Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 23312 - 24099


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
23312  CTGCAAACAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAATCTGTCACAAAACACTCTTCTTCTCT  chr1.fa
23312  CTGCAAACAANAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAATCTGTCACAAANNNNNNNNNNNNNRN  bay-0.fa
23312  CTGCAAACAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAATCTGTCACAAAACANNNNNNNNNNRN  bor-4.fa
23312  CTGCAAACAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAANNNNTCACAAAANNNNNNNNNNNNRN  br-0.fa
23312  CTGCAAACAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAATCTGTCACAAAACACTCTNNNNNNRN  bur-0.fa
23312  CTGCAAACAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAATCTGTCACAAAACANNNNNNNNNNRN  c24.fa
23312  CTGCAANCAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAATCTGTCACAAAACNCTNNNNNNNNRN  col-0.fa
23312  CTGCAAACAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAATCTGTCACAAAACACTNNNNNNNNRN  cvi-0.fa
23312  CTGCAANCAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAATCTGTCACAAAACANNNNNNNNNNRN  est-1.fa
23312  CTGCAAACAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAATCTGTCACAAAACANNNNNNNNNNRN  fei-0.fa
23312  CTNCAAACAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCNAANCTNTCACAANNNNNNNNNNNNNNRN  got-7.fa
23312  CTGCAAACAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCNNNNNNNGTCACAAANNNNNNNNNNNNNRN  ler-1.fa
23312  CTGCAANCAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCNANNNNNNNNCAAANNNNNNNNNNNNNRN  lov-5.fa
23312  CTGCAAACAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAATCTGTCACAAAANNNNNNNNNNNNRN  nfa-8.fa
23312  CTGCAAACANCAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCNNNNNNNNNNNCAAANNNNNNNNNNNNNRN  rrs-10.fa
23312  CTGCAAACAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAATCTGTCACAAAACACNNNNNNNNNRN  rrs-7.fa
23312  CTGCAANCAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAATCTGTCACAAAANNNNNNNNNNNNRN  sha.fa
23312  CTGCAAACAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAATCTGTCACAAANNNNNNNNNNNNNRN  tamm-2.fa
23312  CTGNNNNNAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCNAATCTGTCACAAAACANNNNNNNNNNRN  ts-1.fa
23312  CTGCAAACANCAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTANNNTGNNANNNNNNNNNNNNNNNNNRN  tsu-1.fa
23312  CTGCAAACAACAACTTCAAAATTGGCGTGTTTCGTACGGTCTATCTAACCCTAATCTGTCACAAAACACTCNTNNNNNRN  van-0.fa
 
