTCNNNRNRNNNC  fei-0.fa
18382471  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAATGAAACACATGGTCCTCACCTTCTTCNNNRNRNNNC  got-7.fa
18382471  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNNNN  ler-1.fa
18382471  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNNNN  lov-5.fa
18382471  TCTTCAAGAATTTCAAAGCCNNNNNAGATTTAGGATTCTGCAAATGAAACACATGGTCCTCACCTTCTTCNNCRNRNANC  nfa-8.fa
18382471  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAATGNNNNNNNNNNNNNNNNNNNNNTTCNNNRNRNNNN  rrs-10.fa
18382471  TCTTNNNNNNNNNNNNNNNNNNNNNNNATTTAGGATTCTGCAAATGAAACACATGGTCCTCACCTTCTNNNNNRARCNCC  rrs-7.fa
18382471  TCTTCAAGAATTTCAANGCCTNNNNAGATTTAGGATTCTGCAAATGAAACACATGGTCCTCACCTTCTTCNNNRNRNANC  sha.fa
18382471  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNNNN  tamm-2.fa
18382471  NNNNNNNNNATTTCAAANNNNNNNNAGATTTNGGATTCTGCAAATGAAACACATGGTCCTCACCTTCTTCNNCRNRNNCC  ts-1.fa
18382471  TCTTNNNNNATTTCAAANNNNNNNNAGATTTAGGATTCTGCAAATGAAACACATGGTCCTCACCTTCTTCNNCRARCACC  tsu-1.fa
18382471  TCTNNNNNNNTTTCANNNNNNNNNNAGATTTAGGATTCTGCAAATGAAACACATGGTCCTCACCTTCTTCCNCRARCACC  van-0.fa
 
18382551  TCAACAGTACCTTCCCACTCACACTTCTCCAGCTTCGCCGCATAAGCCAATCCTTGCCTAACAAACACATCTTTCCCAGC  chr1.fa
18382551  NNAACAGNACCTTCCNACNNNNACTTCTCNANRRRRRRRRRRRRRRRRAATCCTTGCCTAACAAACACATCTTTCCCNNC  bay-0.fa
18382551  TCAACAGTACCTTCCCACTCACACTTCTCCAGRRRRRRRRRRRRRRRRAATCCTTGCCTAACAAACACATCTTTCCCAGC  bor-4.fa
18382551  NCAACAGTACCTTCCCACTCACACTTCTCCNGRRRRRRRRRRRRRRRRAATCCTTGCCTAACAAACACATCTTTCCCAGC  br-0.fa
18382551  NNNNNNNNNNCTTCCCACTCACACTTCTCCANRRRRRRRRRRRRRRRRNNANNNNNNNNNNNNNNNACATCTTTCCCNGC  bur-0.fa
18382551  NCAACAGNACCTTCCCACTCACACTTCTCCAGRRRRRRRRRRRRRRRRNATCCTTGCCTAACAAACACANCTTTCCCNGC  c24.fa
18382551  NCAACAGTACCTTCCCACTCACACTTCTCCAGRRRRRRRRRRRRRRRRAATCCTTGCCTAACAAACACATCTTTCCCAGC  col-0.fa
18382551  NNNNNNNNNNNTNCCCACTCACACTTCTCCANRRRRRRRRRRRRRRRRNNANNNNNNNNNNNNNNNNNNTCTTTCCCNGC  cvi-0.fa
18382551  NCAACAGTACCTTCCCACTCACACTTCTCCAGRRRRRRRRRRRRRRRRAATCCTTGCCTANCAAACACATCTTTCCCAGC  est-1.fa
18382551  NCAACAGNACCTTCCCACTCACACTTCTCCANRRRRRRRRRRRRRRRRNATCCTTGCCTAACAANCACATCTTTCCCNGC  fei-0.fa
18382551  TCAACAGTACCTTCCCACTCACACTTCTCCAGRRRRRRRRRRRRRRRRAATCCTTGCCTAACAAACACANCTTTCCCAGC  got-7.fa
18382551  NNNNNNNNNNNTTCCCACTCACACNTCTCCANRRRRRRRRRRRRRRRRNNANNNNNNNNNNNNNNNNNNNCTTTCCCAGC  ler-1.fa
18382551  NNNNNNNNNNNNNNCCACTCACNCTTCTCCANRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNCTTTCCCNGC  lov-5.fa
18382551  TCAACAGTACCTTCCCACTCACACTTCTCCANRRRRRRRRRRRRRRRRNATCCTTGCCTAACAAACACATCTTTCCCNGC  nfa-8.fa
18382551  NNNNNNNNNNCTTCCCACTCACACTTCTCCAGRRRRRRRRRRRRRRRRNNANNNNNNNNNNNNNNNNNNTCTTTCCCAGC  rrs-10.fa
