Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 38898 - 40597


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
38898  TTAAACGGGCGACTTAGAGTCGTTATCCTTATTAGGAGTAGTATATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  chr1.fa
38898  TTAAACGGGCGACTTAGAGTCGTTATCCTTATTAGGAGTAGTATATTGAGCTTCGTTATCCATTCCTGAAGACAATGCNG  bay-0.fa
38898  NTAAACGGGCGACTTAGAGTCGTTNTCCTTNNNNNNNNNNNNNTATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  bor-4.fa
38898  TTAAACGGGCGACTTAGAGTCGTTATCCTTATTNNNNNNNNTATATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  br-0.fa
38898  TTAAACGGGCGACTTAGAGTCGTTATCCTTATTAGGAGTAGTATATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  bur-0.fa
38898  TTAAACGGGCGACTTAGAGTCGTTATCCTTATTAGGAGTAGTATATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  c24.fa
38898  TTAAACGGGCGACTTAGAGTCGTTATCCTTANNNNNNNNNNNNTATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  col-0.fa
38898  TTAAACGGGCGACTTAGAGTCGTTATCCTTATTANGNGTAGTATATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  cvi-0.fa
38898  NNNAACGGGCGACTTAGAGTCGTTATCCTNNNNNNNNNNNNNNTATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  est-1.fa
38898  TTAAACGGGCGACTTAGAGTCGTTATCCTTATTANGAGTAGTATATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  fei-0.fa
38898  NNNAACGGGCGACTTAGAGTCGNNNNNNNNNNNNNNNNNNNNNNATTGNGCTTCGTTATCCATTCCTGAAGACAATGCAG  got-7.fa
38898  NTAAACGGGCGACTTAGAGTCGTTATCCTTNNNNNNNNNNNTATATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  ler-1.fa
38898  NTAAACGGGCGACTTAGAGNCGTTATCCTNNNNNNNNNNNNNNTATTGAGCTTCGTTATCCATTCCTGAAGACAATGCNG  lov-5.fa
38898  TTAAACGGGCGACTTAGAGTCGTTATCCTTATTANGAGTAGTATATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  nfa-8.fa
38898  NTAAACGGGCGACTTAGAGTCGTTATCCNNNNNNNNNNNNNNNTATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  rrs-10.fa
38898  NNNAACGGGCGACTTAGAGTCGTTATCCNNNNNNNNNNNNNNATATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  rrs-7.fa
38898  TTAAACGGGCGACTTAGAGTCGTTATCCTTATTNNNNNNNNNNNNNNGCGCTTCGTTATCCATTCCTGAAGACAATGCAG  sha.fa
38898  NNAAACGGGCGACTTAGAGTCGTTATCCTTNNNNNNNNNNNNNNNNNNCNNNTCGTTATCCATTCCTGAAGACAATGCAG  tamm-2.fa
38898  NNNAACGGGCGACTTAGAGTCGTTATCCTTATTNNNNNNNNTATATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  ts-1.fa
38898  NNNNACGGGCGACTTAGAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTTCGTTATCCATTCCTGAAGACAATGCNG  tsu-1.fa
38898  NTAAACGGGCGACTTAGAGTCGTTATCCTNNNNNNNNNNNGTATATTGAGCTTCGTTATCCATTCCTGAAGACAATGCAG  van-0.fa
 
38978  TTGATGATTCCGTTTCTTTGTTCTTCCCCCACAAGAACATGTAGAGACCCGTTATGGTCACTAGTGATCCAATCACACTG  chr1.fa