23392  CACCCCTTTTTCTGGGTTTATTCAATTCTCGTGCTTTTGGTTCTGTTTTCTTCTCTGGGGATTTGGTTTTCTTGAGTGAG  chr1.fa
23392  NNNCCCTTTTTCTGGGTTTNTTCAATTCTCGTGNTNNTNNNNNNNNNTTNNNNNNNNNNNNNTTGGTTTTNTNNANTGAG  bay-0.fa
23392  NNNNNNNNNNNNNNNNNNNNTTCAATTCTCGTGCTTTTGGNNNNNNNNNNTTCTCTGGGGATTTGGTTTTCTTGNGTGAG  bor-4.fa
23392  NNNNNNNTTTTNTGGGTTTNTNNANTTCTCGTGNTNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGGTTNNNNNNNNNNNN  br-0.fa
23392  NNNCCCTTTTTCTGGGTTTATTCAATTCTCGTGCTTTTGGNNNNNNTTTCTTCTCTGGGGATTTGGTTTTCTTGAGTGAG  bur-0.fa
23392  NNNNNNNTTTTCTGGGTTTNTTCAATTCTCGTGCTTTTGGNNNNNNNNNNNNNTNTGNNNNTTTGGTTTTNTTGNNNNNG  c24.fa
23392  NNNNNNNNNTTCTGNNNNNNNTCAATTCTCGTGCTTNTGNNNNNNNNNNNNNNNNNNNNNNTTTGGTTTTCTNNNNNNNG  col-0.fa
23392  NNNNNCTTTTTCTGGGTTTNTTCAATTCTCGTGCTTTTGGNNNNNNNNNNNNNTNTGNNNNTTTGGTTTTCTTNNNNNNN  cvi-0.fa
23392  NNNNNNTTTTTCTGGGNNNNNNCAATTCTCGTGCTTTTGGNNNNNNNNTNTTCTCTGNGGATTTGGTTTTNNNNNNNNNG  est-1.fa
23392  NNNNNNNTTTTCTGGGTTTNTTCAATTCTCGTGCTTTTGGNNNNNNNNNNNNNTNTGNNNNTTTGGTTTTNNNNNNNNAG  fei-0.fa
23392  NNNNNNNNNNNNNNNNNNNNNNNANTTCTCGTGCTTTTGGNNNNNNNNNNNNNNNNNNGGATTTGGTTTTNNNNNNNNNN  got-7.fa
23392  NNNNNNNNNNNNNNNNNNNNTTCAATTCTCGTGCTTTTGNNNNNNNNNNNTNCNCNNNNNNTTTGGTTNNNNNNNNNNNG  ler-1.fa
23392  NNNNNNNNNNNNNNNNNNNNNTCAATTCTCGNGCTTTTGGNNNNNNNNNNNNNNNNNNNNNNTTGGTNNNNNNNNNNNNG  lov-5.fa
23392  NNNNNNNNNNNNTGGGTTTNTTCAATTCTCGTGCTTTTGGNNNNNNNNNCTNCTNNNNNNNTTTGGTTTTNNNNNNNNNG  nfa-8.fa
23392  NNNNNNNNNNNNNNNNNNNNNNCAATNCTCGTGCTTTTGNNNNNNNNNNNTTCTCTGNGGATTTGGTTTTNNNNNNNNNG  rrs-10.fa
23392  NNNNNNNTTTTCTGGGTTTNTTCAATTCTCGTGCTTTTGGNNNNNNNTTNTTCTCTGNGGATTTGGTTTTCTTGNGTGAG  rrs-7.fa
23392  NNNNNNNNNTTCTGGGNNNNNNCAATTCTCGTGCTTTTGGNNNNNNNNNNNNNNNNNNNNNTTTGGTTTTNNNNNNNNNG  sha.fa
23392  NNNNNNNNNNNNNNNNNTNNNNNAATTCTCGTGCTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTTNNNNNNNNNN  tamm-2.fa
23392  NNNNNNNNNNNNNNNNNNNNTTCAATTCTCGTGNNNNTGNNNNNNNNNNNTTCTNNNNNNNNTTGGTTTTNNNNNNNNNG  ts-1.fa
23392  NNNNNNNNNNNNNNNNNNNNNNCAATTNTCGTGCTTTTGGNNNNNNNNNNNNNNNNNNNNNTTTGGTTTTNNNNNNNNNN  tsu-1.fa
23392  NNNNNNNTTTTCTGGGTNTNNTCAATTCTCGTGCTTNTGNNNNNNNNNNNNNCTNTGNGGATTTGGTTTTNNNNNNNNNG  van-0.fa
 
