Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 33992 - 37061


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
33992  TCATGTAGAAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCATCACTTTGATTGTTTATGTTCCCAACTTGGC  chr1.fa
33992  TCATGTAGAAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCATCNCTTTGATTGTTTATGTTCCCAACTTGGC  bay-0.fa
33992  TCATGTAGAAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCANNNNNNNNNNNNNNNNNNTTCCCAACTTGGC  bor-4.fa
33992  TCATGTAGAAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCNNNNNNNNNNNTGTTTNTGTTCCCAACTTGGC  br-0.fa
33992  TCATGTAGAAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCANCACTTTGATTGTTTATGTTCCCAACTTGGC  bur-0.fa
33992  TCATGTAGAAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCATCACTTTGATTGTTTATGTTCCCAACTTGGC  c24.fa
33992  TCATGTAGAAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCATCACTTTGNTTGTTTNTGTTCCCAACTTGGC  col-0.fa
33992  TCATGTAGAAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCATCACTTTGATTGTTTATGTTCCCAACTTGGC  cvi-0.fa
33992  TCATGTAGAAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCATCNNNNNNNNNGTTTNTGTTCCCAACTTGGC  est-1.fa
33992  TCATGTAGAAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCATCACTTTGATTGTTTATGTTCCCAACTTGGC  fei-0.fa
33992  TCATGTAGNAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCNNNNNNNNNNNNNNNNNTGTTCCCAACTTGGC  got-7.fa
33992  TCANNNNNNNNNNNNTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCATNNNNNNNNNNNTTTATGTTCCCAACTTGGC  ler-1.fa
33992  TCATGTNNNNNNNNNTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTNNNNNNNNNNNNNNNTTATGTTCCCAACTTGGC  lov-5.fa
33992  TCATGTAGAAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCATCACTTTGATTGTTTATGTTCCCAACTTGGC  nfa-8.fa
33992  TCATGTAGAAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCATNNNNNNNNNNNNNNNNNTTCCCAACTTGGC  rrs-10.fa
33992  TCATGTAGNAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCANNNNNNNNNNNGTTTATGTTCCCAACTTGGC  rrs-7.fa
33992  TCATGTAGNAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCATCACTTTGATTGTTTATGTTCCCAACTTGGC  sha.fa
33992  TCATGNNNNNNNNNCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCANNNNNNNNNNNNNNNNNNTTCCCAACTTGGC  tamm-2.fa
33992  TCATGTAGANGNNTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCATCNCTTTGATTGTTTNTGTTCCCAACTTGGC  ts-1.fa
33992  TCATNNNNNNNNNNNNCCTTCCAATCGAAGCCTTTTGCNGACTTTTTNNNNNNNNNNNNNNNNNNNNTTCCCAACTTGGC  tsu-1.fa
33992  TCATGTAGAAGCTTCTCCTTCCAATCGAAGCCTTTTGCAGACTTTTTCATCACNNNNNNNNNNNATGTTCCCAACTTGGC  van-0.fa
 
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  chr1.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  bay-0.fa
34072  TNTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGNCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  bor-4.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  br-0.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  bur-0.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  c24.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  col-0.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  cvi-0.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  est-1.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  fei-0.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGNCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  got-7.fa
34072  TCTCTTTCACTTCCATTGAACNTCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  ler-1.fa
34072  TCNCTTTCACTTCCATNGANCANCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  lov-5.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  nfa-8.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  rrs-10.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  rrs-7.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTNNNNNNNNNANNNNNNNNCTCTTGCATGTTCCAACA  sha.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCNNNNNNNNNNANNNNNNNNNNNTTGCATGTTCCAACA  tamm-2.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  ts-1.fa
34072  TCTNNNNNNNNNNNANNNNNCNNCTCNNNNNNNGCTTAAATCCTGTCTGNCTCGTTTTAAGACTCTTGCATGTTCCAACA  tsu-1.fa
34072  TCTCTTTCACTTCCATTGAACATCTCTTGTATGGCTTAAATCCTGTCTGTCTCGTTTTAAGACTCTTGCATGTTCCAACA  van-0.fa
 
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  chr1.fa
34152  CCGATCATTACNACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  bay-0.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  bor-4.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  br-0.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  bur-0.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  c24.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  col-0.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  cvi-0.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  est-1.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  fei-0.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  got-7.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  ler-1.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  lov-5.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  nfa-8.fa
34152  CCGATCATTACTACTNCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  rrs-10.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  rrs-7.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  sha.fa
34152  CCGATCATTACTNCTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  tamm-2.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  ts-1.fa
34152  CCGATCATTACNNNNNCTTCTTGGTCNGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  tsu-1.fa
34152  CCGATCATTACTACTCCTTCTTGGTCTGCAGCACAAGAATCCTGGCTTTTGAAATTAGGAGCCAATGGCATTGACGTGTC  van-0.fa
 
34232  ACTTTGTTTTCTATTCACATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  chr1.fa
34232  ACTTTGTTTTCTATTCACATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  bay-0.fa
34232  ACTTTGTNNNNNNNNNNNATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  bor-4.fa
34232  ACTTTGTTTTCTNTTCACATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  br-0.fa
34232  ACTTTGTTTTCTATTCACATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  bur-0.fa
34232  ACTTTGTTTTCTATTCACATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  c24.fa
34232  ACTTTGTTTNNNNNNNACATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTNGCAAAGAGAGCCT  col-0.fa
34232  ACTTTGTTTTCTNTTCACATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  cvi-0.fa
34232  ACTTTGTTNNNNNNNNNCATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  est-1.fa
34232  ACTTTGTTTTCTATTCACATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  fei-0.fa
34232  ACNNNNNNNNNNNNNNNNATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  got-7.fa
34232  ACTTTNTNNNNNNNNNACATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTNNNNNNGCAANGAGAGCCT  ler-1.fa
34232  NCTTTGTNNNNNNNNNNCATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTNNNNNNNNNNNAGAGAGCCT  lov-5.fa
34232  ACTTTGTTTTCTNTTCACATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  nfa-8.fa
34232  ACTTTGTTNNNNNNTCACATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  rrs-10.fa
34232  ACTTTGTTTNNNNNTCACATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  rrs-7.fa
34232  ACTTTGTTTTCTNTTCACATTCTCTGCCACTTGAGGNGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  sha.fa
34232  ACTTTGTTNNNNNNNNNCATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGNCAATCTTTCTCTTNNNNNGAGAGCCT  tamm-2.fa
34232  NCTTTGTTTNNNNNNNACATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  ts-1.fa
34232  ACTTTNNNNNNNNNNNNNATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGNCAATCTTNNNNNNNNNNNNAGAGCCT  tsu-1.fa
34232  ACTTTGTTTNNNNNNNNNATTCTCTGCCACTTGAGGAGGCGAAAAGCTTTGAGGCAATCTTTCTCTTGCAAAGAGAGCCT  van-0.fa
 