38978  TTGATGATTCCGTTTCNTNRRRRRRRRNNCACAAGANNARGNNGAGACCCGTTATGGTCACTAGTGATCCAATCACACTG  bay-0.fa
38978  TTGATGATTCCGTTTNNNNRRRRRRRRNNNACAAGAACARGTAGAGACCCGTTATGGTCACTAGTGATCCAATNNNNNNN  bor-4.fa
38978  TTGATGATTCCGTTTNNTNRRRRRRRRNNCACAAGAACARGTAGAGACCCGTTATGGTCACTAGTGATCCAATCACACTG  br-0.fa
38978  TTGATGATTCCGTTTCTTTRRRRRRRRNNNACAAGAACARGTAGAGACCCGTTATGGTCACTAGTGATCCAATCACACTG  bur-0.fa
38978  TTGATGATTCCGTTTCTTTRRRRRRRRNNCACAAGAACARGTAGAGACCCGTTATGGTCACTAGNGATCCAATCACACTG  c24.fa
38978  TTGATGATTCCGTTTNNNNRRRRRRRRNNNACAAGAANARGTAGAGACCCGTTATGGTCACTAGNGATCCAATCACACTG  col-0.fa
38978  TTGATGATTCCGTTTCTNTRRRRRRRRNNNACAAGAACARGTAGAGACCCGTTATGGTCACTAGTGATCCAATCACACTG  cvi-0.fa
38978  TTGATGATTCCGTTTCNNNRRRRRRRRNNNACAAGAACARGTAGAGACCCGTTATGGTCACTAGNGATCCAATCACACTG  est-1.fa
38978  TTGATGATTCCGTTTCTTNRRRRRRRRNNNACAAGAACNRGNAGAGACCCGTTATGGTCACTAGNGATCCAATCACACTG  fei-0.fa
38978  TTGATGATTCCGTTTNNNNRRRRRRRRNNNACAAGAANARGTAGAGACCCGTTATGGTCACTAGTGATCCAATCACACTG  got-7.fa
38978  TTGATGATTCCGTTTNNNNRRRRRRRRNNNACAAGAANARGTAGAGACCCGTTATGGTCNNNNNNNNTCCAATCACACTG  ler-1.fa
38978  TTGATGATTCCGTTTCNNNRRRRRRRRNNNACAAGANNNRGNNGAGACCCGTTATGGTCNCNNGNGATCCAATCACACTG  lov-5.fa
38978  TTGATGATTCCGTTTCNNNRRRRRRRRNNNACAAGANCARGTAGAGACCCGTTATGGTCACTAGTGATCCAATCACACTG  nfa-8.fa
38978  TTGATGATTCCGTTTCNTNRRRRRRRRNNNACAAGANCNRGTAGAGACCCGTTATGGTCACTAGNGATCCAATCACACTG  rrs-10.fa
38978  TTGATGATTCCGTTTNNNNRRRRRRRRNCCACAAGANCARGTAGAGACCCGTTATGGTCACTAGNGATCCAATNNNNNNN  rrs-7.fa
38978  TTGATGATTCCGTTTCNNNRRRRRRRRNNNACAAGAACARGNAGAGACCCGTTATGGTCACTAGNGATCCAANNNNNNNN  sha.fa
38978  TTGATGATTCCGTTTNNNNRRRRRRRRNNNACAAGANNARGNAGAGACCCGTTATGGTCACTAGTGATCCAATCNNNNNN  tamm-2.fa
38978  TTGATGATTCCGTTTCNNNRRRRRRRRNNNACAAGANNARGNAGAGACCCGTTATGGTCNCNNGNGATCCAATCACACTG  ts-1.fa
38978  TTGATGATTCNGNNNNNNNRRRRRRRRNNNACAAGAANARGNAGAGACCCGTTATGGTNNNNNNNGATCCAATCACACTG  tsu-1.fa
38978  TTGATGATTCCGTTTCNNTRRRRRRRRNCNACAAGAACARGTAGAGACCCGTTATAGNNNNNNNNNNTCCAATCACACTG  van-0.fa
 
39058  TAGACCAAAAGTTTTAATGTTGTAATTAGTGTTATGCCTAGACAAAATTAATTTGATAGAGATTATCGAAGAAGATACCT  chr1.fa
39058  TAGACCAAAAGTTTTAATGTTGTAATTAGTGTTATGCRTAGACAAAATTAATTTGATAGAGATTATCGAAGAAGATACCT  bay-0.fa
39058  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTANNCRTAGACAANNNNNNNNNNNNNNNNNNNNNNNNAGAAGATACNN  bor-4.fa
39058  TAGACCAAAAGTTNNNNNNNNNNNNNTNGTGTTANGCRNNGACAAANNNNNNNNNNNNGAGNNNNNCGAAGAAGATACCT  br-0.fa
39058  TAGACCAAAAGTTTTAATGTNGTNATTAGTGTTATGCRTAGACAAAATTAATTTGATAGAGATTATCGAAGAAGATACCT  bur-0.fa
39058  TAGACCAAAAGTTTTAATGTNNNNNNTAGTGTTATGCRTAGACAAAATTAATTTGATAGAGATTATCGAAGAAGATACCT  c24.fa