23472  TTTTTCTCCTCTTTCTTATGTTCTTGATTTGATTATTATATAGAATTATGGTAATGGAGGATGAGCCTAGAGAAGCCACA  chr1.fa
23472  TTTNNNNNNNNNNNNNNNNNNNNTTGATTTGATTNTNNTATNGAATTATGGTAATGGAGGATGAGCCTAGAGAAGCCACA  bay-0.fa
23472  TTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGGAGGATGAGCCTAGAGAAGCCACA  bor-4.fa
23472  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNATGGAGGATGAGCCTAGAGAAGCCACA  br-0.fa
23472  TTTTTCNNNNNNNNNNNNTNNTNTTGATTNNNNNNNNNNNNNNNNNNATGGTAATGGAGGATGAGCCTAGAGAAGCCACA  bur-0.fa
23472  TTTTTNNNNNNNNNNNNNNNNTNNNNNTNNNNNNNNNNNNNNNNNNNNNNGTAATGGAGGATGAGCCTAGAGAAGCCACA  c24.fa
23472  TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAATGGAGGATGAGCCTAGAGAAGCCACA  col-0.fa
23472  TTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAATGGAGGATGAGCCTAGAGAAGCCACA  cvi-0.fa
23472  TTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATGGAGGATGAGCCTAGAGAAGCCACA  est-1.fa
23472  TTTTNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNGGTAATGGAGGATGAGCCTAGAGAAGCCACA  fei-0.fa
23472  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGGATGAGCCTAGAGAAGCCACA  got-7.fa
23472  TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAGGATGAGCCTAGAGAAGCCACA  ler-1.fa
23472  TNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGAGGATGAGCCTAGAGAAGCCACA  lov-5.fa
23472  TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAATGGAGGATGAGCCTAGAGAAGCCACA  nfa-8.fa
23472  TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGGATGAGCCTAGAGAAGCCACA  rrs-10.fa
23472  TTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAATGGAGGATGAGCCTAGAGAAGCCACA  rrs-7.fa
23472  TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATGGAGGATGAGCCTAGAGAAGCCACA  sha.fa
23472  TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGGAGGATGAGCCTAGAGAAGCCACA  tamm-2.fa
23472  TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGGAGGATGAGCCTAGAGAAGCCACA  ts-1.fa
23472  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGAGGATGAGCCTAGAGAAGCCACN  tsu-1.fa
23472  TTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATGGAGGATGAGCCTAGAGAAGCCACA  van-0.fa
 
23552  ATAAAGCCTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  chr1.fa
23552  ATAAAGCCTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  bay-0.fa
23552  ATAAANNNNNNNTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGNTCC  bor-4.fa
23552  ATAAANNNNTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  br-0.fa
23552  ATAAAGCCTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  bur-0.fa
23552  ATAAAGCCTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  c24.fa
23552  ANAANGCNTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  col-0.fa
23552  ATAAAGCCTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  cvi-0.fa
23552  ATAAAGCCTTCNTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  est-1.fa
23552  ATAAAGCCTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  fei-0.fa
23552  ANNNNNNNNNNNNNNTGGCTAGATGCTTGCGAGGACATCTCTTGTNATCTTATCGATGATCTCGTGTCTGAATTTGATCC  got-7.fa
23552  ATNNNNNNNNNNNNNNNGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  ler-1.fa
23552  ATNNNNNNNNNNNNTTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTNTCGATGATCTCGTGTCTGAATTTGATCC  lov-5.fa
23552  ATAAANNNNNNNNATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  nfa-8.fa
23552  ATNNNNNNNNNNNATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  rrs-10.fa
23552  ATAAANNNNNNTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  rrs-7.fa
23552  ATAAAGCCTNNNNATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  sha.fa
23552  ATAAANNNNNNNNNTTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  tamm-2.fa
23552  ATNNNNNNNNNNNATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  ts-1.fa
23552  NNNNNNNNNNNNNNNTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTNTCGATGATCTCGTGTCTGAATTTGATCC  tsu-1.fa
23552  ATAAAGCCTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGATCTTATCGATGATCTCGTGTCTGAATTTGATCC  van-0.fa
 
