Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 31382 - 32670


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
31382  TCAACGCCTCAGGGTGTGGAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTAAT  chr1.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTAAT  bay-0.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTAAN  bor-4.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTANN  br-0.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTAAT  bur-0.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTAAT  c24.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTAAN  col-0.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTAAT  cvi-0.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTAAT  est-1.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTAAT  fei-0.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCNNNNNN  got-7.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTAAT  ler-1.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTAAT  lov-5.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTAAT  nfa-8.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGNGAATTCAGAATCCAGAGTTGCTTTNNN  rrs-10.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTAAT  rrs-7.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCNNNNNNNNANNNNNNNNNNNT  sha.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAANNNNNNNNNNNANNNNNNNNNNNN  tamm-2.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTAAT  ts-1.fa
31382  TCAACGCCTCAGGGTGTGRAGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTNNNN  tsu-1.fa
31382  TCAACGCCTCAGGGTGTGRNGAATGTATTCAGCATAGAGGTCCCTGTAATGGGGAATTCAGAATCCAGAGTTGCTTTNNN  van-0.fa
 
31462  GTTACAAACTAAAAAAGATGTAAGAGAGTTTGGTTCTTGATAAAGAAACAGAGGCTTACATTGAGTACTGGATAGCTTCA  chr1.fa
31462  GTTACAAACTAAAAAAGATGTAAGAGAGTTTGGTTCTTGATAAAGAAACAGAGGCTTACATTGAGTACTGGATAGCTTCA  bay-0.fa
31462  NNNNNNNNNNNNNNNNNNNNNNNGAGAGTTTGGNNNNNNNNNNNNNNNNNNNNANNNNNNNTGAGTACTGGATAGCTTCA  bor-4.fa
31462  NNNNNNNNNNAAAAANNNNNTAAGAGAGTTTGGTTCTTNNNNNNGAAACAGAGGCTTACATTGAGTACTGGATAGCTTCA  br-0.fa
31462  GTTACAAACTAAAAAAGATGTAAGAGAGTTTGGTTCTTGATAAAGNNNNNNNNACTTACATTGAGTACTGGATAGCTTCA  bur-0.fa
31462  GTTACAAACTAAAAAAGATGTAAGAGAGTTTGGTTCTTGATNNNNANNCNNNNACTTACATTGAGTACTGGATAGCTTCA  c24.fa
31462  NNNNNNNNNNNNAAANNNNNNNAGAGAGTTTGGTTNTNNANAAAGAAACAGAGGCTTACATTGAGTACTGGATAGCTTCA  col-0.fa
31462  GTTACAAACTAAAAAANATGTAAGAGAGTTTGGTTCTTGATNNNNNNNNNNNNANNNACATTGAGTACTGGATAGCTTCA  cvi-0.fa
31462  GNNNNNNNNNNNNNNNNATGTAAGAGAGTTTGGTTNTNNANAAAGAAACAGAGGCTTACATTGAGTACTGGATAGCTTCA  est-1.fa
31462  GTTACAAACTAAAAAAGATGTAAGAGAGTTTGGTTCTTGATNNNNNNNNNNNNACTTACATTGAGTACTGGATAGCTTCA  fei-0.fa
31462  NNNNNNNNNNNNNNNNNNNNNNNNNGAGTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACTGGATAGCTTCA  got-7.fa
31462  GNNNNNNNNNAAAANNNNNNNAAGAGAGTTTGGTTNNNNNNNNNGAAACAGAGGCTTACATTGAGTACTGGATAGCTTCA  ler-1.fa
31462  GNNNNNNNNNNNNNNNNNNNNNNNNNAGTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTACTGGATAGCTTCA  lov-5.fa
31462  GTTACAAACNAAAAAAGATGTAAGAGAGTTTGGTTCTTGANAAAGAAACAGAGGCTTACATTGAGTACTGGATAGCTTCA  nfa-8.fa
31462  NNNNNNNNNNNNNNNNNNNNTAAGAGAGTTTGGNNNNNNNNNNNGAAACAGAGGCTTACATTGAGTACTGGATAGCTTCA  rrs-10.fa
31462  GTTNNNNNNNAAAAAANATGTAAGAGAGTTTGGTTCTTGNNNNNNNNNNNNNNANNNNNNNTGAGTACTGGATAGCTTCA  rrs-7.fa
31462  GTTACAAACTAAAAAAGANGTAAGAGAGTTTGGTTCTTGATNNNNNNNNNNNNANNNNCATTGAGTACTGGATAGCTTCA  sha.fa
31462  NNNNNNNNNNNNAAANNNNNTAAGAGAGTTTGGTTNTNNNNNNNNNNNNNNNNANNNNNNTTGAGTACTGGATAGCTTCA  tamm-2.fa
31462  GTTNCNNNNNAAAAANNNNNNNNNAGAGTTNGGTTCTNNNNNNNGAAACAGAGGCTTACATTGAGTACTGGATAGCTTCA  ts-1.fa
31462  NNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTACTGGATAGCTTCA  tsu-1.fa
31462  NNNNNNNNNNANANNNNNNNNAAGAGNNNNNGNNNNNNNNNNNNNNNNNNNNNANNNNCATTGAGTACTGGATAGCTTCA  van-0.fa
 
