Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 26764774 - 26765181


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
26764774  TTATTTTAGTTTTCATTTCATTAATCTTTATTTATGCTAAATAATAATGTTGTTTCTCAAGTAGTGCTATCTTATTGCCA  chr1.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCAAGTNGTGCTATCTTATTGCCA  bay-0.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNTCAAGTAGTGCTATCTTATTGCCA  bor-4.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNTNNCNA  br-0.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNCNCAAGTAGTGCTATCTTATTNNNN  bur-0.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNCNCAAGTAGTGCTATCTTATTGCCA  c24.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTNNCAAGTAGTGCTATCTTATTGCCA  col-0.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCAAGTAGTGCTATCTTATTGCCA  cvi-0.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTCTCAAGTAGTGCTATCTTATTGCCA  est-1.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCAAGTNGTGCTATCTTATTGCCA  fei-0.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCAAGTNNNNNNNTCTTATTGCCA  got-7.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNTTNTTGCCA  ler-1.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCAAGTAGTGCTATCTTATTGCCA  lov-5.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCAAGTAGNGCTATCTTATTGCCA  nfa-8.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNCTCAAGTAGTGCTATCTTATTGCCA  rrs-10.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTCNCAAGTAGTGCTATCTTATTGCCA  rrs-7.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNTCAAGTAGTGCTATCTTATTGCCA  sha.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCNNNNNNNNNNNNNNNNTTNCCN  tamm-2.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCNNNNNNNNNTATCTTATTGCCA  ts-1.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTCTCAAGTAGTGCTATCTTATTGCCA  tsu-1.fa
26764774  NNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCAAGTNNNNCTATCTTNTTNCCN  van-0.fa
 
26764854  TTGGGATGGTTTGTTTTCATTTCTACTGTCGTTTATCTTTATTTATGCTAAAATAATAATATGTTTGTTCTATTCAGATT  chr1.fa
26764854  TTGGGATGGTNNNNNNNNNNNNCTNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  bay-0.fa
26764854  TTGGGATGGTTTGNNNNNNNNNCTNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  bor-4.fa
26764854  TTGGGATGGTNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  br-0.fa
26764854  NNGGGATGGTTTGNNNNNNNNNCTNNNNTNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNCAGATN  bur-0.fa
26764854  TTGGGATGGTTTGNNNNNNNNTCTACTGTCNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  c24.fa
26764854  TTGGGATGGTTTGTTNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  col-0.fa
26764854  TTGGGATGGNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  cvi-0.fa
26764854  TTGGGATGGTTTGNNNNNNNNTCTACTGTCNNTRNNNTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  est-1.fa
26764854  TTGGGATGGTTTGNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  fei-0.fa
26764854  TTGGGATGGTNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  got-7.fa
26764854  TTGGGATGGTTTNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  ler-1.fa
26764854  TTGGGATGGNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  lov-5.fa
26764854  TTGGGATGGTNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  nfa-8.fa
26764854  TTGGGATGGTTTGNNNNNNNNNCNACTGTCNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  rrs-10.fa
26764854  TTGGGATGGTTTGNNNNNNNNTCTACTGTCNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  rrs-7.fa
26764854  TTGGGATGGTTTNNNNNNNNNNCTACTGTCNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  sha.fa
26764854  TTGGGATGGTNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  tamm-2.fa
26764854  TTGGGATGGNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  ts-1.fa
26764854  TTGGGATGGTTTGTTNNNNNNTCTACTNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  tsu-1.fa
26764854  TTGGGATGGTNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  van-0.fa
 
26764934  ATAACTTCAATAACATTTCTAATTTCTATATATATATACTCACTATTTCTCAAGCTCTGAGAGCCTTTTCATGAAACCAA  chr1.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNTTTCTCAANNNRNNNGANCCTTTTCATGAAACCAA  bay-0.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNATTTCTCAANCNRNNNGAGCCTTTTCATGAAACCAA  bor-4.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNCTCANNNNRNNNNNNNNNNNNCATNAAACCAA  br-0.fa
26764934  ANNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNACTATTTCTCAAGCNRNNNGAGCCTTTTNNNNNNNNNNN  bur-0.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNATTTCTCAAGCTRTGAGAGCCTTTTCATGAAACCAA  c24.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNTCTCAAGCTRTGAGAGCCTTTTCATGAAACCAA  col-0.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNATTTCTCAANCNRNNNGAGCCTTTTCATGAAACCAA  cvi-0.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNATTTCTCAAGCTRTGAGAGCCTTTTCATGAAACCAA  est-1.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNTTTCTCAANNNRNGNGAGCCTTTTCATGANACCAA  fei-0.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNCTCAANNNRNNNGAGNCTTTTCATGAAACCAA  ler-1.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNTTCTCAAGNNRNNAGAGCCTTTTCATGAAACCAA  lov-5.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNTTCTCAANNNRNNNGAGCCTTTTCATGAAACCAA  nfa-8.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNTTCTCAAGCNRNGAGAGCCTTTTCANGAAACCAA  rrs-10.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNTTTCTCAANNNRNNAGAGCCTTTTCATGAAACCAA  rrs-7.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNATTTCTCAANCNRTGAGAGCCTTTTCATGAAACCAA  sha.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNCTCAANNNRNNNNNNNNNTTTCATNNNNCNAA  tamm-2.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNCTCAANNNRNNNGAGCCTTTTCANNNNNNCAA  ts-1.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNTTTCTCAAGNTRNNAGNGCCTTTTCATGAAACCAA  tsu-1.fa
26764934  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNCTCAANNNRNNNNNNNNNNTTNNNNNNNNNNN  van-0.fa
 