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACATTTTAG  chr1.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCNTCAATGATTTTTTCNNNNNGATTGATCACATTTTAG  bay-0.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACATTNNNN  bor-4.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACATTTTNN  br-0.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACATTTTAG  bur-0.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACATTTTAG  c24.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACATTNTNN  col-0.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACATTTTAG  cvi-0.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACATTTNNN  est-1.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACATTTTAG  fei-0.fa
23632  TTCCTCTGTTGNTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATNNNNNNNNNN  got-7.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACNNNNNNN  ler-1.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCNTCAATGATTTTTTCGGTGGGATTGATNNNNNNNNNN  lov-5.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACATTTTAG  nfa-8.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACATTTNNN  rrs-10.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACATTTNNN  rrs-7.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACATTTTAG  sha.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACATTTTNN  tamm-2.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACANNNNNN  ts-1.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCANTGATTTTTTCGGTGGGATTGATNNNNNNNNNN  tsu-1.fa
23632  TTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCAATGATTTTTTCGGTGGGATTGATCACANTTNNN  van-0.fa
 
23712  ATAGTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  chr1.fa
23712  ATAGTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  bay-0.fa
23712  NNNNNATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  bor-4.fa
23712  NNNNNANCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  br-0.fa
23712  ATAGTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  bur-0.fa
23712  ATAGTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  c24.fa
23712  NNNNNATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  col-0.fa
23712  ATAGTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  cvi-0.fa
23712  NNNNNNTCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  est-1.fa
23712  ATAGTATCAAGAACGGTGGAGGCTTNCCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  fei-0.fa
23712  NNNNNNTCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATANNNNNNNTCAAATCAACGAGGTTACTGTAACT  got-7.fa
23712  NNNNNNTCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  ler-1.fa
23712  NNNNNNNNNNGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCNCAAATCAACGAGGTTACTGTAACT  lov-5.fa
23712  ATAGTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGNTTACTGTAACT  nfa-8.fa
23712  NNNNNNTCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACNNNNNNTCAAATCAACGAGGTTACTGTAACT  rrs-10.fa
23712  NNNNTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  rrs-7.fa
23712  ATAGTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  sha.fa
23712  NNNNNATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  tamm-2.fa
23712  NNNNNNNNAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  ts-1.fa
23712  NNNNNNNNAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACNNNNNNTCAAATCAACGAGGTTACTGTAACT  tsu-1.fa
23712  NNNNNATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGATACCAATTCTCAAATCAACGAGGTTACTGTAACT  van-0.fa
 
23792  CCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  chr1.fa
23792  CCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAANNNNCGAAAGA  bay-0.fa
23792  CCTCAGGTTATTGCTAAGGAGACAGTGNAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  bor-4.fa
23792  CCTCAGGTTATTGCTAAGGAGANNNNNAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  br-0.fa
23792  CCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  bur-0.fa
23792  CCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  c24.fa
23792  CCTCAGGTTATTGCTAAGGAGACAGTGNAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  col-0.fa
23792  CCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  cvi-0.fa
23792  CCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  est-1.fa
23792  CCTCAGGTTATTGCTAAGGAGACNGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  fei-0.fa
23792  CCTCAGGTTATTGCTAAGGAGACNGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  got-7.fa
23792  CCTCAGGTTATTGCTAAGGAGACNNNNAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  ler-1.fa
23792  CCTCAGGTTATTGCTAAGGAGACNGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  lov-5.fa
23792  CCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  nfa-8.fa
23792  CCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  rrs-10.fa
23792  CCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  rrs-7.fa
23792  CCTCAGGTTATTGCTAAGGAGACAGTGANGGAGAATGGGNNNNNNNTNAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  sha.fa
23792  CCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGNNNNNNNNNTNNNNGGCGGTAAGAGAGACGAATTCTCGAAAGA  tamm-2.fa
23792  CCTCAGGTTATTGCTAAGGAGACNNNNNAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCNCGAAAGA  ts-1.fa
23792  CCTCAGGTTATTGCTAAGGAGNNNNNNNNGGAGAATGGNTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  tsu-1.fa
23792  CCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAAGA  van-0.fa
 