18382551  NCAACAGTACCTTCCCACTCACACTTCTCCAGRRRRRRRRRRRRRRRRAATCCTTGCCTAACAAACACATCTTTCCCAGC  rrs-7.fa
18382551  TCAACAGTACCTTCCCACTCACACTTCTCCANRRRRRRRRRRRRRRRRNATCCTTGCCTAACAAACACATCTTTCCCNGC  sha.fa
18382551  NNNNNNNNNNNNNNNNNCTCACACNTCTCCANRRRRRRRRRRRRRRRRNNANNNNNNNNNNNNNNNNNNNCTTTCCCNGC  tamm-2.fa
18382551  NCAACAGTACCTTCCCACTCACACTTCTCCAGRRRRRRRRRRRRRRRRAATCCTTGCCTAACAAACACANCTTTCCCNGC  ts-1.fa
18382551  TCAACAGTACCTTCCCACTCACACTTCTCCAGRRRRRRRRRRRRRRRRAATCCTTGCCTAACAAACACATCTTTCCCAGC  tsu-1.fa
18382551  NCAACAGTACCTTCCCACTCACACTTCTCCAGRRRRRRRRRRRRRRRRAATCCTTGCCTAACAAACACATCTTTCCCAGC  van-0.fa
 
18382631  TACCGCAACCAAAACCTTATCACATCCCAACCCAGAAAAATCCGACCCGGATCCGTTTACATTAAACAACGGATCATCCG  chr1.fa
18382631  RNCNRNAACCAAARRRRNRRNNNANNNNNNNNNNNNAAAATNCGACCNNNNNNCGTTTACATNANNCNACGGATCATCCG  bay-0.fa
18382631  RACCRCAACCAAARRRRNRRNNNNNNNNNNCCCAGAAAAATCCGACCCGGNTCCGTTTANNNNNNNNNACGGATCATCCG  bor-4.fa
18382631  RACCRNAACCAAARRRRNRRCNNANNNNNNNCCAGAAAAATCCGACCCGGNTCCGTTTACATTAAACNACGGATCATCCG  br-0.fa
18382631  RACCRNAACCAAARRRRNRRCNCATCCCAACCCAGAAAAATCCGACCCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
18382631  RACCRNAACCAAARRRRNRRCNNATCCNAACCCAGAAAAANCCGACCNNNNNNCGTTTACATNANNCNACGGATCATCCG  c24.fa
18382631  RACCRNAACCAAARRRRNRRCNNATCCNAACCCAGAAAAATCCGACCNNNNNNCGTTTACATNANNCNACGGATCATCCG  col-0.fa
18382631  RNCCRNAACCAAARRRRNRRNNNANCCCAACCCANAANAANCCGACCNNNNNNCGTTTANNNNNNNNNACGGATCATCCG  cvi-0.fa
18382631  RACCRNAACCANARRRRNRRNNNNNNNNNNNCCAGAAAAANCCGACCCGGNTCCGTTTACNNNNNNNNACGGATCATCCG  est-1.fa
18382631  RNCCRNNACCANNRRRRNRRNNNNNNNNNNNNNNNNNNAANCCGACCNNNNNNNNNNNNNNNNNNNCNACGGATCATCNG  fei-0.fa
18382631  RACCRCAACCAAARRRRNRRNNNNNNNNNNNNCANAAAAATCCGACCCGGNTCNGNNNNNNNNNNNNNACGGATCATCCG  got-7.fa
18382631  RACCRNAACCAAARRRRNRRCNNATCCNAANNNNNNNAAATCCGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
18382631  RACNRNAACCANARRRRNRRNNNNNNNNNNNNCNGAAAAANCCGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
18382631  RACCRNNACCAAARRRRNRRNNNANNNNAACCCAGAAAAATCCGACCNNNNNNCGTTTACATNANNCNACGGATCATCCG  nfa-8.fa
18382631  RACCRNAACCAAARRRRNRRCACATCCNAACCCAGAAAAATCCGACCCGGNTCCGTTTACATTAAACNACGGATCATCCG  rrs-10.fa
18382631  RACCRCAACCAAARRRRNRRNNNANCCCAACCCAGAAAAATCCGACCCGGNTCCGTTNNNNNNNNNCNACGGATCATCCG  rrs-7.fa
18382631  RACCRNAACCAAARRRRNRRCNNATCCCAACCCAGAAAAANCCGACCNNNNNNCGTTTACATNANNCNACGGATCATCCG  sha.fa
18382631  RACNRNNACCNNARRRRNRRNNNNNNNNNNNNNNNNNNNANCCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
18382631  RACCRNNACCAAARRRRNRRNNNNNNNNNNNCCAGAAAAANCCGACCNNNNNNCGTTNNNNNNNNNNNACGGATCATCCG  ts-1.fa
18382631  RACCRNAACCAAARRRRNRRCNNANNNNAACCCAGAAAAATCCGACCCGGNTCCGTTTACATNANNCNACGGATCATCCG  tsu-1.fa