39058  TAGACCAAAAGTTNNNNNNNNNNNNNNNGTGTTATNCRNANACAANNNNNNNNNNNNNNNNNNNNNNGAAGAAGATACNN  col-0.fa
39058  TAGACCAAAAGTTTTAATGTTGTNATTAGTGTTATGCRTAGACAAAANNNNNNNNNNNGAGATTATCGAAGAAGATACCT  cvi-0.fa
39058  TAGACCAAAAGTTNNNNNNNNNNNNNNAGTGTTANNNRNNNACNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGATACNN  est-1.fa
39058  TAGACCAAAAGTTTTAATGTTGTNATTAGTGTTATGCRTAGACAAAATTNANNNGATAGAGATTATCGAAGAAGATACCT  fei-0.fa
39058  TAGACCAAAAGTNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGATACNN  got-7.fa
39058  TAGACCAAAAGTTNNNNNNNNNNNNNNNGTGTTANNCRNAGACAANNNNNNNNNNNNNNNNNNNNNNGAAGAAGATACNN  ler-1.fa
39058  TAGACCAAAANNNNNNNNNNNNNNNNNNNNNNTANNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATACNN  lov-5.fa
39058  TAGACCAAAAGTTTTAATNNNNNNNNTAGTGTTATGCRTAGACAAAANNNNNNNNNNNGAGATTATCGAAGAAGATACCT  nfa-8.fa
39058  TAGACCAAAAGTTNNNNNNNNNNNNNNNNTGTTANNNRNAGACANNNNNNNNNNNNNNNNNNNNNTCGNNNNNNNNNNNN  rrs-10.fa
39058  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTANGCRNAGACAANNNNNNNNNNNNNNNNNNNNNNGAAGAAGATACCN  rrs-7.fa
39058  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANGCRNAGACAAAANNNNNNNNNNNNAGATTATCGAAGAAGATACNN  sha.fa
39058  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCRNNNACNNNNNNNNNNNNNNNNNNNNNNNNNAAGAAGATACCN  tamm-2.fa
39058  TAGACCAAAAGTNNNNNNNNNNNNNNNNNTGTTATGCRNAGACAANNNNNNNNNNNNNNNNNNNNNNGAAGAAGATACCT  ts-1.fa
39058  TAGACCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGATANNN  tsu-1.fa
39058  TAGACCAAAAGTTTTNNNNNNNNNNNNAGTGTTANGCRTAGACANNNNNNNNNNNNNNNNNNNNNNNGAAGAAGATACNN  van-0.fa
 
39138  TCCAAGGTATAAAGGAGTGTGTAAAATGAGGAAATCAAATAGAGTAGCCGAAATGAGAGTAAGTGGGAAAAACGCCGATG  chr1.fa
39138  TCCNNNGRRRRRAGGAGRGTGTAAAATGAGGAAATCNAATNGARTAGCCGAAATGAGAGTAAGTGGGAAAAACGCCGATG  bay-0.fa
39138  NNNNNNNRRRRRNNNNNRNNNNNNNNNNNNNNNNNNNNNTNNARTAGCCGAAATGAGAGTAAGTGGGAAAAACGCCGATG  bor-4.fa
39138  TCCNNNGRRRRRAGGNGRGNGTAAAATGANGNNNNNNNATNGARTAGCCGAAATGAGAGTAAGTGGGAAAAACGCCGATG  br-0.fa
39138  TCCNAGGRRRRRAGGAGRGTGTAAAATGAGGAAATCNAATAGARTNGCCGAAATGAGAGTAAGTGGGAAAAACGCCGATG  bur-0.fa
39138  TCCNAGGRRRRRAGGAGRGTGTAAAATGAGGAAATCNAATNGARTAGCCGAAATGAGAGTAAGTGGGAAAAACGCCGATG  c24.fa
39138  NNNNNNGRRRRRNNNNNRGNGTAAAATGNGGNANNNNNATNGARNAGCCGAAATGAGAGNAAGTGGGAAAAACGCCGATG  col-0.fa
39138  TCCNAGGRRRRRAGGAGRGTGTAAAATGAGGAAATCNAATAGARNAGCCGAAATGAGAGTAAGTGGGAAAAACGCCGATG  cvi-0.fa
39138  NNNNNNNRRRRRNNNNGRNTGTAAAANNNNNNNNNNNNATNNARTAGCCGAAATGAGAGTAAGTGGGAAAAACGCCGATG  est-1.fa
39138  TCCNNGGRRRRRAGGAGRGTGTAAAATGAGGAAATCNAATAGARNNGCCGAAATGAGAGTAAGTGGGAAAAACGCCGATN  fei-0.fa
39138  NNNNNNNRRRRRNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNRNAGCCGAAATGAGNNNNNNNGGGAAAAACGCCGATG  got-7.fa