34312  GAAACGCTATACGACCCTGAAAATATTTTGATAGTGTTAGTTCCCAGAAGAACTCTGCAATATCCATGAATCATTGGTTT  chr1.fa
34312  GAAACGCTATACGACCCTGAAAATNTTTTGATAGTGTTAGTTCCCAGAAGAACTCTGCAATATCCATGAATCATTGGTTT  bay-0.fa
34312  GAAACGCTATACGACCCTGAAANNNNNNNNNNAGNGTNAGTTCCCAGAAGAACTCTGCAATATCCATGAATCNNNNNNNN  bor-4.fa
34312  GAAACGCTATACGACCCTGAAAATANNNNNNNNNTGTTAGTTCCCAGAAGAACTCTGCAATATCCATGAATCATTNGTTT  br-0.fa
34312  GAAACGCTATACGACCCTGAAAATATTTTGATAGTGTTAGTTCCCAGAAGAACTCTGCAATATCCATGAATCATTGGTTT  bur-0.fa
34312  GAAACGCTATACGACCCTGAAAATATTTTGATAGTGTTAGTTCCCAGAAGAACTCTGCAATATCCATGAATCATTGGTTT  c24.fa
34312  GAAACGCTATACGACCCTGAAANNNNNNNNNNNNTGTTAGTTCCCAGAAGAACTCTGCAATATCCATGAATCATTGGTTT  col-0.fa
34312  GAAACGCTATACGACCCTGAAAATATTTTGATAGTGTTAGTTCCCAGAAGAACTCTGCAATATCCATGAATCATTGGTTT  cvi-0.fa
34312  GAAACGCTATACGACCCTGAAAANNNNNNNNNNNTGTTAGTTCCCAGAAGAACTCTGCNNNNNNCATGAATCNNNGGTTT  est-1.fa
34312  GAAACGCTATACGACCCTGAAAATATTTTGATAGTGTTAGTTCCCAGAAGAACTCTGCAATATCCATGAATCATTGGTTT  fei-0.fa
34312  GAAACGCTATACGACCCTNNNNNNNNNNNNNNNNNNNNNGNTCCCAGAAGAACTCTGCAATATCCATGANNNNNNNNNNN  got-7.fa
34312  GAAACGCTATACGACCCTGAAAANNNNNNNNNNGTGTTAGNTCCCAGAAGAACTCTGCAATATCCATGANTCNTTNGTTT  ler-1.fa
34312  GAAACGCTATACGACCCTGAANNNNNNNNNNNNNTGTTAGNTCCCAGAAGAACTCTGCAATANNNNNNNNNNNNNNNNNN  lov-5.fa
34312  GAAACGCTATACGACCCTGAAAATATTTTGATNGTGTTAGTTCCCAGAAGAACTCTGCAATATCCATGAATCATTGGTTT  nfa-8.fa
34312  GAAACGCTATACGACCCTGAANNNNNNNNNNNNNNNNNNNNNCCCAGAAGAACTCTGCAATATCCATNNNNNNNTGGTTT  rrs-10.fa
34312  GAAACGCTATACGACCCTGAAAANNNNNNNNNNNTGTTAGTTCCCAGAAGAACTCTGCAATATCCATGAATCNNNNNTTT  rrs-7.fa
34312  GAAACGCTATACGACCCTGAANNNNNNNNNNNNNNNNNNNNNNNCAGAAGAACTCTGCAATATCCATGAATCATTGGTTT  sha.fa
34312  GAAACGCTATACGACCCTGANNNNNNNNNNNNNNNNNNNNNNNNNAGAAGAACTCTGCAATATCCATGANNNNNNNGNTN  tamm-2.fa
34312  GAAACGCTATACGACCCTGAAAANNNNNNNNNNNNGTTAGTTCCCAGAAGAACTCTGCAATATCCATGAATCNNNNNNTN  ts-1.fa
34312  GAAACGCTATACGACCCTNNNNNNNNNNNNNNNNNNNNNNNNNCCAGAAGAACTCTGCAATATNNNNNNNNNNNNNNNNN  tsu-1.fa
34312  GAAACGCTATACGACCCTGAAAATANNNNNNNNNTGTTAGTTCCCAGAAGAACTCTGCAATATCCATGANNNNTTGGTTT  van-0.fa
 