18382631  RACCRCAACCAAARRRRNRRCNNANCCCAACCCAGAAAAATCCGACCCGGNTCCGTTTACATNANNCNACGGATCATCCG  van-0.fa
 
18382711  TCCCATTAACACTATTCGGACTCGCAATCTTCTCCCAAATTTCCGCGATTCCGCTTCTCGTTTCTTTATCTTGCACATCG  chr1.fa
18382711  TCCCATTAACACTATTCGGACTCRCAATCTTCTCCCAAATTTCCGCGATTNCGCTTCTCGTTTCNNNNNNTTGCACATCG  bay-0.fa
18382711  TCCCATTAACACTATTCGGACTCRCAATCTTCTCCCAAATTTCCGCGATTCCGCTTCTCGTTTCTTTATCTTGCACATCG  bor-4.fa
18382711  TCCCATTAACACTATTCGGACTCRCAATCTTCTCCCAAATTTCCGCGATTCCGCTTCTCGTTTCTTTATCTTGCACATCG  br-0.fa
18382711  NTNNNNNNNNACTATTCGGANNNRNNNNNNNNNNNNNNNNNNNTGCGANNNNNNNNNNGNNNNNNNNATCTTGCACATCG  bur-0.fa
18382711  TCCCATTAACACTATTCGGACTCRCAATCTTCTCCCAAATTTCCGCGATTCCGCTTCTCGTTTCTTNATCTTGCACATCG  c24.fa
18382711  TCCCATTAACACTATTCGGACTCRCAATCTTCTCCCAAATTTCCGCGATTCCGCTTCTCGTTTCTTTATCTTGCACATCG  col-0.fa
18382711  TCCCATTAACACTATTCGGNNNNRNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNTTGNNNGNCG  cvi-0.fa
18382711  TCCCATTAACACTATTCGGACTCRCAATCTTCTCCCAAATTTCCGCGATTCCGCTTCTCGTTTCTTNATCTTGCACATCG  est-1.fa
18382711  TCCCATTAACACTATTCGGACTCRCNATCTTCTCCCAAATTTCCGCGATTCCGCTTCTCGTTTCTTNATCTTGCACATCG  fei-0.fa
18382711  TCCCATTAACACTATTCGGACTCRCAATCTTCTCCCAAATTTCCGCGATTCCGCTTCTCGTNTCNTTNNNNNNNACATCG  got-7.fa
18382711  NNNNNNNNNNACTATTCGNNNNNRNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNCTTGCACATCG  ler-1.fa
18382711  NNNNNNNNNNNNNATTCGNNNNNRNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACATCG  lov-5.fa
18382711  TCCCATTAACACTATTCGGACTCRCAATCTTCTCCCAAATTTCCGCGATTCCGCTTCTCGTTTCTTTATCTTGCACATCG  nfa-8.fa
18382711  TCCCATTAACACTATTCGGACTCRCAATCTTCTCNCAAATTTCCGCGATTCCGCTTCTCGTTTNNNNNNNNNNNNNNNNN  rrs-10.fa
18382711  TCCCATTAACACTATTCGGACTCRCAATCTTCTCCCAAATTTCCGCGATTCCGCTTCTCGTTTCTTTATCTTGCACATCG  rrs-7.fa
18382711  TCCCATTAACACTATTCGGACTCRCAATCTTCTCCCAAATTTCCGCGATTCCGCTTCTCGTTTCTTTATCTTGCACATCG  sha.fa
18382711  NTNNNNNNNNNCTATTCGGNNNNRNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNGNNNNNNNTATCTTGCACATCG  tamm-2.fa
18382711  TCCCATTAACACTATTCGGACTCRCAATCTTCTCCCAAATTTCCGCGATTCCGCTTCTCNTTTCTTNATCTTGCACATCG  ts-1.fa
18382711  TCCCATTAACACTATTCGGACTCRCAATCTTCTCCCAAATTTCCGCGATTCCGCTTCTCGTTTCTTTATCTTGCACATCG  tsu-1.fa
18382711  TCCCATTAACACTATTCGGACTCRCAATCTTCTCCCAAATTTCCGCGATTCCGCTTCTCGTTTCTTTATCTTGCACATCG  van-0.fa
 