31542  ACCGCAGACTCAGATGGCAGAAAATCATTCACTGCAACTTCCTTGTTCTCGTTTTTCTTGTCTGTAAGATATTAGAGTTA  chr1.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRNTTGRRRRRRRTNTTCTTGTCTGTAAGATATTAGAGTTA  bay-0.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTTTTCTTGNNNNNNNNNNNNNNNNNNNN  bor-4.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNTTCTTGNNNNNNNNNNNNNNNNNNNN  br-0.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNTTCTTGTCTGTAAGATATTAGANTTA  bur-0.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNTTCTTGTCTGTAAGATATTAGAGTTA  c24.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNTTCTTGTNNNNNNNNNNNNNNNNNNN  col-0.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNTTCTTGTCTGTANGNNNNNNNNNNNA  cvi-0.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTTTTCTTGTNNNNNNNNNNNNNNNNNNN  est-1.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNTTCTTGTCTGTAAGANATTAGAGNTA  fei-0.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNTTCTTGNNNNNNNNNNNNNNNNNNNN  got-7.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNTTCTTGTCTGNNNNNNNNNNNNNNNN  ler-1.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNTTCTTGNNNNNNNNNNNNNNNNNNNN  lov-5.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNTTCTTGTCTGTNAGATNNNNNNNNNN  nfa-8.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNTTCTTGTCNNNNNNNNNNNNNNNNNN  rrs-10.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTTTTCTTGTCNNNNNNNNNNNNNNNNNN  rrs-7.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNNTCTTGTCNNNNNNNNNNNNNNGNTA  sha.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNTTCTTGTCNNNNNNNNNNNNNNNNNN  tamm-2.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTNNRRRRRRRNNTTCTTGTCTGTAAGANNNNNNNNNNN  ts-1.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNTTCTTNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
31542  ACCGCAGACTCAGATGGCAGAAAATCATRRRRRRRRRRRRRCTTGRRRRRRRTNTTCTTGTNNNNNNNNNNNNNNNNNNN  van-0.fa
 
31622  AAGGGAAAAACTAATACTTGTTGAGAGATCAATAGAGATGAATAAGGAGGAACACTGAAGAAAAAGGATACAGTCTTCGA  chr1.fa
31622  AAGGGAAAAACTAATACTTGTTGAGAGATCAATAGAGATGAATAAGGAGGAACACTGAAGAAAAAGGATACAGTCNNCRA  bay-0.fa
31622  NNNNNNNNNNNNNNNNNTNGTTGAGAGATCNNNNNNNNNNNNNNAGGAGGAACACTGAAGAAAAAGGATACAGTCNNCRA  bor-4.fa
31622  NNNNNNAAAACTAATACTTGTTGAGAGATCAANAGAGATGAATAAGGAGGAACNCTGAAGAAAAAGGATACAGTCNNCRA  br-0.fa
31622  AAGGGAAAAACTAATACTTGTTGAGAGATCAATAGAGATGAATAAGGAGGAACACTGAAGAAAAAGGATACAGTCNNCRA  bur-0.fa
31622  AAGGGAAAAACTAATACTTGTTGAGAGATCAATAGAGATGAATAAGGAGGAACACTGAAGAAAAAGGATACAGTCNNCRA  c24.fa
31622  NNNNNNNAAACTAATACTTGTTGAGAGATCAANAGNGANGAATAAGGAGGAACACTGAAGAAAAAGGATACAGTCNNCRA  col-0.fa
31622  AAGGGAAAAACTAATACTTGTTGAGAGATCAATAGAGATGAATAAGGAGGAACACTGAAGAAAAAGGATACAGTCNNCRA  cvi-0.fa
31622  NNNNNNNNNNNNNATACTTGTTGAGAGATCNNNNNNNNNNNNNNAGGAGGAANACTGAAGAAAAAGGATACAGTCNNCRA  est-1.fa
31622  AAGGGAAAAACTAATACTTGTTGAGAGATCAATAGAGATGAATAAGGAGGAACACTGAAGAAAAAGGATACAGTCNNCRA  fei-0.fa
31622  NNNNNNNNNNNNNNNNNNNNNTGNGAGNNNNNNNNNNNNNNNNNNGGAGNAANACNGAAGAANNNNNATACAGTCTTCRA  got-7.fa
31622  NNNNGNNNNACTAATACTTGTTGAGAGATCNNNNNNNNNNNNNAAGGAGGAANACTGAAGAAAAAGGATACAGTCNNNRA  ler-1.fa
31622  NNNNNNNNNNNNNATACTTGTTGAGAGATCNNNNNNNNNNNNNNAGGAGGNNNNNNNAAGAAAAAGGATACAGTCNNCRA  lov-5.fa
31622  AAGGGAAAAACTAATACTTGTTGAGAGATCAATAGAGATGAATAAGGAGGAACACTGAAGAAAAAGGATACAGTCNNCRA  nfa-8.fa
31622  NNNNNNNNANCTAATANTTGTTGAGAGATNNNNNNNNANGAATAAGGAGGAACACTGAAGAAAAAGGATACAGTCTNCRA  rrs-10.fa
31622  NNNNNAAAAANTAATACTTGTTGAGAGATCNNNNNNNANNNNNAAGGAGGAACACTGAAGAAAAAGGATANNNNNNNNRN  rrs-7.fa
31622  AAGGGAAAAACTAATACTTGTTGAGAGATCAATAGAGATGAATAAGGAGGAACACTGAAGAAAAAGGATACAGTCNNCRA  sha.fa
31622  NNNNNNNAAACTAATACTTGTTGAGAGATCAANAGAGATGAATAAGGAGGAACACTGAAGAAAAAGGATACAGTCNNCRA  tamm-2.fa
31622  NNGNGAAAAACTAATACTTGTTGAGAGATCAANAGAGATGAATAAGGAGGAACACTGAAGAAAAAGGATACAGTCNNCRA  ts-1.fa
31622  NNNNNNNNNNNNNNNNNNTGNTGAGAGATNNNNNNNNNNNNNNNNGGNNNNNNNCNGAAGAAAANGGATACAGNNNNCRA  tsu-1.fa
31622  NNNNNNNNAANNNNNACTTGTTGAGAGATCAANANNNNNNNATAAGGAGGAACACTGAAGAAAAAGGATACAGTCTNCRA  van-0.fa
 