26765014  GGGGGTTCCATTCCAAAAATAAAAAAGAATTGAGTACAGAACAACGTTGTAAGATATGCAAGAATAAAGCATGGAAGCAA  chr1.fa
26765014  GGGGGTTCCNNNRRNNNNNNNNNNNNNNNNNNNNNACAGAACAACGNNNNAAGATNNNRRRRRRRRRRRRRRRRRRRRRR  bay-0.fa
26765014  GGGGGTTCCATNRRNNNNNNNNNNNNNNNNNNNNNNCAGAACAACGTTGTAAGATNNNRRRRRRRRRRRRRRRRRRRRRR  bor-4.fa
26765014  GNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRR  br-0.fa
26765014  NNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTTGTAAGATNTNRRRRRRRRRRRRRRRRRRRRRR  bur-0.fa
26765014  GGGGGNNNNNNNRRNNNNNNNNNNANNNNNNNNNNNNNNNNCAACGTTGTAAGATNNNRRRRRRRRRRRRRRRRRRRRRR  c24.fa
26765014  GGGGNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNTACAGAACAACGTTGTAAGATNNGRRRRRRRRRRRRRRRRRRRRRR  col-0.fa
26765014  GGGGGNTCCNNNRRNNNNNNNNNNNNNNNNNNNNNACAGAACAACGTTGTAAGNNNNNRRRRRRRGRRRRRRRRRRRRRR  cvi-0.fa
26765014  GGGGGTTCCANTRRNNNAANNNNNNNNNNTTGAGTACAGAACAACGTTGTAAGATATGRRRRRRRRRRRRRRRRRRRRRR  est-1.fa
26765014  GGGGGNTCNNNNRRNNNNNNNNNNNNNNNNNNNNNNCAGAACAACGTTGTAANNNNNNRRRRRRRRRRRRRRRRRRRRRR  fei-0.fa
26765014  NNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTAAGATNNNRRRRRRRRRRRRRRRRRRRRRR  got-7.fa
26765014  GGGGGNTCCNNNRRNNNNNNNNNNNNNNNNNNNNNNNAGNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRR  ler-1.fa
26765014  GGGGNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTGTAAGATNNNRRRRRRRRRRRRRRRRRRRRRR  lov-5.fa
26765014  GGGGGNTCCNNNRRNNNNNNNNNNNNNNNNNNNGTACAGAACAACGTTGTAAGATNNNRRRRRRRRRRRRRRRRRRRRRR  nfa-8.fa
26765014  GGGGGTNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNNNNACAACGTTGTAAGATNNGRRRRRRRRRRRRRRRRRRRRRR  rrs-10.fa
26765014  GGGGGTTCCNNNRRNNNAANAAAAAANNNNNGAGTACAGAACAACGTTGTAAGANNNNRRRRRRRGRRRRRRRRRRRRRR  rrs-7.fa
26765014  GGGGGTTCCNNNRRNNNNNNNNNNNNNNNNNNNNNACAGAACAACGTTGTAAGATNNNRRRRRRRRRRRRRRRRRRRRRR  sha.fa
26765014  GGGGNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAANNNNNNRRRRRRRRRRRRRRRRRRRRRR  tamm-2.fa
26765014  GGGGGTTCCNNNRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGNNNNNRRRRRRRRRRRRRRRRRRRRRR  ts-1.fa
26765014  GGGGGNTCCANNRRNNNNNNNNNNAANNNNNNNGTACAGAACAACGTTGTAAGNNNNNRRRRRRRRRRRRRRRRRRRRRR  tsu-1.fa
26765014  NNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRR  van-0.fa
 
26765094  ATATTAGCCAGAAAGATCAACCCAGAGTCGAGATGAAAAAAATGTTCCAAGTAAGAAATCAAACATTCATATATAATACT  chr1.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNNATGAAAAAAANNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bay-0.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGANANGAAAANNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRNANNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGAGATGAAAANNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGAGANGAAAAAANNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGANATGAAAANNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGAGATGAAAAAAATGTTCCNARNNNNNNNNCNNNNNNNNNNNNNNNNNNNN  est-1.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGANATGANNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGANNNNNNAAAAATGTNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNNANGAAAANNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNNATNAAANNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGANANGAAAAAAANNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGANATNAANNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGAGATGAAAANNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNNATGAAAAAAATGNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGAGATGAAAAAAATGTTCNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
26765094  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNNANGAAAANNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
26765174  TGTTCAGA   chr1.fa
26765174  NNNNNNRR   bay-0.fa
26765174  NNNNNNRR   bor-4.fa
26765174  NNNNNNRR   br-0.fa
26765174  NNNNNNRR   bur-0.fa
26765174  NNNNNNRR   c24.fa
26765174  NNNNNNRR   col-0.fa
26765174  NNTNNNRR   cvi-0.fa
26765174  NNTNNARR   est-1.fa
26765174  NNNNNNRR   fei-0.fa
26765174  NNNNNNRR   got-7.fa
26765174  NNNNNNRR   ler-1.fa
26765174  NNNNNNRR   lov-5.fa
26765174  NNNNNNRR   nfa-8.fa
26765174  NNNNNNRR   rrs-10.fa
26765174  NNNNNNRR   rrs-7.fa
26765174  NNNNNNRR   sha.fa
26765174  NNNNNNRR   tamm-2.fa
26765174  NNNNNNRR   ts-1.fa
26765174  NNNNNNRR   tsu-1.fa
26765174  NNNNNNRR   van-0.fa
 
visited.