39138  NNNNNNNRRRRRNNNNNRGNNTAAAATGAGGAAATCNAATAGARNAGCCGAAATGAGAGTAAGTGGGAAAAACGCCGATG  ler-1.fa
39138  NNNNNNNRRRRRNNNNNRGNNNAANNNNNNNNNNNNNNNTNNARTAGCCGAAATGAGAGNAAGTGGGAAAAACGCCGATG  lov-5.fa
39138  NNNNNGGRRRRRNGGNNRGNGTAAAATGAGGAANNNNNATNGARNAGCCGAAATGAGAGTAAGTGGGAAAAACGCCGATG  nfa-8.fa
39138  NNNNNNGRRRRRAGNNNRNNNTAAAATGAGNNNNNNNNATNGARTAGCCGAAATGAGAGTAAGTGGGAAAAACGCCGATG  rrs-10.fa
39138  NNNNNNNRRRRRNNNNNRNNNNNNNNNNNNNNNNNNNNNTNGARTAGCCGAAATGAGAGTNAGTGGGAAAAACGCCGATG  rrs-7.fa
39138  NNNNNNGRRRRRNNNNNRNNNNNNNNNNNNNNNNNNNNNTNGARNAGCCGAAATGAGAGTAAGTGGGAAAAACGCCGATG  sha.fa
39138  NNNNNNNRRRRRNNNNNRNNNNNNNNNNNNNNNNNNNNNTNNNRNNGCCGAAATGAGAGNAAGTGGGAAAAACGCCGATG  tamm-2.fa
39138  NNNNNNNRRRRRNNNNNRGNGNAAAATGAGNNNNNNNNATNNNRNNGCCGAAATGAGAGNAAGTGGGAAAAACGCCGATG  ts-1.fa
39138  NNNNNNNRRRRRNNNNNRNNNNNNNNNNNNNNNNNNNNATNNNRNAGCCGAAATGAGNNNNNNNGGGAAAAACGCCGATG  tsu-1.fa
39138  NNNNNGGRRRRRNGNNGRGNGTAAAANNNNNNNNNNNNATNGARTAGCCGAAATGAGAGTAAGTGGGAAAAACGCCGATG  van-0.fa
 
39218  CGAACACAGCTCCTAATTTTTTAATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCTACCACTCCCTATAATATA  chr1.fa
39218  CGAANACAGCTCCTAATTTTTTAATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRCTCCCTATANNNNN  bay-0.fa
39218  CGAANACAGCTCCTAATTTNNNNNNCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRNNNNNNNNNNNNNN  bor-4.fa
39218  CGAANACAGCTCCTAATTTTTTNATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRNNNNNNNNNNNNNN  br-0.fa
39218  CGAANACAGCTCCTAATTTTTTAATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRCTNCCTANNNNNNN  bur-0.fa
39218  CGAANACAGCTCCTAATTTTTTAATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRCTCCCNNNNNNNNN  c24.fa
39218  CGAACACAGCTCCTAATTTTTTAATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRNNNNNNNNNNNNNN  col-0.fa
39218  CGAANACAGCTCCTAATTTTTTAATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRCNNCCNNNNNNNNN  cvi-0.fa
39218  CGAACACAGCTCCTAATTTTTTNNNNNCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRNNNNNNNNNNNNNN  est-1.fa
39218  CNNANACAGCTCCTAATTTTTTAATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRCNNCNNNNNNNNNN  fei-0.fa
39218  CGAACACAGCTCNNNNNNNNNNNNNNCCCCATGTTGTTGCAACCGTCGTCATTGCTTGNCCRRRRRNNNNNNNNNNNNNN  got-7.fa
39218  CGAANACAGCTCCTAATTTTTTAATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRNNNNNNNNNNNNNN  ler-1.fa
39218  CGAANACAGCTCCTAATTTTTTNATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRNNNNNNNNNNNNNN  lov-5.fa
39218  CGAANACAGCTCCTAATTTTTTAATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRNNNCNNNNNNNNNN  nfa-8.fa