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGCAATACCTTTGATTTTGAGATCTAGCTTCTTCTC  chr1.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGCAANACCTTTGARTTTNNNNNNNNNCTTCTTCTC  bay-0.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGCAANACNTTNNNRNNNGAGANNNNNNNNNTTCTC  bor-4.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGCAATACCTTTGARTTTGAGATCTNGCTTCTTCTC  br-0.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGCAATACCTTTGARTTTGAGATCTAGCTTCTTCTC  bur-0.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGCAANACCTTTGNRTTTGAGATCTNGCTTCTTCTN  c24.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGCAANACCTTNGARTNTGAGANNNNNNTTCTTCTC  col-0.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGCAANACCTTNNNRNNNGAGATCTNGCTTCTTCTC  cvi-0.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACNNNNNNACCTTNNNRNNNGAGANNNNNNNNCNTCTC  est-1.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCNGGATGAACAACAGCNANACCTTNNNRNNNGANNNNNNNNNNCTTCTC  fei-0.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGNNNNNNCTTNNNRNNNNNNNNNNNNNNNNNNNNN  got-7.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACNGCAATACCTTTNNRNNNGAGANNNNNNNNNTTNTC  ler-1.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNCNTNNN  lov-5.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGCAANACCTTNNNRTTNGAGANNNNNNNTCTTCTC  nfa-8.fa
18382791  TATTCATCAACNNNNNTNNNNCCCCAGAAANNNNNNNNNNNNNNNNNNNNNCCTTTGARTTTGAGNNNNNNNNTCTTCTC  rrs-10.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGCAANACCTTNGARNNNGAGNNNNNNNTTCTTCTC  rrs-7.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGCAATACCTTTGNRTTNGAGATCTNGCTTCTTCTC  sha.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGCAANACCTTNNNRNNNGAGNNNNNNNTTCTTCNN  tamm-2.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGANGAACAACAGCAATACCTTNNNRTTTGAGANNNNNNTTCTTCTC  ts-1.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGCAANACCTTNGNRNNNGAGATNNNNNNNNTTCTC  tsu-1.fa
18382791  TATTCATCAACCGGATCTGTTCCCCAGAAAGCTGGATGAACAACAGCAANACCTTTGNRTTNGAGATNNNNNNTCTTCTC  van-0.fa
 
18382871  TTTACCAGCTTTCATCGCCATGTGATGCGATATGTTACCGCCTGCGCTATCTCCGCCGAGGAAAACTTTACCGAAATCGG  chr1.fa
18382871  TTNACCANCTRTCNTCGRCATGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGNGGAAAACTTTACCGAAARRGN  bay-0.fa
18382871  TTTACCAGCTRTCATCGRCATGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGAGGAAAACTTTACCGAAARRGG  bor-4.fa
18382871  TTTACCAGCTRTCATCGRCATGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGAGGAAAACTTTACCGAAARRGN  br-0.fa
18382871  TTTACCAGCTRTCATCGRCATGTGATGCGATATGTTACCGCCGGCGCTATCTCCGRCGNGGAAANNNNNNNNNNNNRRNN  bur-0.fa
18382871  NNNACCAGCTRTCATCGRCATGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGNGGAAAACTTTACCGAAARRGG  c24.fa
18382871  TTNACCAGCTRTCATCGRCATGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGAGGAAAACTTTACCGAAARRGN  col-0.fa
18382871  TTNACCAGCTRTCATCGRCNTGTGATGCGATATGTTACCGCCGNNNNNNTCTNCGRCGNNNNNNNNNNNNNNNNNNRRNN  cvi-0.fa
18382871  TTTACCAGCTRTCATCGRCATGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGAGGAAAACTTTACCGAAARRGN  est-1.fa