34392  TTGTTTTACCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCATTGTTGTTGCTGTTGTTGTCTCTCATTTTAATCT  chr1.fa
34392  TTGTTTTACCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCNTTGTTNNNRRRRRRNNNGNCTCTCATTTTAATCT  bay-0.fa
34392  NNNNNNTNCCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCATTGTNGNNRRRRRRNTTGTCTNNNNNNNNNNNNN  bor-4.fa
34392  TTNTNNTNCCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCNTTGTTNNNRRRRRRNNNNNNNNNNNNNNTAATNN  br-0.fa
34392  TTGTTTTNCCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCNTTGTTNNNRRRRRRNTTGNCTCTCATTTTAATCT  bur-0.fa
34392  TTGTTTTACCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCATTGTTGNNRRRRRRNNNGTCTCTCATTTTAATCT  c24.fa
34392  TNGTTTTNCCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCATTGTTGNNRRRRRRNNNNNNNNNCATTNNNNNNN  col-0.fa
34392  TTGTTTTACCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCATTGTTGNNRRRRRRGNNGTCTCTCATTTTAATCT  cvi-0.fa
34392  TTGTTTTACCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCATTGTTNNNRRRRRRNNTGTCTCTCNNNNNNNNNN  est-1.fa
34392  TTGTTTTACCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCATTGTTGNNRRRRRRNNNGTCTCTCATTTTAATCT  fei-0.fa
34392  NTNTNNTNCCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCATTGTTNNNRRRRRRGTTGTCTCTCNNNNNNNNNN  got-7.fa
34392  TTGTTTTNCCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCATTGTNNNNRRRRRRNNNGTCTCTCATTTTNNNNN  ler-1.fa
34392  NNNNNNNNNNNNNTCGGAGACTTCCTTCCACGAATCAGTAGTNNNNNNNNNNNNRRRRRRNNNGTCTNNNNNNNNNNNNN  lov-5.fa
34392  TTGTTTTNCCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCNTTGTTNNNRRRRRRNTTGTCTCTCATTTTAATCT  nfa-8.fa
34392  TTGTTTTACCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCATTGTTNNNRRRRRRGNTGTCTCTCNNNNNNNNNN  rrs-10.fa
34392  TTGTTTTACCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCATTGTTGNNRRRRRRNNNGTCTCTCATTTTAATNN  rrs-7.fa
34392  TTGTTTTNCCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCNNNNNNNNNRRRRRRNNNGNCTCTCATTTTAATCT  sha.fa
34392  NTNTTTTACCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCATTGTNNNNRRRRRRNNNGNCTNTCNTNNNNNNNN  tamm-2.fa
34392  NNGTNTTNCCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCNTNNNNNNNRRRRRRNNNNNNTCTCATTNNNNNNN  ts-1.fa
34392  NNNNNNNNNNTCTTCGGAGACTTCCTTCCACGAATCAGTAGTNNNNNNNNNNNNRRRRRRNNNGNNNNNNNNNNNNNNNN  tsu-1.fa
34392  TTGTTTTACCTCTTCGGAGACTTCCTTCCACGAATCAGTAGTTGCATTGTTGNNRRRRRRNTTGTCTCTCATTNNNNNNN  van-0.fa
 
34472  TACGGTTATTTAACTCAATAACATCTGGCTGATTCTCATCTGTCTCCTTCACATCCTCTTTATCTTTCTCCATTTTATCT  chr1.fa
34472  TACGGTTATTTAACTCAATAACATCTGGCTGATTCTCATCTGTCTCCTTCACATCCTCTTTNTCNTTNTCCATTTTATCT  bay-0.fa
34472  NNNNNNNNNNNNNNNNNNNAACATCTGGCTGATTCTCATCTGTCTCCTTCACATCNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
34472  NNNNNTTANNNNNNNCAATAACATCTGGCTGATTCTCATCTGTCTCCTTCACATCCTCNNNNNNNNNNNNNNNNNNNNNT  br-0.fa
34472  TACGGTTATTTAACTCAATAACATCTGGCTGATTCTCATCTGTCTCCTTCACATCCTCTTTNNNNTTCTCCNTTTTATCT  bur-0.fa
34472  TACGGTTATTTAACTCAATAACATCTGGCTGATTCTCATCTGTCTCCTTCACATCCTCTTTNTCNTTNTCCATTTTATCT  c24.fa
34472  NNNNNNNNNNNNNNNNNATAACATCTGGCTGATTCTCATCTGTCTCCTTCACANNNNNNNNNNNNNNNNNNNNNNNNNCN  col-0.fa
34472  TACGGTTATTTAACTCAATAACATCTGGCTGATTCTCATCTGTCTCCTTCACATCCTCTNNNNNNNNNNNNNNTTTATCT  cvi-0.fa
34472  NNNNNNNNNNNNNNNNNATAACATCTGGCTGATTCTCATCTGTCTCCTTCACATNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
34472  TANGGTTATTTAACTCAATAACATCTGGCTGATTCTCATCTGTCTCCTTCACATCCTCTTTNTCNTTNNNNNTTTTATCT  fei-0.fa
34472  NNNNNNNNNNNNNNNNNNNNNCATCTGGCTGATTCTCATCTGTNTCCTTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
34472  NNNNNNNNNNNNNNNNNNNAACATCTGGCTGATTCTCATCTNNNNNNNNNACATNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
34472  NNNNNNNNNNNNNNNNNNNNACATCTGGCTGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
34472  TANGGTTATTTNACTCAATAACATCTGGCTGATTCTCATCTGTCTCCTTCACATCCTCTNNNNNNNNNNNNNNNNTATCT  nfa-8.fa
34472  NNNNNNNNNNNNNNNNNNNAACATCTGGCTGATTCTCATCTGTCTCCTTCACATCCTCNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
34472  NNNNNNNNNNNNNNNNNNNNACATCTGGCTGATTCTCATCTGTCTCCNTCACATNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
34472  TACGGTTATTTANNTCAATAACATCTGGCTGATTCTCATCTGTCTCCTTCACATCNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
34472  NNNNNNNNNNNNNNNNNNNAACATCTGGCTGATTCTCATCTGTCTNNNTCACATCNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
34472  NNNNNNNNNNNNNNNNNNTAACATCTGGCTGATTCTCATCNNNNNNCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
34472  NNNNNNNNNNNNNNNNNNNNNNNTCTGGCTGATTCTCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
34472  NNNNNNNNNNNNNNNNAATAACATCTGGCTGATTCTCATCTGTCTCCTTCACATCCTNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
34552  AATGCATCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTGGGC  chr1.fa
34552  AATGCATCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTNGGC  bay-0.fa
34552  NNNGNATCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCNNNCNNTGAGCGGTCCACAAGATTTTTCTTCTGGGC  bor-4.fa
34552  AATGCATCAGTTTCTGCGNCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTGGGC  br-0.fa
34552  AATGCATCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTGGGC  bur-0.fa
34552  AATGCATCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTGGGC  c24.fa
34552  NNNNNNTCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTGGGC  col-0.fa
34552  AATGCATCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTGGGC  cvi-0.fa
34552  NNNNCATCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTGGGC  est-1.fa
34552  AATGCATCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTGGGC  fei-0.fa
34552  NNNNNNNCAGTTTCTGCGTCACTCCCTGANGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGNTTTTTCTTCTGGGC  got-7.fa
34552  NNNNNNTCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTGGGC  ler-1.fa
34552  NNNNNNTCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTGGGC  lov-5.fa
34552  AATGCATCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTGGGC  nfa-8.fa
34552  NNNNNNTCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTGGGC  rrs-10.fa
34552  NNNNNNTCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCNNNCNNTGAGCGGTCCACAAGATTTTTCTTCTGGGC  rrs-7.fa
34552  NATGCATCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCNNNCNNTGAGCGGTCCACAAGATTTTTCTTCTGGGC  sha.fa
34552  NNNNNNTCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCNNNCNNTGAGCGGTCCACAAGATTTTTCTTNTGGGC  tamm-2.fa
34552  AATGCATCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTGGGC  ts-1.fa
34552  NNNNNATCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTNTGGGC  tsu-1.fa
34552  NNNNNATCAGTTTCTGCGTCACTCCCTGAAGGTGTATTTGAGCCACAGGATGAGCGGTCCACAAGATTTTTCTTCTGGGC  van-0.fa
 