39218  CGAANACAGCTCCTAATTTTTTAATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRNNNNNNNNNNNNNN  rrs-10.fa
39218  CGAACACAGCTCCTAATTTTTTAATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRNNNNNNNNNNNNNN  rrs-7.fa
39218  CGAANACAGCTCCTAATTTTTTAATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRNNNNNNNNNNNNNN  sha.fa
39218  CGAACACAGCTCCTAATTTTTTAATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRNNNNNNNNNNNNNN  tamm-2.fa
39218  CGAACACAGCTCCTAATTTTTTNATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRNNNNNNNNNNNNNN  ts-1.fa
39218  CGAACACAGCTNNNNNNNNNNNNNNNNNNNNTGTTGTTGCAACCGTCGTCATTGCTTGNCCRRRRRNNNNNNNNNNNNNN  tsu-1.fa
39218  CGAANACAGCTCCTAATTTTTTAATCCCCCATGTTGTTGCAACCGTCGTCATTGCTTGTCCRRRRRNNNNNNNNNNNNNN  van-0.fa
 
39298  TGATAAAAAAAAACCACATAAAAAAACCCACATTAATATCTTAAGTTCTTACATACTAATCTTATAATTTTTAAAAAGTT  chr1.fa
39298  NNNNNNNRNNNAANNNNNNNNNNAAACCNACATTAATATCTTAAGTTCTTACATACTAATCTTATAATTNNNRNNNNNRN  bay-0.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  bor-4.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  br-0.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNAAACCCACATNAATATCTNNNNNNCTTACATNNNNNNNNNNNNNNNNNNRNNNNNRN  bur-0.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  c24.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  col-0.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  cvi-0.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  est-1.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  fei-0.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  got-7.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  ler-1.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  lov-5.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  nfa-8.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  rrs-10.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  rrs-7.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  sha.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  tamm-2.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  ts-1.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  tsu-1.fa
39298  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNRN  van-0.fa
 
39378  AATTTATAAAGATATGATGTTTGTAACTTACAGCGTATATGATGACGGTGATAACGAATCTATCATCTATGATCCAATCA  chr1.fa
39378  NATTTATAAAGATNTGATGTTTGTAACTTACAGCGTATATGATGACGGTGATAACGAATCTATCATCRATGATCCAATCA  bay-0.fa
39378  NNNNNNNNNNNNNNNNNNNNNTGTAACTTACAGCGTATATGATGACGGTGATAACGAATCNATCNTNRNNNNNCCAATCA  bor-4.fa
39378  NNNNNNNNNNNNNNNNNNNNTTGTAACTTACAGCGTATATGATGACGGTGATAACGAATCTATCATCRANGATCCAATCA  br-0.fa