18382871  NNNNNNAGCTRTCNTCGRCNNGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGNGGAAAACTTTACCGNAARRGN  fei-0.fa
18382871  NNNNNNAGCTRTCATCGRCANGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGAGGAAAACTTTACCGAAARRGG  got-7.fa
18382871  NTTACCAGCTRTCATCGRCANGTGATGCGATATGTTACCGCCGGNNCNATCTNCGRCGNGGNNNNNNNNNNNNNNNRRNN  ler-1.fa
18382871  NNNNCCAGCTRTCATCGRNNNGTGATGCGATATGTTACCNNNGNNNNNNNNNNCNRCGNGGAAAACTTTACCGAAARRGN  lov-5.fa
18382871  TTNACCAGCTRTCATCGRCATGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGAGGAAAACTTTACCGAAARRGG  nfa-8.fa
18382871  TTTACCAGCTRTCATCGRCATGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGNGGAAAACTTTACCGAAARRGN  rrs-10.fa
18382871  TTTACCAGCTRTCATCGRCATGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGAGGAAAACTTTACCGAAARRGG  rrs-7.fa
18382871  TTNACCAGCTRTCATCGRCANGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGNGGAAAACTTTACCGAAARRGG  sha.fa
18382871  NNNACCAGCTRTCATCGRCANGTGATGCGATATGTTACCGCCGNNNNNNNCTNCGRCGNGGAAAACTTTACCGAAARRGN  tamm-2.fa
18382871  NNNNNNAGCTRTCATCGRCATGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGNGGAAAACTTTACCGAAARRGN  ts-1.fa
18382871  TTTACCAGCTRTCATCGRCATGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGAGGAAAACTTTACCGAAARRGG  tsu-1.fa
18382871  TTTACCAGCTRTCATCGRCATGTGATGCGATATGTTACCGCCTGCGCTATCTCCGRCGAGGAAAACTTTACCGAAARRGG  van-0.fa
 
18382951  CGTGTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAATGAGCAAAAATCCACTGAATCGCGGACCATACATCTTCA  chr1.fa
18382951  CGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAANGAGCNAARANCCACTGAATCGCGGACCATACATCTTCA  bay-0.fa
18382951  CGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTANNNNNNNCAAARATCCACTGAATCGCGGACCATACATCTTCA  bor-4.fa
18382951  CGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAATGAGCAAARATCCACTGAATCGCGGACCATACATCTTCA  br-0.fa
18382951  CGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGANNNNNNNNNRCNNNNNNNNNNAGCGGACCATACATCTTNN  bur-0.fa
18382951  CGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAATGAGCAAARATCCACTGAATCGCGGACCATACATCTTCA  c24.fa
18382951  CGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAANGAGCAAARATCCACTGAATCGCGGACCATACATCTTCA  col-0.fa
18382951  NGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAATGAGCAAARANCCACTGAATANNNGACCANACATCTTNN  cvi-0.fa
18382951  CGTRTTNGTTAATCCAATCTACAGGACCAGATCCATTANNNNNNNCNAARANCCACTGAATCGCGGACCATACATCTTCA  est-1.fa
18382951  CGNRTTNGTTAATCCAATCTACAGGACCAGATCCATTAGNNNNNNCNAARANNCACTGAATCGCGGACCATACATCTTCA  fei-0.fa
18382951  CGTRTTNGTNNNNNNNNTCTACAGGACCAGATCCATTANNNNNNNCNNARATCCACTGAATCGCGGACCATACATCTTCA  got-7.fa