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCTCCTCAATTTTATCATCATTGGTTTTTGAGTCGGCATTTAGCT  chr1.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCTCCTCAATTTTATCATCATTNGTTTTTGAGTCGGCATTTAGCT  bay-0.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAANNNNNNNNNNNNNNNNNNNNNNNTTGGTTTTTGAGTCGGCATTTAGCT  bor-4.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCNCCTCAATNNNNNNATCNTTGGTTTTTGAGTCGGCATTTAGCT  br-0.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGNAACAACAACCTCCTCAATTTTATCATCATTGGTTTTTGAGTCGGCATTTAGCT  bur-0.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCTCCTCAATTTTATCATCATTGGTTTTTGAGTCGGCATTTAGCT  c24.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCTCCTCAATNNNNNNATCATTGGTTTTTGAGTCGGCATTTAGCT  col-0.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCTCCTCAATTTTATCATCATTGGTTTTTGAGTCGGCATTTAGCT  cvi-0.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCTCCTCAATNNNNNNNNNANTGGTTTTTGAGTCGGCATTTAGCT  est-1.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCTCCTCAATTTTATCATCATTGGTTTTTGAGTCGGCATTTAGCT  fei-0.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCNNNNNNNNNNNNNNNNNNNNNNTTTTTGAGTCGGCATTTAGCT  got-7.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCNCNNCNNNNNNNNNNNNNNNGGTTTTTGAGTCGGCATTTAGCT  ler-1.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCNCCTCAATNNNNNNNNNNNNNNTTTTTGAGTCGGCATTTAGCT  lov-5.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCTCCTCAATTTNATCATCATTGGTTTTTGAGTCGGCATTTAGCT  nfa-8.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCNNNNNNNNNNNNNNNNNNNTGGTTTTTGAGTCGGCATTTAGCT  rrs-10.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACANNNNNNNNNNNNNNNNNNNNNNNNGTTTTTGAGTCGGCATTTAGCT  rrs-7.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCTCCTCAATTTTATCATCATTGGTTTTTGAGNCGGCATTTAGCT  sha.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAANAACNNNCNNNNNNNNNNNNNNNNNNGTTTTTGAGTCGGCATTTAGCT  tamm-2.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCTCCTCANNNNNNNNNNNNNNNGTTTTTGAGTCGGCATTTAGCT  ts-1.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCTCCTCNNNNNNNNNNNNNNNNNTTTTTGAGTCGGCATTTAGCT  tsu-1.fa
34632  AGTGTTTGAGTCATGCACAGCGGCAGTAACAACAACCTCCTCAANNNNNNNNNNNNNNGTTTTTGAGTCGGCATTTAGCT  van-0.fa
 
34712  TGGTTACTCCAGTCTCATCTGAATCATCAGATGATGAAGCTGGAGATTTCGAAGCCAAGTTTTGATCTTGCAGAGCTGTG  chr1.fa
34712  TGGTTACTCCAGTCTCATCTGNNNNNNNNNATGATGAAGCTGGAGATTTCGAAGCCAAGTTRTGATNTTGCAGAGCTGTG  bay-0.fa
34712  TGGTTACTCCAGTCTCATCTGNNNNNNNNNNNNNNNNAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCAGAGCTGTG  bor-4.fa
34712  TGGTTACTCCAGTCTCATCTGNNNNNNNNNNTGATGAAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCAGAGCTGTG  br-0.fa
34712  TGGTTACTCCAGTCTCATCTGNNNNNNNNNNNGATGAAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCAGAGCTGTG  bur-0.fa
34712  TGGTTACTCCAGTCTCATCTGNNNNNNNNNNNGATGAAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCAGAGCTGTG  c24.fa
34712  TGGTTACTCCAGTCTCATCTNNNNNNNNNNNNNNNGAAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCAGAGCTGTG  col-0.fa
34712  TGGTTACTCCAGTCTCATCTGNNNNNNNNNNNGATGAAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCAGAGCTGTG  cvi-0.fa
34712  TGGTTACTCCAGTCTCATCTNNNNNNNNNNATGANGAAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCAGAGCTGTG  est-1.fa
34712  TGGTTACTCCAGTCTCATCTGNNNNNNNNNATGATGAAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCAGAGCTGTG  fei-0.fa
34712  TGGTTACTCCAGTCTCATCTNNNNNNNNNNNNNNTGAAGCTGGAGATTTCGAAGCCAAGTTRTNATCTTGCAGAGCTGTG  got-7.fa
34712  TGGTTACTCCAGTCTCATCNNNNNNNNNNNNNNNNNNAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCAGAGCTGTG  ler-1.fa
34712  TGGTTACTCCAGTCTCATNNNNNNNNNNNNNNNNNNAAGCTGGAGATTTCGAAGCCAAGTTRTGNTCTTGCAGAGCTGTG  lov-5.fa
34712  TGGTTACTCCAGTCTCATCTGNNNNNNNNNNNGATGAAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCAGAGCTGTG  nfa-8.fa
34712  TGGTTACTCCAGTCTCATCTNNNNNNNNNNNNNNNGAAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCAGAGCTGTG  rrs-10.fa
34712  TGGTTACTCCAGTCTCATCNNNNNNNNNNNNNNNNGAAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCNGAGCTGTG  rrs-7.fa
34712  TGGTTACTCCAGTCTCATCTNNNNNNNNNNNNNNNGAAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCAGAGCTGTG  sha.fa
34712  TGGNTACTCCAGTCTCATCTGNNNNNNNNNNNNNNNNAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCNGAGCTGTG  tamm-2.fa
34712  TGGTTACTCCAGTCTCATCNNNNNNNNNNNNNNNNGAAGCTGGAGATTTCGAAGCCAAGNTRTGATCTTGCAGAGCTGTG  ts-1.fa
34712  TGGTTACTCCAGTCTCATCNNNNNNNNNNNNNNNNNNAGCTGGAGATTTCGAAGCCAAGNTRTGATCTNNNNGAGCTGTG  tsu-1.fa
34712  TGGTTACTCCAGTCTCATCNNNNNNNNNNNNTGNTGAAGCTGGAGATTTCGAAGCCAAGTTRTGATCTTGCAGAGCTGTG  van-0.fa
 