31702  AGAAACGACGGATTTCAGAGAGACGGTGAGGAGGAAGTTCTTTGATGTCAGTGTAGTGCTTATATTCAGGATCATCAACA  chr1.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRNGNNGAGGAAGTTNRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  bay-0.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRNGAGGAGGAAGTTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  bor-4.fa
31702  RRRRRCGNCGGATTTCAGRRAGACGRNGAGGAGGAAGTTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  br-0.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRTGNGGAGGAAGTTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  bur-0.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRTGAGGAGGAAGTTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  c24.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRNGAGGAGGAAGTTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  col-0.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRTGAGGAGGAAGTTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  cvi-0.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRTGAGGAGGAAGTTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  est-1.fa
31702  RRRRRCGNCGGATTTCNGRRNGACGRNGNGGAGGAAGTTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  fei-0.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRTGAGGAGGAAGTTCRTTNATGTCAGTGTAGTGCTTATANNCRRRATCATCARRR  got-7.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRNGNGGAGGAAGTTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  ler-1.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRNGNGGAGGAAGNTNRTTGATGTCAGTGTAGTGCTTATANTCRRRATCANCARRR  lov-5.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRNGAGGAGGAAGNTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  nfa-8.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRTGAGGAGGAAGTTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  rrs-10.fa
31702  RRRRRCGACGGATTTCAGRRAGNCGRTGAGGAGGAAGTTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  rrs-7.fa
31702  RRRRRCGACGGATTTCAGRRAGNCGRNGAGGAGGAAGNTCRTNGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  sha.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRTGNGGAGGAAGNTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  tamm-2.fa
31702  RRRRRCGNCGGATTTCAGRRAGNCGRNGAGGAGGAAGNTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  ts-1.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRNGAGGAGGAAGTTNRTTGATGTCAGTGTAGTGCTTATANNCRRRANCATCARRR  tsu-1.fa
31702  RRRRRCGACGGATTTCAGRRAGACGRTGNNNNGGAAGTTCRTTGATGTCAGTGTAGTGCTTATANTCRRRATCATCARRR  van-0.fa
 
31782  CACACTGCAATGATCTTGTCATCTTTTTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  chr1.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTTTTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  bay-0.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRNNNTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  bor-4.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTNNTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  br-0.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTTTTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  bur-0.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTTTTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  c24.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTNTTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  col-0.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTTTTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  cvi-0.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTNNTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  est-1.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTTTTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  fei-0.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRNNNTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  got-7.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTNTTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  ler-1.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTNNTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  lov-5.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTNTTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  nfa-8.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTTTTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  rrs-10.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTNTTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  rrs-7.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTTTTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  sha.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTNNTNACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  tamm-2.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRTNTTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  ts-1.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRNNNTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  tsu-1.fa
31782  RRRRRRRRRRRRRRRRRRRRRRRRNNTTCACCCTAAAATTACAGCGCCAAAAATACAAGATTGGAGTACAAGACCATTTA  van-0.fa
 