18382951  NNNRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAATGAGCAAARATCCACTGANNANNNGACCATACATCTNNN  ler-1.fa
18382951  CGTRTTTGTTAANCCAATCTACAGGACCNGATCCATTANNNNNNNCNNNRNNCCACTGAATCGCGGACCATACATCNTCA  lov-5.fa
18382951  CGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAANGAGCAAARATCCACTGAATCGCGGACCATACATCTTCA  nfa-8.fa
18382951  CGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAATGAGCAAARATCCACTGAATCGCGGACCATACATCTTCA  rrs-10.fa
18382951  CGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAATGAGCAAARATCCACTGAATCGCGGACCATACATCTTCA  rrs-7.fa
18382951  CGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAATGAGCAAARATCCACTGAATCGCGGACCATACATCTTCA  sha.fa
18382951  CGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAANGAGCAANRANCCACTGAATCGCGGACCATACATCTTCA  tamm-2.fa
18382951  CGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAANGAGCAAARATCCACTGAATCGCGGACCATACATCTTCA  ts-1.fa
18382951  CGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAATGAGCAAARATCCACTGAATCGCGGACCATACATCTTCA  tsu-1.fa
18382951  CGTRTTTGTTAATCCAATCTACAGGACCAGATCCATTAGAATGAGCAAARATCCACTGAATCGCGGACCATACATCTTCA  van-0.fa
 
18383031  TAAGCCGCCGGAACAGGATCTTCCGGTGCACGGCGATACTGAACAGAGACAGCGAGGCAGTTAGCGGATTTGACTACTTC  chr1.fa
18383031  TAAGCCGCCGGAACANNARRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGNGGRRGTTNRRGGATTTGACTACTTC  bay-0.fa
18383031  TAAGCCGCCGGAACAGGARRRRRCGNTGCACGGCGATACTGAACAGAGACAGCGAGGRRGTTARRGGATTTGACTACTTC  bor-4.fa
18383031  TAAGCCGCCGGAACAGGARRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGAGGRRGTTARRGGATTTGACTACTTC  br-0.fa
18383031  NNCNNNNNNNNNNNCNNNRRRRRCGNTGCACGGCGATACTGANNNNNNNNGNNNNNNRRGTTARRGGATTTGACTACTTC  bur-0.fa
18383031  TAAGCCGCCGGAACAGGARRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGAGGRRGTTNRRGGATTTGACTACTTC  c24.fa
18383031  TAAGCCGCCGGAACAGGARRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGAGGRRGTTARRGGATTTGACTACTTC  col-0.fa
18383031  NNCNNCGNNNNNNNCNNNRRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGNGGRRGTTNRRGGATTTGACTACTTC  cvi-0.fa
18383031  TAAGCCGCCGGAACAGGARRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGAGGRRGTTARRGGATTTGACTACTTC  est-1.fa
18383031  TAAGCCGCCGGAACANNARRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGAGGRRGTTNRRGGATTTGACTACTTC  fei-0.fa
18383031  TAAGCCGCCGGAACAGGARRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGAGGRRGTTARRGGATTTGACTACTTC  got-7.fa
18383031  NNCNNNGNNNGAACNNNNRRRRRCGNTGCACGGCGATACTGANNNNNNNNGNNNNNNRRNTTARRGGATTTGACTACTTC  ler-1.fa
18383031  TAAGCCGCCGGAACAGNNRRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGNNGRRGTTNRRGGATTTGACTACTTC  lov-5.fa