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  chr1.fa
34792  TTTTGTTTCTCNAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  bay-0.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  bor-4.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  br-0.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACNGCAACAGTTGAGAA  bur-0.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  c24.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  col-0.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTNCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  cvi-0.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  est-1.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  fei-0.fa
34792  TTTTGTTTCTCAAACGGTNGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  got-7.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  ler-1.fa
34792  TTTTGTTTCTCAAACGGNTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  lov-5.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  nfa-8.fa
34792  TTTTGTTTCTCANACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  rrs-10.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  rrs-7.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  sha.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  tamm-2.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCANTGCTGGAGTTGGAACTGCAACAGTTGAGAA  ts-1.fa
34792  TTTTGTTTCTCNNNNNGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  tsu-1.fa
34792  TTTTGTTTCTCAAACGGTTGAGTATTTTCAACGGTATCCATTTCAGTCATTGCTGGAGTTGGAACTGCAACAGTTGAGAA  van-0.fa
 
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGCTACTG  chr1.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGCTACTG  bay-0.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGCTACTG  bor-4.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGCTACTG  br-0.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGCTACTG  bur-0.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGCTACTG  c24.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGCTANTG  col-0.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCANTTGCAGCAGCTANTG  cvi-0.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGCTACTG  est-1.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGNNNNNG  fei-0.fa
34872  TGGAACNCATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGCTANTG  got-7.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCNNNNNNNN  ler-1.fa
34872  TGGAACNCATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCANNNNNNNNNN  lov-5.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGNNNNNG  nfa-8.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGCTANTG  rrs-10.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGCTACTG  rrs-7.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCNNNNNNNN  sha.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGNNNNNG  tamm-2.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGCTACTG  ts-1.fa
34872  TGGNNNNNNNGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCNNNNNNNNNNN  tsu-1.fa
34872  TGGAACACATGTTATTGGAGCTGGAGCGCATACAGGAAGAAGTCCATGAGAAGCCCACCAAGCAGTTGCAGCAGCTANTG  van-0.fa
 
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGCTCATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  chr1.fa
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGCTCATTGGGNTTGATGAATCACCAGAATTCCCGACACTCGCA  bay-0.fa
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGCTCATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  bor-4.fa
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGCTCATTGGGGTTGATGAATCACCANAATTCCCGACACTCGCA  br-0.fa
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGCTCATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  bur-0.fa
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGCTCATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  c24.fa
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGCTCATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  col-0.fa
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGCTCATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  cvi-0.fa
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGCTCATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  est-1.fa
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGCTCATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  fei-0.fa
34952  TAGCAGCGGCAATGGCAGTTATNNNNNNAGGAGAAGAGCNCATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  got-7.fa
34952  NAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGNNNNNNTTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  ler-1.fa
34952  NNGCAGCGGCAATGGCAGTTATACTTGGNGGAGAAGNNNNNATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  lov-5.fa
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGCTCATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  nfa-8.fa
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGCTCATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  rrs-10.fa
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGNTCATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  rrs-7.fa
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGCTCATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  sha.fa
34952  TAGCAGCGGCAATGGCAGTTATACTNNNNGGAGAAGANNNNNNTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  tamm-2.fa
34952  NAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGNNNNNNTTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  ts-1.fa
34952  NAGCAGCGGCAATGGCAGTTNNNNNNNNNNNNGAAGANNNNNNTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  tsu-1.fa
34952  TAGCAGCGGCAATGGCAGTTATACTTGGAGGAGAAGAGCTCATTGGGGTTGATGAATCACCAGAATTCCCGACACTCGCA  van-0.fa
 
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCTGCAGCATGAGCTGCAGGATTCTGTAGGAGAGTTGACATAATAAGATTGGA  chr1.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGNNNNNNNNNNNNCTGCAGGATTCTGTAGGAGAGTTGACATAATAAGATTGGA  bay-0.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCTNNNNNNNNNNCTGCAGGATTCTGTAGGAGAGTTGNCATAATNANNNNNNN  bor-4.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCNGCNGCNTGAGCTGCAGGATTCTGTAGGAGAGTTGNCATAATAAGATTGGA  br-0.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCNNNNNNNNNNNCTGCAGGATTCTGTAGGAGAGTTGACATAATAAGATTGGA  bur-0.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCTNNNNNNNNNGCTGCAGGATTCTGTAGGAGAGTTGACATAATAAGATTGGA  c24.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCTNNNNNNNNNNCTGCAGGATTCTGTAGGAGAGTTGACATAATAAGATTGGA  col-0.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCNNNNNNNNNNNCTGCAGGATTCTGTAGGAGAGTTGACATAATAAGATTGGA  cvi-0.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCTGCANNNNNAGCTGCAGGATTCTGTAGGAGAGTTGNCATAATAAGATNGGA  est-1.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCNNNNNNNNNNNCTGCAGGATTCTGTAGGAGAGTTGACATAATAAGATTGGA  fei-0.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCTGCAGNNNNNNNTGCAGGATTCTGTAGGANNNNNNNNNNNNNNNNNNNNNA  got-7.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGNNNNNNNNNNNNNNNNNNCAGGATTCTGTAGGAGAGTTGANATAATAANATTGGA  ler-1.fa
35032  TAAGGCCAGACCGAAGCAGCGANNNNNNNNNNNNNNNNNNNNNCAGGATTCTGTAGGAGAGTNGNNANNNNNNNNNNNNN  lov-5.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCNNNNNNNNNNNCTGCAGGATTCTGTAGGAGAGTTGACATAATAAGATTGGA  nfa-8.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCNGCNNNNNNNGCTGCAGGATTCTGTAGGAGAGTTNACNNNNNNNNNNNNGA  rrs-10.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCNGNNNNNNNNNCTGCAGGATTCTGTAGGAGAGTTGACATAATNNNNNNGGA  rrs-7.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGNNNNNNNNNNNNNNGCTGCAGGATTCTGTAGGAGAGTTGACATAATAAGATTGGA  sha.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCNNNNNNNNNNNNNNCAGGATTCTGTAGGAGAGTTGACATAATAAGATTGGA  tamm-2.fa
35032  TAAGGCCAGNCCGAANCAGCGAATGTAGCNNNNNNNNNNNNTGCAGGATTCTGTAGGAGAGTTGACATAATAAGATTGGA  ts-1.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTNNNNNNNNNNNNNNNNNNAGGATTCTGTAGGAGANNNNNNNNNNNNNNNNNNNN  tsu-1.fa
35032  TAAGGCCAGACCGAAGCAGCGAATGTAGCTGCNNNNNNNGCTGCAGGATTCTGTAGGAGAGTTGACATAATAAGNTNGGA  van-0.fa
 