31862  AACTGACCTAAAGGATTAGAGTAAGAGAAAAAAAAAACAGAGTCTTTTCATTGATCAAGTTTAGGTTTTACCTGGTCAAT  chr1.fa
31862  AACTGACCTAAAGGATTAGAGTNNNNNNNNNNNNAAACAGAGTCTTTTCATTGATCAAGTTTAGGTTTTACCTGGTCRRR  bay-0.fa
31862  AACTNACCTAAAGGNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNGTTTAGGTTTTACCTGGTCRRR  bor-4.fa
31862  AACTGACCTAAAGGNNNNNNNNNNNNNNNNNNNAAANNNNNNNNNTTTCNNNNNNNNNNTTTAGGTTTTACCTGGTCRRR  br-0.fa
31862  AACTGACCTAAAGGATTAGAGTNNNNNNNNANAAAAACAGAGTCTTTTCATTGATCAAGTTTAGGTTTTACCTGGTCRRR  bur-0.fa
31862  AACTGACCTAAAGGANNNNNNNNNNNNNNNNNNNAAACAGAGTCTTTTCATTGATCAAGTTTAGGTTTTACCTGGTCRRR  c24.fa
31862  AACTGACCTAAAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATTGATCAAGTTTAGGTTTTACCTGGTCRRR  col-0.fa
31862  AACTGACCTAAAGGATNNNNNNNNNNNNNNNNNAAANNNNNGTCTTTTCATTGATCAAGTTTAGGTTTTACCTGGTCRRR  cvi-0.fa
31862  AACTGACCTAAAGGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNGTTTAGGTTTTACCTGGTCRRR  est-1.fa
31862  AACTGACCTAAAGGATTAGAGNNNNNNNNNNNAAAAACAGAGTCTTTTCATTGATCAAGTTTAGGTTTTACCTGGTCRRR  fei-0.fa
31862  AACTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAGGTTTTACCTGGTCRRR  got-7.fa
31862  AACTGACCTAAAGGANNNNNNNNNNNNNNNNNNNNAANNNNNNNNNNNNNTTNATCAAGTTTAGGTTTTACCTGGTCRRR  ler-1.fa
31862  AACTGACCTAAAGGNNNNNNNNNNNNNNNNNNAANNNNNNNNNNNNNNNNNNNATCAAGTTTAGGTTTTACCTGGTCRRR  lov-5.fa
31862  AACTGACCTAAAGGANNNNNNNNNNNNNNNNNNNAAACAGNNNNNNNTCATTGATCAAGTTTAGGTTTTACCTGGTCRRR  nfa-8.fa
31862  AACTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTTACCTGGTCRRR  rrs-10.fa
31862  AACTGACCTAAAGGANNNNNNNNNNNNNNNNNAAAAACANNNNNNNTTCATTGNNCAAGTTTAGGTTTTACCTGGTCRRR  rrs-7.fa
31862  AACTGACCTAAAGGANNNNNNNNNNNNNNNNNNNAAACAGAGNNNNNTCATTNNNNNNNNNNNNANNNTNCCTGGTCRRR  sha.fa
31862  AACTGACCTAAAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNTCRRR  tamm-2.fa
31862  AACTGACCTAAAGGATNNNNNNNNNNNNNNNNNNAAACAGNNNNNNNNCNTTGATCAAGTTTAGGTTTTACCTGGTCRRR  ts-1.fa
31862  AACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAGGTTTTACCTGGTCRRR  tsu-1.fa
31862  AACTGACCTNAAGGNNNNNNNNNNNNNNNNNNAAAANNNNNNNNNNNNNANNNNNNNAGTTTAGGTTTTACCTGGTCRRR  van-0.fa
 
31942  CATAGGCATTAATCCAATGGCTCTGGCACGCAGAAAACAACCCGGAAGCACAGGTTCCTACACAAAGATAATAATATATA  chr1.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACAAAGATAATAATNNNNN  bay-0.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACANNNNNNNNNNNNNNNN  bor-4.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACAANNNNNNNNNNNNNNN  br-0.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACAAANNNNNNNNNNNNNN  bur-0.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACAANNNNNNNNNNNNNNN  c24.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACANNNNNNNNNNNNNNNN  col-0.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACANNNNNNNNNNNNNNNN  cvi-0.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACAANNNNNNNNNNNNNNN  est-1.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACANNNNNNNNNNNNNNNN  fei-0.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACNNNNNNNNNNNNNNNNN  got-7.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACANNNNNNNNNNNNNNNN  ler-1.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACNNNNNNNNNNNNNNNNN  lov-5.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACANNNNNNNNNNNNNNNN  nfa-8.fa
31942  RRRRRRNRRRRRTCCARRGGNTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACANNNNNNNNNNNNNNNN  rrs-10.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACANNNNNNNNNNNNNNNN  rrs-7.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACANNNNNNNNNNNNNNNN  sha.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACANNNNNNNNNNNNNNNN  tamm-2.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACAANNNNNNNNNNNNNNN  ts-1.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACNNNNNNNNNNNNNNNNN  tsu-1.fa
31942  RRRRRRCRRRRRTCCARRGGCTCTGGCACGCAGAAAACAARRRRRRRGCACAGGTTCCTACACANNNNNNNNNNNNNNNN  van-0.fa
 