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGTGAAAGGAGTAACCTTTCAGGTAGAGGGCATG  chr1.fa
23872  GGAAGNAGACAAGGATAGGAANAGAGCTAGGGTTTGTAGTTATCAGAGTGAAAGGNNNNNNNTTTCAGGTAGAGGGCATG  bay-0.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGTGAAAGNNNNNNNNNTTCAGGTAGAGGGCATG  bor-4.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGTGAANNNNNNNNNNNTTCAGGTAGAGGGCATG  br-0.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGTGAAAGGNNNNNNCTTTCAGGTAGAGGGCATG  bur-0.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGTGAAAGGNNNNNNNNTTCAGGTAGAGGGCATG  c24.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGTGAAAGNNNNNNNNNNTCAGGTAGAGGGCATG  col-0.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGTGAAAGGNNNNNNCTTTCAGGTAGAGGGCATG  cvi-0.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGTGAAANNNNNNNNNTTTCAGGTAGAGGGCATG  est-1.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGTGAAAGNNNNNNNCTTTCAGGTAGAGGGCATG  fei-0.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATNNNNNNNNNNNNNNNNNNNNNNCAGGTAGAGGGCANN  got-7.fa
23872  GGAAGGAGACAANGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGTGANNNNNNNNNNNNNNCAGGTAGAGGGCATG  ler-1.fa
23872  GGAAGGNNNNNNGGATNGNNANAGAGCTAGGGTTTGTAGTTATCAGAGNNNNNNNNNNNNNNNNNCAGGTAGAGGGCATG  lov-5.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGTGAAANNNNNNNNNNTTCAGGTAGAGGGCATG  nfa-8.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGNTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCANG  rrs-10.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGTGAAAGNNNNNNNNNNTCAGGTAGAGGGCATG  rrs-7.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGTGAAANNNNNNNNNNTTCAGGTAGAGGGCATG  sha.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGNGAAAGGANNNNNNNNTCAGGTAGAGGGCATG  tamm-2.fa
23872  GGAAGNNNNNNNNGATAGGAAGAGAGCNAGGGTTTGTAGTTNTCAGAGTGAAANNNNNNNNNNNNCAGGTAGAGGGCATG  ts-1.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGNGNNNNNNNNNNNNNNNNTCAGGTAGAGGGCATG  tsu-1.fa
23872  GGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGAGTGAAAGGAGNNNNNNNTCAGGTAGAGGGCATG  van-0.fa
 
23952  TTAATAATTCTAGGGAGGGAGATAGGTTTATGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACAATAAGAAG  chr1.fa
23952  TTAATAATTCTAGGGAGGGAGATAGGTTTATGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACAATAAGAAG  bay-0.fa
23952  TTAATAANNNNNNNNNNNGAGATAGGNNNNTGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACAATAANNNN  bor-4.fa
23952  TTAATANNNNNNNNNNNNGNGNNNNNNNNATGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACANNNNNNNN  br-0.fa
23952  TTAATAATTCTAGGGAGGGAGATAGGTTTATGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACAANAAGAAG  bur-0.fa
23952  TTAATAATTCTAGGGAGGGAGATAGGTTTATGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACNANNANAAG  c24.fa
23952  TTAATAATTNTANNNNNNNAGATNGNNNNNNNAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACAATAANNNN  col-0.fa
23952  TTAATAATTCTAGGGAGGGAGATAGGTTTATGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACAATAANNNN  cvi-0.fa
23952  TTAATNNNNNNNNNNNNNGAGATAGGTNTATGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACAANNNNNNN  est-1.fa
23952  TTAATAATTCTAGGGNGGGAGATNGGTTTATGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACAANAAGAAG  fei-0.fa
23952  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNACGTACTCGTAATTGGGACGAGGCGGGTAACANNNNNNNN  got-7.fa
23952  TTAANNNNNNTAGGGAGGGAGATNNNNNNNNNAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACANNNNNNNN  ler-1.fa
23952  TTAANNNNNNNNNNNNNNNNGATAGGTNNNNGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAANNNNNNNNNN  lov-5.fa
23952  TTAATAATTCTAGGGAGGGAGATAGGTTTATGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACAATAANNNN  nfa-8.fa
23952  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAANNNNNNNNNN  rrs-10.fa
23952  TTAATAANTCTAGGNNNNNNNNNAGNNNNNNNAATAGGAANNNNNNTCGTAATTGGGACGAGGCGGGTAACAATAANANN  rrs-7.fa
23952  TTAATAATTCTAGGGAGGGAGATAGGTTTATGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACAATAAGAAN  sha.fa
23952  TTAANNNNNNNNNNNNNNNNNNNNNNNNNNTGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACAANNNNNNN  tamm-2.fa
23952  TTAATAATTNTAGGGAGNGAGATNGGTTTATGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACAANNNNNNN  ts-1.fa
23952  TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACNNNNNNNNN  tsu-1.fa
23952  TTAANNNNNNNNNNNNNNGAGATAGGNNNNNGAATAGGAAACGTACTCGTAATTGGGACGAGGCGGGTAACANNNNNNNN  van-0.fa
 