35112  GAAAGTAGATGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  chr1.fa
35112  GAAAGTAGATGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  bay-0.fa
35112  NNNNNNNNNNNNNNNNTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  bor-4.fa
35112  GAAAGTAGATGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  br-0.fa
35112  GAAAGTAGNTGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  bur-0.fa
35112  GAAAGTAGATGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  c24.fa
35112  GAAAGTNGATGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  col-0.fa
35112  GAAAGTAGATGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  cvi-0.fa
35112  GAAAGTAGATGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  est-1.fa
35112  GAAAGTAGATGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  fei-0.fa
35112  GANNNNNNNNNNNATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  got-7.fa
35112  GAAAGTNGATGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  ler-1.fa
35112  NNNNNNNNNNNNTATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  lov-5.fa
35112  GAAAGTAGATGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  nfa-8.fa
35112  GANNNNNNNNNNNNNNTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  rrs-10.fa
35112  GAAAGTAGATGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  rrs-7.fa
35112  GAAAGTAGATGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  sha.fa
35112  GAAAGTNGANNNNNNNNGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  tamm-2.fa
35112  GANNNNNNNTGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  ts-1.fa
35112  NNNNNNNNNNNNNNNNNNGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  tsu-1.fa
35112  GAAAGTAGATGATATCTGGAGAAACGAACGGTAATCATCCTGTGAATGACAAGCTGGAAACGCTTGATGAGAAGCTGTAG  van-0.fa
 
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTCTCATAGGATGAAACATGAAGTCTTGA  chr1.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTCTCATAGGATGAAACATGAAGTCTTGA  bay-0.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTNNNNNNNNGGATGAAACATGAAGTCTTGA  bor-4.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTCTCATAGGATGAAACATGAAGTCTTGA  br-0.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTCTCATAGGATGAAACATGAAGTCTTGA  bur-0.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTCTCATAGGATGAAACATGAAGTCTTGA  c24.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTCTCATAGGATGAAACATGAAGTCTTGA  col-0.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTCTCATAGGATGAAACATGAAGTCTTGA  cvi-0.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTCTCATAGGATGAAACATGAAGTCTTGA  est-1.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGNCCGTGAGTTTCTTCTCTCATAGGATGAAACATGAAGTCTTGA  fei-0.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTNNNNNNNNNNNNAACATGAAGTCTTGA  got-7.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTCTCATNNGATGAAACATGAAGTCTTGA  ler-1.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTNNNNNNNNNNNNNNAACATGAAGTCTTGA  lov-5.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTCTCATAGGATGAAACATGAAGTCTTGA  nfa-8.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTNNNNNNNNNGATGAAACATGAAGTCTTGA  rrs-10.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTCTCANAGGATGAAACATGAAGTCTTGA  rrs-7.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTCTCATNGGATGAAACATGAAGTCTTGA  sha.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTNNNNNNNNNNGNTGAAACATGAAGTCTTGA  tamm-2.fa
35192  TAGTAGCAGATGCTGTTGTNGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTCTNNNNNGATGAAACATGAAGTCTTGA  ts-1.fa
35192  TAGTAGCAGATGCTGTTGTNGCTTGAAGATTTGCGTGCCCGTGAGTTTCNNNNNNNNNNNNNNNAAACATGAAGTCTTGA  tsu-1.fa
35192  TAGTAGCAGATGCTGTTGTAGCTTGAAGATTTGCGTGCCCGTGAGTTTCTTCTCTCATAGGATGAAACATGAAGTCTTGA  van-0.fa
 
35272  GATACCATACCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  chr1.fa
35272  GATACCATACCTGAGNGATGATTTTGANGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  bay-0.fa
35272  GATACCATACCTGAGGGATGATTTTGNGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  bor-4.fa
35272  GATACCATACCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  br-0.fa
35272  GATACCATACCTGAGNGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  bur-0.fa
35272  GATACCATACCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  c24.fa
35272  GATACCATACCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  col-0.fa
35272  GATACCATACCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  cvi-0.fa
35272  GATACCATANCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  est-1.fa
35272  GATACCATACCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  fei-0.fa
35272  GATACCATACCTGAGGGATGATTTTGAGNGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  got-7.fa
35272  GATACCATACCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  ler-1.fa
35272  GATACCATNCCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  lov-5.fa
35272  GATACCATACCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  nfa-8.fa
35272  GATACCATACCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  rrs-10.fa
35272  GATACCATACCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  rrs-7.fa
35272  GATACCATACCTGAGGGATGATTTTGNGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  sha.fa
35272  GATACCATACCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  tamm-2.fa
35272  GATACCATACCTGAGGGANGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  ts-1.fa
35272  GATACCATACCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  tsu-1.fa
35272  GATACCATACCTGAGGGATGATTTTGAGGGCATTTTGCTATATTCCCGTTCACAATATCTGCGTGGAAATGCCAAGGGTA  van-0.fa
 