32022  TTTGAAATACAAAAAATTGGTGCAAATAGTATAGGGATAATATGAGAAAGAAAGAAAGAGTAATACCTGCATGATGACTA  chr1.fa
32022  NNRNAAATACAAAAAATTGGTGCAAATAGTATAGGGATAATATGAGNNNNNNNNAAAGAGTAANACCTGCATGATGACTA  bay-0.fa
32022  NNRNNNNNNCAAAAAATTGGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATACCTGCATGATGACTA  bor-4.fa
32022  NNRNNNNNNNAAAAAATTGGTGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATACCTGCATGATGACTA  br-0.fa
32022  NNRNNNNNACAAAAAATTGGTGCAAATAGTATANNNNNNATATGAGNNNNNNNNNNNGAGTAATACCTGCATGATGACTA  bur-0.fa
32022  NNRNNNNNACAAAAAATTGGTGCAAATAGTATAGGGATAANATGNNNNNNNNNNNAAGAGTAATACCTGCATGATGACTA  c24.fa
32022  NNRNNNNNNNAAAAAATTGGTGCAAATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTAATACCTGCATGATGACTA  col-0.fa
32022  NNRNNNNNNCAAAAAATTGGTGCAAATAGTATAGGNNNNNNNNNNNNNNNNNNNNNNGAGTAATACCTGCATGATGACTA  cvi-0.fa
32022  NNRNNNNNNNNAAAAATTGGTGCAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATACCTGCATGATGACTA  est-1.fa
32022  NNRNNNNNACAAAAAATTGGTGCAAATAGTATAGGNNNNNNNNNNNNNNNNNNNNNNGAGTAATACCTGCATGATGACTA  fei-0.fa
32022  NNRNNNNNNNAAAAAATTGGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATACCTGCATGATGACTA  got-7.fa
32022  NNRNNNNNNNAAAAAATTGGTGCAAATAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATACCTGCATGATGACTA  ler-1.fa
32022  NNRNNNNNNNAAAAAATTGGTGCAAATAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATACCTGCATGATGACTA  lov-5.fa
32022  NNRNNNNNNNAAAAAATTGGTGCAAATAGTATANNNNNNNNNNNNNNNNNNNNNNNNNAGTAATACCTGCATGATGACTA  nfa-8.fa
32022  NNRNNNNNNNNAAAAATTGGTGNNNNNAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACCTGCATGATGACTA  rrs-10.fa
32022  NNRNNNNNNNNNAAAATTGGTGCAAATAGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAATACCTGCATGATGACTA  rrs-7.fa
32022  NNRNNNNNNCAAAAAATTGGTGCAAATAGTATNNNNNNNNNNNNNNNNNNNNNNNNNGAGTAATACCTGCATGATGACTA  sha.fa
32022  NNRNNNNNNNNNAAAATTGGTGCAAATAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNAGTAATACCTGCATGATGACTA  tamm-2.fa
32022  NNRNNNNNNNNNNNNNNNNNTGCAAATNGTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTGCATGATGACTA  ts-1.fa
32022  NNRNNNNNNNAAAAAATTGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATACCTGCATGATGACTA  tsu-1.fa
32022  NNRNNNNNNNNAAAAATTGGTGCAAATAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCATGATGACTA  van-0.fa
 
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGGGTACACAACTGATGAGTAG  chr1.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGGGTACACAACTGATGAGTAG  bay-0.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGNGTACACAACTGATGAGTAG  bor-4.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGGGTACACAACTGATGAGTAG  br-0.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGGGTACACAACTGATGAGTAG  bur-0.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGGGTACACAACTGATGAGTAG  c24.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGGNTACACAACTGATGAGTAG  col-0.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGGGTACACAACTGATGAGTAG  cvi-0.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGGGTACACAACTGATGAGTAG  est-1.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGGGTACACAACTGATGAGTAG  fei-0.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGNGTACACAACTGATGAGTAG  got-7.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGNNNNTACACAACTGATGAGTAG  ler-1.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTNNNNNNNCACAACTGATGAGTAG  lov-5.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGNGTACACAACTGATGAGTAG  nfa-8.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGNGTACACAACTGATGAGTAG  rrs-10.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGNGTACACAACTGATGAGTAG  rrs-7.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTNNNNNNNCACAACTGATGAGTAG  sha.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGNGTACACAACTGATGAGTAG  tamm-2.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGGGTACACAACTGATGAGTAG  ts-1.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGNNNNNNTACACAACTGATGAGTAG  tsu-1.fa
32102  AGACATCAATGGGGTCATTGTCTTCACACAATGTGCGAGGAACAAAACCATAGTTGTGAGGGTACACAACTGATGAGTAG  van-0.fa
 