39378  NNNNNNNNNNNNNNNNATGTTTGTAACTTACAGCGTATATGATGACGGTGATAACGAATCTATCATCRATGATCCAATCA  bur-0.fa
39378  NNNNNNNNNNNNNNNNATGTTTGTAACTTACAGCGTATATGATGACGGTGATAACGAATCTATCATCRATGATCCAATCA  c24.fa
39378  NNNNNNNNNNNNNNNNNNNNTTGTAACTTACAGCGTATATGATGACGGTGATAACGAATCNATCATCRANNATCCAATCA  col-0.fa
39378  NNNNNNNNNNNNNNNNNNGTTTGTAACTTACAGCGTATATGATGACGGTGATAACGAATCTATCATCRATGATCCAATCA  cvi-0.fa
39378  NNNNNNNNNNNNNNNNNNNTTTGTAACTTACAGCGTATATGATGACGGTGATAACGAATCNATCANCRNNNATCCAATCA  est-1.fa
39378  NNNNNNNNNNNNNNNNNTGTTTGTAACTTACAGCGTATATGATGACGGTGATAACGAATCTATCNNCRATGATCCAATCA  fei-0.fa
39378  NNNNNNNNNNNNNNNNNNNNNNNTAACTTACAGCGTATATGATGACGGTGATAACGNNNNNNNNNNNRNNNNNNNAATCA  got-7.fa
39378  NNNNNNNNNNNNNNNNNNNNNNNTAACTTACAGCGTATATGATGACGGTGATAACGAATCNANNNNNRNNNATCCAATCA  ler-1.fa
39378  NNNNNNNNNNNNNNNNNNNNNNGTAACTTACAGCGTATATGATGACGGTGATAACGAATCNNNNNNNRNNNNNNNNATCA  lov-5.fa
39378  NNNNNNNNNNNNNNNNNNGTTTGTAACTTACAGCGTATATGATGACGGTGATAACGAATCTATCANCRATGATCCAATCA  nfa-8.fa
39378  NNNNNNNNNNNNNNNNNNNNNNNTAACTTACAGCGTATATGATGACGGTGATAACGAATCTATCANNRNNNNNNNNATCA  rrs-10.fa
39378  NNNNNNNNNNNNNNNNNNNNNNGTAACTTACAGCGTATATGATGACGGTGATAACGAATCTATCNNNRNNNNNCCAATCA  rrs-7.fa
39378  NNNNNNNNNNNNNNNNNNGTTTGTAACTTACAGCGTATATGATGACGGTGATAACGAATCTATCANCRNTGATCCAATCA  sha.fa
39378  NNNNNNNNNNNNNNNNNNNNNNGTAACTTACAGCGTATATGATGACGGTGATAACGAATCNATCANCRNNNNNNCAATCA  tamm-2.fa
39378  NNNNNNNNNNNNNNNNNNNNTTGTAACTTACAGCGTATATGATGACGGTGATAACGAATCNATCNNNRNNNNNNCAATCA  ts-1.fa
39378  NNNNNNNNNNNNNNNNNNNNNNGTAACTTACAGCGTATATGATGACGGTGATAACGANNNNNNNNNNRNNNNNNNNNNCA  tsu-1.fa
39378  NNNNNNNNNNNNNNNNNNNNNNGTAACTTACAGCGTATATGATGACGGTGATAACGAATCTATCANCRNNNANCCAATCA  van-0.fa
 
39458  TTAACGTCTCTGCTCTTGTAAAGGCTCAAGAGAGCACATTGAAATGCCGCGAAAATTGACATAAGACAAGTGCTCGAGTA  chr1.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCTCAARAGAGCACATTGAAARGCRGCGAAAATTGNCRRRAGACAAGTGCTCGNGRN  bay-0.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCTCAARAGAGCACATTGAAARGCRGCGAAAATTGACRRRAGACAAGTGCTCGAGRA  bor-4.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCTCAARAGAGCACATTGAAARGCRGCGAAAATTGACRRRAGACAAGTGCTCGAGRA  br-0.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCTCAARAGAGCACATTGAAARGCRGCGAAAATTGACRRRAGACAAGTGCTCGAGRA  bur-0.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCTCAARAGAGCACANTGAAARGCRGCGAAAATTGNCRRRAGACAAGTGCTCGAGRA  c24.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCNCAARAGAGCACANTGAAARGCRGCGAAAATTGACRRRNGACAAGTGCTCGAGRA  col-0.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCTCAARAGAGCACANTGAAARGCRGCGAAAATTGACRRRAGACAAGTGCTCGAGRA  cvi-0.