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTTTGTCTTTGTTCTTCTTGGGAACATCTTGAACCGCGTTGT  chr1.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTNNNNNNNTGTTCTTCTTGGGAACATCTTGAACCGCGTTGT  bay-0.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTTNNNNNNNNNNNTTCTTGGGAACATCTTGAACCGCGTTGT  bor-4.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTTTGTNNNNNNNNTTCTTGGGAACATCTTGAACCGCGTTGT  br-0.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCANCTTTGTCTTTGTTCTTCTTGGGAACATCTTGAACCGCGTTGT  bur-0.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTTTGTCTTTGTTCTTCTTGGGAACATCTTGAACCGCGTTGT  c24.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTNNNNNNNNNNNNTTNTTNGGAACATCTTGAACCGCGTTGT  col-0.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTTTGTCTTTGTTCTTCTTGGGAACATCTTGAACCGCGTTGT  cvi-0.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCNNNNNNNNNNNNNTTCTTGGGAACATCTTGAACCGCGTTGT  est-1.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTTTGTCNTTGTTCTTCTTGGGAACATCTTGAACCGCGTTGT  fei-0.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTTNNNNNNNNNNNNTCTTGGGAACATCTTGAACCGCGTTGT  got-7.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCNNNNNNNTTNNNNTTCTTGGGAACATCTTGAACCGCGTTGT  ler-1.fa
35352  GTTTTGCATGCTGNGCACAGTAGTACCATCGTTACCATCNNNNNNNNNNNNNTTCTTGGGNACATCTTGAACCGCGTTGT  lov-5.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTTNGTCTTTNTTCTTCTTGGGAACATCTTGAACCGCGTTGT  nfa-8.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTNNNNNNNTNTTCTTCTTGGGAACATCTTGAACCGCGTTGT  rrs-10.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCNNNNNNNNNNNNNTTCTTGGGAACATCTTGAACCGCGTTGT  rrs-7.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTNNNNNNNNNTTCTTCTTGGGAACATCTTGAACCGCGTTGT  sha.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTNNNNNNNNNTTNTTCTTGGGAACATCTTGAACCGCGTTGT  tamm-2.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTNNNNNNNNNNNNNTCTTGGGAACATCTTGAACCGCGTTGT  ts-1.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTTNNNNNNNNNNNTTNTTNGGAACATCTTGAACCGCGTTGT  tsu-1.fa
35352  GTTTTGCATGCTGTGCACAGTAGTACCATCGTTACCATCTTTGTNNNNNTTCTTCTTGGGAACATCTTGAACCGCGTTGT  van-0.fa
 
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGAATGGAACAAATAATTTGTCATGCAC  chr1.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGAATGGAACAAATAATTTGTCATGCAC  bay-0.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCANNNNNNNNNNNNNNATTTGTCATGCAC  bor-4.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGNNNNNNNCAAATAATTTGTCATGCAC  br-0.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGAANGGAACAAATAATTTGTCATGCAC  bur-0.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGAATGGAACAAATAATTTGTCATGCAC  c24.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGNNNNNNNNAAATAATTTGTCATGCAC  col-0.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGNNNNNNNCAAATAATTTGTCATGCAC  cvi-0.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGNNNNNNNNAAATAATTTGTCATGCAC  est-1.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGAANGGAACAAATAATTTGTCATGCAC  fei-0.fa
35432  CCACAGTTGAGGTCTTNCTTGTTTCAATGTCGCCACTTACCTGCNAAAAANNNNNNNNNNNNNNNNNNNNNGNCATGCAC  got-7.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGNNNNNNNNNNNNNNNTTGTCATGCAC  ler-1.fa
35432  CCACAGTTGAGGTCTTNCTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGNNNNNNNNNNNNNNNNNNTCATGCAC  lov-5.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGNNNNNNACAAATAATTTGTCATGCAC  nfa-8.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGAATNNNNNNNNNAATTTGTCATGCAC  rrs-10.fa
35432  CCACAGTTGAGGTCTTNCTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGNNNNNNNNNNNNNNTTTGTCATGCAC  rrs-7.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGNNNNNNACAAATAATTTGTCATGCAC  sha.fa
35432  CCACAGTTGAGGTCTTNCTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGNNNNNNNNNNNNNNTTTGTCATGCAC  tamm-2.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGNNNNNNNNNAATAATNNGTCATGCAC  ts-1.fa
35432  CCACAGTTGAGGTCNNNNNNNTTTCAATGTCGCCACTTACCTGCTAAAAATCNNNNNNNNNNNNNNNNNNTGTCNTGCAC  tsu-1.fa
35432  CCACAGTTGAGGTCTTACTTGTTTCAATGTCGCCACTTACCTGCTAAAAATCAGNNNNNNNNNAATAATTTGTCATGCAC  van-0.fa
 