32182  AGAATACGATCAACCTGAATGAGAGAATTCAAACTTGTTGAGATTGATTTTGCTATAAGAAAACCATTCATATAAAAAAT  chr1.fa
32182  AGAATACGATCAACCTGAATGAGAGAATTCAAACTTGTTGAGATTGATTTTGCTATAAGAAAACCATTCNNNNNAAAAAN  bay-0.fa
32182  AGAATACGATCAACCTGANNNNNNNNNNCNNNNNNNNNNNNGATTGANNNNNNTATNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
32182  AGAATACGATCAACCTGAATGAGNNNNNCNNNNNNNNNNGAGATTGATTTTGCNATNAGNNNNNNNNNNNNNNNNNNNNN  br-0.fa
32182  AGAATACGATCAACCTGAATGAGAGNNNCNAAACTTGTTGAGATTGATTTTGCTATAAGAAAANNNNNNNNNNNNNAAAT  bur-0.fa
32182  AGAATACGATCAACCTGAATGAGAGNNNCNAAACTTGTTGAGATTGATTTTGCTATAAGAAAACNNNNNNNNNNNNNNNN  c24.fa
32182  AGAATACGATCAACCTGAATGAGAGAATTCAAACTTGTTGAGATTGATTTTGCTATAAGNNNNNNNNNNNNNNNNNNNNN  col-0.fa
32182  AGAATACGATCAACCTGAATGAGANNNNCNNNNNTTGTTGAGATTGATTTTGCTATAAGAAANNNNNNNNNNNNNNNNAN  cvi-0.fa
32182  AGAATACGATCAACCTGAATGAGAGAATTCAAACTTGTTGAGATTGATTTTGCTATAAGAANNNNNNNNNNNNNNNNNAN  est-1.fa
32182  AGAATACGATCAACCTGAATGAGAGNNNCNANNCNTGTTGAGATTGATTTTGCTATAAGAAAANNNNNNNNNNNNNNNNN  fei-0.fa
32182  AGAATACGANCAACCTGNNNNNNNNNNNNNNNNNNNNNNNNGATTGNTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
32182  AGAATACGATCAACCTGANNNNNNNNNNCNNNNNNNNNNNAGATTGATTTTGCTATAAGANNNNNNNNNNNNNNNNNNNN  ler-1.fa
32182  AGAATACGATCAACCTGAANNNNNNNNNCNNNNNNNNNNNAGATTGATTTTGCTATANNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
32182  AGAATACGATCAACCTGAATGAGNNNNNCNNNNNNNNTTGAGATTGATTTTGCTATAAGAANNNNNNNNNNNNNNNNNNN  nfa-8.fa
32182  AGAATACGATCAACCTGAATGNNNNNNNCNNNNNNNNNNNAGATTGATTTTGCTATAAGANNNNNNNNNNNNNNNNNNNN  rrs-10.fa
32182  AGAATACGATCAACCTGANNNNNNNNNNCNNNNNNNNNNNNGATTGATTTTGCTATAAGANNNNNNNNNNNNNNNNNNNN  rrs-7.fa
32182  AGAATACGATCAACCTGAATGAGNNNNNCNNNNNNNNNNGAGATTGATTTTGCTATAAGAAANNNNNNNNNNNNNNNNNN  sha.fa
32182  AGAATACGATCAACCTGAATGNNNNNNNCNNNNNNNNNNNAGATTGATTTTGCTATAAGAANNNNNNNNNNNNNNNNNNN  tamm-2.fa
32182  AGAATACGATCAACCTGAATNNNNNNNNCNNNNNNNNNTGAGATTGATTTTGCTATAAGAAANNNNNNNNNNNNNNNNNN  ts-1.fa
32182  AGAATACGATCAACCTGANNNNNNNNNNCNNNNNNNNNNNNGATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
32182  AGAATACGATCAACCTGAATGNNNNNNNCNNNNNNNNNNNAGATTGATTTTGCTATAAGANNNNNNNNNNNNNNNNNNNN  van-0.fa
 
32262  AAACTTTGTTCTCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  chr1.fa
32262  AAACTTTGTTCNCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  bay-0.fa
32262  NNNNNNNNNNNNCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGNGATCTC  bor-4.fa
32262  NNACNTTNTTCTCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  br-0.fa
32262  AAACTTTGTTCNCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  bur-0.fa
32262  NNACTTTGTTCNCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  c24.fa
32262  NNNNNNNNNNNNCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  col-0.fa
32262  AAACTTTGTTCNCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  cvi-0.fa
32262  NNNNNNNGTTCTCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  est-1.fa
32262  NAACTTTGTTCNCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  fei-0.fa
32262  NNNNNNNNNNNTCATNNNNNCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  got-7.fa
32262  NNNNNNNNNTCTCATCTANCCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  ler-1.fa
32262  NNNNNNNNNNNNCANCTNACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  lov-5.fa
32262  NAACTTTGTTCNCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  nfa-8.fa
32262  NNNNNNNGTTCTCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  rrs-10.fa
32262  NNNNNNNNNNCTCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  rrs-7.fa
32262  NNNCTTTGTTCTCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  sha.fa
32262  NNNNNNNNNNNNCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  tamm-2.fa
32262  NNNNNNTGTTCTCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  ts-1.fa
32262  NNNNNNNNNNNNCATCTNACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  tsu-1.fa
32262  NNNNNNNNNNNNCATCTAACCTTGATGAGTCCTGTCTTTTTGTCAAGCTCGTATTTGACCTTGCTTCCTTTAGTGATCTC  van-0.fa
 