18383031  TAAGCCGCCGGAACAGGARRRRRCGNTGCACGGCGATACTGAACAGAGACAGCGAGGRRGTTARRGGATTTGACTACTTC  nfa-8.fa
18383031  TAAGCCGCCGGAACAGGARRRRRCGNTGCACGGCGATACTGAACAGAGACAGCGAGGRRGTTARRGGATTTGACTACTTC  rrs-10.fa
18383031  TAAGCCGCCGGAACAGGARRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGAGGRRGTTARRGGATTTGACTACTTC  rrs-7.fa
18383031  TAAGCCGCCGGAACAGGARRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGAGGRRGTTNRRGGATTTGACTACTTC  sha.fa
18383031  TAAGCCGCCGGAACAGGARRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGNGGRRGTTNRRGGATTTGACTACTTC  tamm-2.fa
18383031  TAAGCCGCCGGAACAGGARRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGAGGRRGTTNRRGGATTTGACTACTTC  ts-1.fa
18383031  TAAGCCGCCGGAACAGGARRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGAGGRRGTTARRGGATTTGACTACTTC  tsu-1.fa
18383031  TAAGCCGCCGGAACAGGARRRRRCGNTGCACGGCGATACTGAACAGAGACNGCGAGGRRGTTARRGGATTTGACTACTTC  van-0.fa
 
18383111  AGTGAGGTAATTGTGGTAGAGTGGGGAGAAAGGTGACTCGATGATCCAAGCTCCGCCGTGGATGTAGATAAGTAGAGGGA  chr1.fa
18383111  AGTGAGGTAATTGTGGTNGNRNNNNNNNAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNAGNNGRRRRR  bay-0.fa
18383111  AGTGAGGTAATTGNNNNNNNRNNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNNNNGRRRRR  bor-4.fa
18383111  AGTGAGGTAATTGTGGTNNNRNNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNGTAGRRRRR  br-0.fa
18383111  AGTGAGGTAATTGTGGTNGNRNNNNNNGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNAGNAGRRRRR  bur-0.fa
18383111  AGTGAGGTAATTGTGGTNGNRNNNNNNGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNAGNAGRRRRR  c24.fa
18383111  AGTGAGGTAATTGTNNNNNNRTNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNNNAGRRRRR  col-0.fa
18383111  AGTGAGGTAATTGTGGTNNNRNNNGGAGAAAGGTGACTCGATGATCCAAGCTCCNRRRRRRRRRRRRRRNNNNNNRRRRR  cvi-0.fa
18383111  NGTGAGGTAATTGTGGTNNNRNNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNNNNNRRRRR  est-1.fa
18383111  AGTGAGGTAATTGTNNNNNNRNNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNNNNNRRRRR  fei-0.fa
18383111  NNTGNNNNNNNNNNNNNNNNRNNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNNNNNRRRRR  got-7.fa
18383111  AGTGAGGTAATTGTGGTNNNRNNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNNNNNRRRRR  ler-1.fa
18383111  AGTGNGGTAATTGTNNNNNNRNNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNNNNNRRRRR  lov-5.fa
18383111  AGTGAGGTAATTGTGGTNNNRNNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNNNNGRRRRR  nfa-8.fa
18383111  AGTGAGGTAATTGTGGTNNNRTNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNGNAGRRRRR  rrs-10.fa
18383111  AGTGAGGTAATTGTGGTNNNRNNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNNNNNRRRRR  rrs-7.fa