35512  TTGAAAGCATTCATCAGATTCTTCGACTACAATTTTGTAGCTTTCTTAGACTTACTTTCGTTGGTAAGGGATACTTGTTC  chr1.fa
35512  TTGAAAGCATTCATCAGATTCTTCGRCNNCAATTTTGTAGCTTTCTTAGACTTACTTTCGTTGGTAAGGGATACTTGTTC  bay-0.fa
35512  TTGAAAGCATTCATCAGATTCTTCGRCNNCAATTTTGTAGCNNNNNNNNACTTACTTTCGTTGGTAAGGGATACTTGTTC  bor-4.fa
35512  TTGAAAGCATTCATCAGATTCTTCGRCNACAATTTTGTAGCTTTNTTAGACTTACTTTCGTTGGTAAGGGATACTTGTTC  br-0.fa
35512  TTGAAAGCATTCATCAGATTCTTCGRCNACAATTTTGTAGCTTTCTTAGACTTACTTTCGTTGGTAAGGGATACTTGTTC  bur-0.fa
35512  TTGAAAGCATTCATCAGATTCTTCGRCNACAATTTTGTAGCTTTCTTAGACTTACTTTCGTTGGTAAGGGATACTTGTTC  c24.fa
35512  TTGAAAGCATTCATCAGATTCTTCGRCNNCAATTTTGTAGCTTTNTTAGACTTACTTTCGTTGGTAAGGGATACTTGTTC  col-0.fa
35512  TTGAAAGCATTCATCAGATTCTTCGRCNACAATTTTGTAGCTTTCTTAGACTTACTTTCGTTGGTAAGGGATACTTGTTC  cvi-0.fa
35512  TTGAAAGCATTCATCAGATTCTTCGRCTACAATTTTGTAGCTNNNNNNGACTTACTTTCGTTGGTAAGGGATACTTGTTC  est-1.fa
35512  TTGAAAGCATTCATCNGATTCTTCGRCNACAATTTTGTAGCTTTCTTAGACTTACTTTCGTTGGTAAGGGATACTTGTTC  fei-0.fa
35512  TTGAAAGCATTCATCAGATTCTNNGRCNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTCGTTGGTAAGGGATACTTGTTC  got-7.fa
35512  TTGAAAGCATTCATCAGATTCTTCGRCNNNNATTTTGTAGCTTTCTTAGACTTACTTTCGTTGGTAAGGGATACTTGTTC  ler-1.fa
35512  TTGAAAGCATTCATCNGATTCTNCGRCNNCANNNNNNNNGNNNNNNNNNNNNNNCTTTCGTTGGTAAGGGATACTTGTTC  lov-5.fa
35512  TTGAAAGCATTCATCAGATTCTTCGRCNACAATTTTGTAGCTTTCTTAGACTTACTTTCGTTGGTAAGGGATACTTGTTC  nfa-8.fa
35512  TTGAAAGCATTCATCAGATTCTTCGRCNACAATNTNNTNNNNNNNNNNGACTTACTTTCGTTGGTAAGGGATACTTGTTC  rrs-10.fa
35512  TTGAAAGCATTCATCNGATTCTTCGRCNNCAATTTNNNNNNNNNNNNNNNNTTACTTTCGTTGGTAAGGGATACTTGTTC  rrs-7.fa
35512  TTGAAAGCATTCATCAGATTCTTCGRCNNNNNNNNNNNNNNNNNNNNNNNCTTACTTTCGTTGGTAAGGGATACTTGTTC  sha.fa
35512  TTGAAAGCATTCATCAGATTCTNCGRNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTCGTTGGTAAGGGATACTTGTTC  tamm-2.fa
35512  TTGAAAGCATTCATCAGATTCTNCGRCNNCAATTTNGTAGCTTTCTTAGACTTACTTTCGTTGGTAAGGGATACTTGTTC  ts-1.fa
35512  TTGAAAGCANNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCGTTGGTAAGGGATACTTNTTC  tsu-1.fa
35512  TTGAAAGCATTCATCAGATTCTTCGRCNACAATTTTGTAGCNNNNNNNGACTTACTTTCGTTGGTAAGGGATACTTGTTC  van-0.fa
 
35592  ACAGTAGAAACACCCGAGCAATTCTCATCTTGATTTTCTTTTCCAGTTGATGTTTTCTAACCAGAAAATAAAACATAAGA  chr1.fa
35592  ACAGTAGAAACACCCGAGCAATTCTCATCTTGATTTTNTTTTCCNGTTGATGTTTTCTAACCAGAAAANAAAACATAAGA  bay-0.fa
35592  ACAGTAGAAACACCCGAGCAATTCTNNNNNNNNNNNTNTTNNNNNNNNNNTGTTTTNNNNNNNNNNNNNNNNNNNNNNNA  bor-4.fa
35592  ACAGTAGAAACACCCGAGCAATTCTCATNNNNNTNNTNTNNNNNNNTTGATGTTTNNNNNNNNNNNNNNNNNNNNNNAGA  br-0.fa
35592  ACAGTAGAAACACCCGAGCAATTCTCATCTTGATTTTCTTTTCCAGTTGATGTTTTCTAACCAGAAAANAAAACATAAGA  bur-0.fa
35592  ACAGTAGAAACACCCGAGCAATTCTCATCTTGNTTTTCTTTTCCAGTTGATGTTTTCTAACCAGAANNNNNNACATAAGA  c24.fa
35592  ACAGTAGAAACACCCGAGCAATTCTCATNNNNNTTTTCTTTTCCNGTTGATGTTTNNNNNNNNNNNNNNNNNNNNNNAGA  col-0.fa
35592  ACAGTAGAAACACCCGAGCAATTCTCATCTTGNNNNTCTTTTCCAGTNGATGTTTTCTAACNNNNNNNNNNNNNNNNAGA  cvi-0.fa
35592  ACAGTAGAAACACCCGAGCAATTCTCATCNNNNNNNTNTTTTNNNNNNGATGTTTNNNNNNNNNNNNNNNNNNNNNNAGA  est-1.fa
35592  ACAGTAGAAACACCCGAGCAATTCTNATNNNNNNNTTCTTTTCCAGTTGATGTTTTCTAACCNGNNNNNNNNNNNNNAGA  fei-0.fa
35592  ACAGTAGAAACACCCGAGCAATTCNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
35592  ACAGTAGAAACACCCGAGCAATTCTCANNNNNNNNNTNTTTTCCNGNNGNTGTTNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
35592  ACAGTAGAAACACCCGAGCAATTCTCNNNNNNNNNNTNTTTTNNNNNNNNTGNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
35592  ACAGTAGAAACACCCGAGCAATTCTCATCTTGNTTTTCTTTTCCAGTTGATGTTTTNNNNNNNNNNNNNNNNNNNNNAGA  nfa-8.fa
35592  ACAGTAGAAACACCCGAGCAATTCTCANNNNNNNNNNNNNNNNNNNNNNNNGTTNNNNNNNNNNNNNNNNNNNNNNNAGA  rrs-10.fa
35592  ACAGTAGAAACACCCGAGCAATTCTCATNNNNNNNNNNTTTTCCNGTTGATGTTTNNNNNNNNNNNNNNNNNNNNNNNNA  rrs-7.fa
35592  ACAGTAGAAACACCCGAGCAATTCTCATCTTGNTTTTCTTTTCCAGTTGATGTTTNNNNNNNNNNNNNNNNNNNNNNAGA  sha.fa
35592  ACAGTAGAAACACCCGAGCAATTCNNNNNNNNNNNNNNTNNNNNNNNNNNNGTNNNNNNNNNNNNNNNNNNNNNNNNNNA  tamm-2.fa
35592  ACAGTAGAANCACCCGAGCAATTCTNNNNNNNNNNNTNTTTTCCNGTTGATGTTTTNNNNNNNNNNNNNNNNNNNNNNNA  ts-1.fa
35592  ACAGTAGAAACACCCGAGCAATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
35592  ACAGTAGAAACACCCGAGCAATTCTCATNNNNNNNNNNNNNNNNNNNNGATGTTTTCNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
35672  AGTCTATCACAAG