32342  AACAACCTAATAATCATCCAAAGATAAAATGATTAGAGAATCTAATAACAACATACTCTGTTTAGAACAAAGAGTAGGAA  chr1.fa
32342  AACAACCTAATAATCATCCAAAGATAAAATGATTAGAGAATCTAATAACAACATACTCTGTTTAGAACAAAGAGTAGGAA  bay-0.fa
32342  AACAACCNAANAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTTTAGANNNNNNNNNAGGAA  bor-4.fa
32342  AACAACCNAATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAACATACTCTGTTTAGAACAAANNNNAGGAA  br-0.fa
32342  AACAACCTAATAATCATCCAAAGATAAAATGATTAGAGAATCTAATAACAACATACTCTGTTTAGAACAAAGAGTAGGAA  bur-0.fa
32342  AACAACCTAATAATCATCCAAAGATAAAATGATTAGNGAATCTAANAACAACATACTCTGTTTAGAACAAAGAGTAGGAA  c24.fa
32342  AACAACCNNNNNNNNNNCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACATNCTCTGTTTNGANCNNNNNGTAGGAA  col-0.fa
32342  AACAACCTAATAATCATCCAAAGATNNNNNNNNNNNNNNNNNNAATAACAACATACTCTGTTTAGAACAAAGAGTAGGAA  cvi-0.fa
32342  AACAACCTAATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACANNNNNNNCTGTTTANNNNNNNNNNNAGGAA  est-1.fa
32342  AACAACCTAATAATCATCCAAAGATAAAATGNNNNNNNAATCTAATAACAANATACTCTGTTTAGAACAAAGAGTAGGAA  fei-0.fa
32342  AACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAA  got-7.fa
32342  AACAACCTAATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACANNNNNCTCTGTTNNNNNNNNNNNGTAGGAA  ler-1.fa
32342  AACAACCTAATAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTNNNNNNNNNNNNNTAGGAA  lov-5.fa
32342  AACAACCTAATAATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNATAACAACATACTCTGTTTAGAACNAAGAGTAGGAA  nfa-8.fa
32342  AACAACCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCTGTNNNNNNNNNNNAGTAGGAA  rrs-10.fa
32342  AACAACCTAATAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTNNNNNNNNNNNNGTAGGAA  rrs-7.fa
32342  AACAACCTAATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNATAACAACATACTCTGTTTAGAACAAAGAGTAGGAA  sha.fa
32342  AACAACCTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNCTCTGTTTAGANNNNNNNGTAGGAA  tamm-2.fa
32342  AACAACCTAATAATCATCCAAANNNNNNNNNNNNNNNNNNNNNNNNAACAANNNNNNCTGTTTANAACAAANNNNAGGAA  ts-1.fa
32342  AACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAA  tsu-1.fa
32342  AACAACCNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNTCTGTTTAGANNNNNNNGTAGGAA  van-0.fa
 
32422  AAAACTTACCACATTGAAAATCTGTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGATTTAGTAACAGAATACA  chr1.fa
32422  AAAACTTACCACATTGAAAATCRRTGNAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGATTTAGTAACAGAATACA  bay-0.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGANNNNNNNNNNNNNNNNN  bor-4.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTANCCAGACTTATGATTNNNNNNNNNNNNNNN  br-0.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGATTTAGTAACAGAATACA  bur-0.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGATTTAGTAACAGAATACA  c24.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGATNNNNNNNNNNNNNNNN  col-0.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGATTTAGTAACAGAATACA  cvi-0.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGATTNNNNNNNNNNNNNNN  est-1.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGATTTAGTAACAGAATACA  fei-0.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGANNNNNCNGANNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGANNNNNNNNNNNNNNNNN  ler-1.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTNATNNNNNNNNNNNNNNNNNNN  lov-5.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGATTTNNNNNNNNAANACA  nfa-8.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNA  rrs-10.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGATNNNNNNNNNNNNNNNN  rrs-7.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGANNNNNNNNNNNNNNNNN  sha.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGNNNNNNNNNNNNNNNNNN  tamm-2.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGATTNNNNNNNNNNNNNNN  ts-1.fa
32422  AAAANNNNNNNCATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
32422  AAAACTTACCACATTGAAAATCRRTGGAGCTCCAGGTCCTAGATAGATTATCCAGACTTATGNNNNNNNNNNNNNNNNNN  van-0.fa
 