24032  AAAAGGGAATGTAACAATTACAGAAGAGATGGTAGAGATAGAGAAGTTAGGGGTTATTGGGAGAGGGA   chr1.fa
24032  AAAAGGGAATGTAACAATTACAGAAGAGATGGTNGAGATAGAGAAGTTAGGGNNNNTTGGGAGAGGGA   bay-0.fa
24032  NNNNNNNNNNGTANNNNNNNNAGAAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNTNTTNNNNNNNGGA   bor-4.fa
24032  NNNNNNNNNNGTAANAATTNCAGAAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNGGNGAGGGA   br-0.fa
24032  AAAAGGGAATGTAACAATTACAGAAGAGATGGTAGAGATAGAGNAGTTAGGGGTTATTGGGAGAGGGA   bur-0.fa
24032  AAAAGGGAATGTAACAATTACAGAAGAGATGGNNNNNANAGNGAAGTTAGGGGTTATTGGGAGAGGGA   c24.fa
24032  NNNNNNNNNNNNNNNNNNNNCAGAAGANATNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAGAGGGA   col-0.fa
24032  ANNANGGAATGTAACAATTACAGAAGAGATNNNNNNNATNGNNNNNTTNNNNNNNNTTGGGAGAGGGA   cvi-0.fa
24032  NNNNNNNNNNNNNNNNNNNNNAGAAGAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGNGAGGGA   est-1.fa
24032  AAAANGGAATGTAACAATTACAGAAGAGATGGTNGAGATAGNNNNNNNNNNNNNNNTTGGGNGAGGGA   fei-0.fa
24032  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGA   got-7.fa
24032  NNNNNNNNNNNTANNNNNNNCAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTGGGNGAGGGA   ler-1.fa
24032  NNNNNNNNNNNNNNNNNNNNCNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGAGAGGGA   lov-5.fa
24032  ANNNNNNNATGTAACAATTACAGAAGAGATNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGGAGAGGGA   nfa-8.fa
24032  NNNNNNNNNNNNNNNNNNNACAGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGNNNNNNGA   rrs-10.fa
24032  NNNNNNNAATGTAACAATTACAGAAGAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGA   rrs-7.fa
24032  AAAAGGGAATGTAACAATTACAGAAGAGATNNNNNNNNNNNNNNNNNNNNNNNTTNTTGGGAGAGGGA   sha.fa
24032  NNNNNNNNNNGTAACAATNACAGAAGAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGA   tamm-2.fa
24032  NNNNNGNNANGTAACAATTACAGAAGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGA   ts-1.fa
24032  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGA   tsu-1.fa
24032  NNNNNNNNNNNNNANNNTNACAGAAGAGATNNNNNNNNNNNNNNNNNNNNNNNNNATTNNNNNNGGGA   van-0.fa
 
visited.