18383111  AGTGAGGTAATTGTGGTNNNRNNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNGNNGRRRRR  sha.fa
18383111  AGTGAGGTAATTGTNNNNNNRNNNNNNNAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNNNNNRRRRR  tamm-2.fa
18383111  AGTGAGGTAATTGTNNNNNNRNNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNNNNGRRRRR  ts-1.fa
18383111  AGTGAGGTAATTGTGGTNGNRNNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNNNNGRRRRR  tsu-1.fa
18383111  AGTGAGGTAATTGTGGTNGNRNNNGGAGAAAGGTGACTCGATGATCCAAGCTCCGRRRRRRRRRRRRRRNNNNNNRRRRR  van-0.fa
 
18383191  GCTTGTTACCGGCGGTGAGTTTTGTTGATTTGTGAGGGAGGAAGAGACGAACGGAGAGGTTATTCTCCGGTGAGTATATA  chr1.fa
18383191  RRRNGNTNCCGGNGNRGNGNTRNNNTGATTTNNGRRRRRRRRRRRRRRRRRRRGAGAGGTNNTRNNCCGGTGAGTATARA  bay-0.fa
18383191  RRRTGTTACCGGCGGRGAGTTRNGNTGNNNNGNGRRRRRRRRRRRRRRRRRRRGAGAGGTTNTRCTCCGGTGAGTANNRN  bor-4.fa
18383191  RRRTGTTACCGGCGGRGAGTTRNGNTGATTTGNGRRRRRRRRRRRRRRRRRRRGAGAGGTTNTRCTCCGGTGAGTATARA  br-0.fa
18383191  RRRTGTTACCGGCGGRGAGTTRNGNTGNTTTGTGRRRRRRRRRRRRRRRRRRRGAGAGGTTNTRCTCCGGTGAGTATARA  bur-0.fa
18383191  RRRTGTTACCGGCGGRGNGTNRNGNTGATTTGTGRRRRRRRRRRRRRRRRRRRGAGAGGTTNTRCTCCGGTGAGTATARA  c24.fa
18383191  RRRTGTTACCGGCGGRGAGTTRNGNTGNTTTGNGRRRRRRRRRRRRRRRRRRRGAGAGGTTNTRCTCCGGTGAGTATARA  col-0.fa
18383191  RRRNGTTNCCGGCGGRGNGTTRNGNTGNTTTGNGRRRRRRRRRRRRRRRRRRRGAGAGGTTNTRCTCCGGNNNNNNNNRN  cvi-0.fa
18383191  RRRTGTTACCGGCGGRGNGTTRNNNNNNTTTNNNRRRRRRRRRRRRRRRRRRRGAGAGGTTNTRCTCCGGTGAGTATARN  est-1.fa
18383191  RRRTNTTNCCGGCGGRGNGNNRNGNNGNTTTNNNRRRRRRRRRRRRRRRRRRRGAGAGGTNNNRCNCCGGTGAGTANNRN  fei-0.fa
18383191  RRRTGTTACCGGCGGRGAGTTRNNNNGNNNNNNGRRRRRRRRRRRRRRRRRRRGAGAGGTNNTRCTCCNNNNNNTNNNRN  got-7.fa
18383191  RRRNNNTACCGGCGGRGAGTTRNNNTGATTTGTGRRRRRRRRRRRRRRRRRRRGAGAGNNNNTRCTCCGGTGAGTATARN  ler-1.fa
18383191  RRRNGTTACCGGCGGRGNGTTRNNNNNNNTTNNNRRRRRRRRRRRRRRRRRRRGAGAGGTNNNRCTCCGGTGAGTATNRN  lov-5.fa
18383191  RRRTGTTACCGGCGGRGAGNNRNNNTGNTTTGNGRRRRRRRRRRRRRRRRRRRGAGAGGTNNTRCTCCGGTGAGTATARA  nfa-8.fa
18383191  RRRTGTTACCGGCGGRGAGTTRNGNTGNTNNGNGRRRRRRRRRRRRRRRRRRRGAGAGGTTNTRCTCCGGTGAGTATARA  rrs-10.fa
18383191  RRRTGTTACCGGCGGRGAGTTRNNNTGNTTTNNNRRRRRRRRRRRRRRRRRRRGAGAGGTTNNRCTCCGGTGAGTNTARN  rrs-7.fa
18383191  RRRTGTTACCGGCGGRGAGNNRNGNTGATTTGTGRRRRRRRRRRRRRRRRRRRGAGAGGTTNNRCTCCGGTGAGTATNRA  sha.fa
18383191  RRRTGTTACCGGCGNRGNGNNRNNNNNNTTTNNNRRRRRRRRRRRRRRRRRRRGAGAGGTNNTRCTCCGGTGAGTANARA  tamm-2.fa
18383191  RRRTGTTNCCGGCGNRGNNNTRNNNNNNNTTGNGRRRRRRRRRRRRRRRRRRRGNGAGGTNNNRCTCCGGTGAGTATARN  ts-1.fa
18383191  RRRTGTTACCGGCGGRGAGTTRNNNTGNTTTGNGRRRRRRRRRRRRRRRRRRRGAGAGGTNNTRCTCCGGTGAGTATARN  tsu-1.fa
18383191  RRRTGTTACCGGCGGRGAGTTRNNNTGATTTNNNRRRRRRRRRRRRRRRRRRRGAGAGGTTNTRCTCCGGTGAGTATARA  van-0.fa
 
18383271  ACGTCTTTTGAAACG