32502  AAAGTATGAAATCAAAAAGTAGCATGTTTAGAATGATTTATATACCAATCTCAAGATCATGCCATGGATGAGCAGCTACG  chr1.fa
32502  AAAGTATGAAATCAAAAAGTAGCATGTTTAGAATGATTTATATACCAATCTCAAGRTCATGCRRNGGATGAGCAGCTACG  bay-0.fa
32502  NNNNNNNNNNNTCAAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAAGRTCATGCRRTGGATGAGCAGCTACG  bor-4.fa
32502  NNNNNNNNNNNNCAAAAAGTAGCATGTTTNNNNNNNNNNNNNNNNNNNNNTCAAGRTCATGCRRNGGATGAGCAGCTACG  br-0.fa
32502  AAAGTATGAAATCAAAAAGTAGCATGTTTAGAATGATTTATATACCAATCTCAAGRTCATGCRRNGGATGAGCAGCTACG  bur-0.fa
32502  AAAGTATGAAATCAAAAAGTAGCATGTTTAGAATGATTTATATACCAATCTCAAGRTCATGCRRNGGATGAGCAGCTACG  c24.fa
32502  NNNNNNNNNNATCAAAAAGTAGCATGTTTAGNNNNNNNNNNNNNNCAATCTCAAGRTCATGCRRTGGATGAGCAGCTACG  col-0.fa
32502  AAANNNNNAAATCAAAAAGTAGCATGTTTAGAATGNNNNNTATACCAATCTCAAGRTCATGCRRNGGATGAGCAGCTACG  cvi-0.fa
32502  NNNNNNNNNNATCAAAAAGTAGNATGTTTNNNNNNNNNNNNNNNCCAATCTCAAGRTCATGCRRTGGATGAGCAGCTACG  est-1.fa
32502  AAAGNATGAAATCAAAAAGTAGCATGTTTAGAATGATTTATATACCAATCTCAAGRTCATGCRRNGGATGAGCAGCTACG  fei-0.fa
32502  NNNNNNNNNNNTCAAAAAGNANNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAAGRTCATGCRRTGGATGAGCAGCTACG  got-7.fa
32502  NNNNNNNNNAATCAAAAAGTAGCATGTTTAGANNNNNNNNNNNNNNNNTCTCAAGRTCATGCRRTGGATGAGCAGCTACG  ler-1.fa
32502  NNNNNNNNNNNNCAAAAAGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCAAGRTCATGCRRNGGATGAGCAGCTACG  lov-5.fa
32502  AANNNNNNNAATCAAAAAGTAGCATGTTTAGANNNNNNNATATACCAATCTCAAGRTCATGCRRNGGATGAGCAGCTACG  nfa-8.fa
32502  NNNNNNNNNNATCAAAAAGTAGCATGTNNNNNNNNNNNNNNNNNCCAATCTCAAGRTCATGCRRNGGATGAGCAGCTACG  rrs-10.fa
32502  NNNNNNNNNAATCAAAAAGTAGCATGTTTAGNNNNNNNNNNNNNNNAATCTCAAGRTCATGCRRTGGATGAGCAGCTACG  rrs-7.fa
32502  NNNNNNNGAAATCAAAAAGTAGCATGTTTNNNNNNNNNNNNNNNNNNNNNTCAAGRTCATGCRRNGGATGAGCAGCTACG  sha.fa
32502  NNNNNNNNNNATCAAAAAGTAGCATGNNNNNNNNNNNNNNNNNNNNNNNNNCNNGRTCNTGCRRNGGATGAGCAGCTACG  tamm-2.fa
32502  NNNNNNNNNNANCAAAAAGTAGCATGTTTAGAANNNNNNNTATACCAATCTCAAGRTCATGCRRTGGATGAGCAGCTACG  ts-1.fa
32502  NNNNNNNNNNNNNNNNAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAAGRTCATGCRRTGGATGAGCAGCTACG  tsu-1.fa
32502  NNNNNNNNNNNNCAAAAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAAGRTCATGCRRTGGATGNGCAGCTACG  van-0.fa
 
32582  GATCTTCTTGACAAGGATGAGAGAATCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTTTAGTTTC  chr1.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGNTGGTCGCTGCAGCCTCTGGTTATCTTTNGTTTC  bay-0.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTTTNGTTTC  bor-4.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTTTNGTTTC  br-0.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGNTGGTCGCTGCAGCCTCTGGTTATCTTTAGTTTC  bur-0.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTTTAGTTTC  c24.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTTTAGTTTC  col-0.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTTTAGTTTC  cvi-0.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTTNNNNNTC  est-1.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTTTAGTTTC  fei-0.fa
32582  GATCTTCTTGACAAGGATGAGRRAANCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCNNNNNNNNC  got-7.fa
32582  GATCTTCTTGACAAGGATGAGRRNNTCCTCTCGTTNAGACGAGGAGNTGGTCGCTGCAGCCTCTGGTTATCTTTAGTTTC  ler-1.fa
32582  GATCTTCTTGACAAGGATGAGRRNNNCCTCTCGTTNAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTTTAGNNTC  lov-5.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGNTGGTCGCTGCAGCCTCTGGTTATCTTTAGTTTC  nfa-8.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTTTAGTTTC  rrs-10.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTTTNGTTTC  rrs-7.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGNTGGTCGCTGCAGCCTCTGGTTATCTTTAGTTTC  sha.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTTTAGTTTC  tamm-2.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTTTNGTTTC  ts-1.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTNTNGTNNN  tsu-1.fa
32582  GATCTTCTTGACAAGGATGAGRRAATCCTCTCGTTAAGACGAGGAGCTGGTCGCTGCAGCCTCTGGTTATCTTTNGTTTC  van-0.fa
 
32662  TTCACTCAT   chr1.fa
32662  TTCACTCAT   bay-0.fa
32662  TTCACTCAT   bor-4.fa
32662  TTCACTCAT   br-0.fa
32662  TTCACTCAT   bur-0.fa
32662  TTCACTCAT   c24.fa
32662  TTCACTCAT   col-0.fa
32662  TTCACTCAT   cvi-0.fa
32662  TTCNCTCAT   est-1.fa
32662  TTCACTCAT   fei-0.fa
32662  TTCNCNNAN   got-7.fa
32662  TTCACTCAT   ler-1.fa
32662  TTCNCTCAT   lov-5.fa
32662  TTCACTCAT   nfa-8.fa
32662  TTCACTCAT   rrs-10.fa
32662  TTCACTCAT   rrs-7.fa
32662  TTCACTCAT   sha.fa
32662  TTCACTCAT   tamm-2.fa
32662  TTCACTCAT   ts-1.fa
32662  NNNNNNNAN   tsu-1.fa
32662  TTCACTCAT   van-0.fa
 
visited.