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCTCAARAGAGCACATTGAAARGCRGCGAAAATTGACRRRAGACAAGTGCTCGAGRA  est-1.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCTCANRAGAGCACATTGAAARGCRGCGAAAATTGNCRRRAGNCAAGTGCTCGAGRA  fei-0.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCNCAARNGAGCACATTGAAARGCRGCGAAAATTGANRRRAGNCAAGTGCTCNAGRA  got-7.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCNCNARNNNGCACATTGAAARGCRGCGAAAATTGACRRRNNACAAGTGCTCGAGRA  ler-1.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCNNNNRNNNNCNCANTGAAARGCRGCGAAAATTGACRRRNGNCAAGTGCTCGAGRA  lov-5.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCTCAARAGAGCACATTGAAARGCRGCGAAAATTGACRRRAGNCAAGTGCTCGAGRA  nfa-8.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCTCAARNGAGCACATTGAAARGCRGCGAAAATTGACRRRAGACAAGTGCTCGAGRA  rrs-10.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCTNAARAGAGCACATTGAAARGCRGCGAAAATTGACRRRAGACAAGTGCTCGAGRA  rrs-7.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCTCAARNNNGCACATTGAAARGCRGCGAAAATTGACRRRAGACAAGTGCTCGAGRA  sha.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCNCNARNGNGCACANTGAAARGCRGCGAAAATTGNCRRRNGNCAAGTGCTCGAGRA  tamm-2.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCTNAARANNGCACANTGAAARGCRGCGAAAATTGACRRRAGACAAGTGCTCGAGRA  ts-1.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCNNNARNNNGCACATTGAAARGCRGCGAAAATTGNCRRRNNNCAAGTGCTCGAGRA  tsu-1.fa
39458  TTAACGTCTCTGCTCTTGTAAAGGCTCAARAGAGCACATTGAAARGCRGCGAAAATTGACRRRAGACAAGTGCTCGAGRA  van-0.fa
 
39538  TTTGCAAGGGTACTTAATACTTAAAGTCCCTTGAAACAACATCCATAGAGATAGCAACACTGTTCCTATGGTTAAATAAA  chr1.fa
39538  TTTGCAAGGGTACTTRANRNTTAAAGTCCCTRRRRRRRRRRRRRRRRRAGATARCAACACRGTTCCTATGGTTAARTARA  bay-0.fa
39538  TTTGCAAGGGNNNNNRNNRNNNNNNNNNNNNRRRRRRRRRRRRRRRRRNGANNRCNNNNCRGNTCCTNNNNNNNNRNNRN  bor-4.fa
39538  TTTGCAAGGGNNNNNRNNRNNNNNNNTCCCTRRRRRRRRRRRRRRRRRAGATARCAACACRGTTCCTATGGTNNNRNARN  br-0.fa
39538  TTTGCAAGGGTACTTRNNRNNTAAAGTCCCTRRRRRRRRRRRRRRRRRAGATARCAACACRGNTCCTATGGTTAARTARA  bur-0.fa
39538  TTTGCAAGGGTACTTRNNRNNNNAAGTCCCTRRRRRRRRRRRRRRRRRAGATARCAACACRGTTCCTATGGTTAARTARA  c24.fa
39538  TTTGCAAGGGTNNNNRNNRNNNNNNNNCNNNRRRRRRRRRRRRRRRRRAGATARCANCACRGTTCCTANGGTNNARNNRN  col-0.fa
39538  TTTGCAAGGGTANNNRNNRNNNNNNNTCCCTRRRRRRRRRRRRRRRRRAGATARCAACACRGTTCCTATGGTTAARNARA  cvi-0.fa
39538  TTTGCAAGGNNNNNNRNNRNNNNNNNNNNNNRRRRRRRRRRRRRRRRRAGATARCANCACRGTTCCTATGGTNNNRNNRN  est-1.fa
39538  TTTGCAAGGGTACTNRNNRNNNNNAGTCCCTRRRRRRRRRRRRRRRRRAGATARCAACACRGTTCCTATGGTTAARTARA  fei-0.fa
39538  TTTGCANNNNNNNNNRNNRNNNNNNNNNNNNRRRRRRRRRRRRRRRRRANANNRCNNNNCRNTNCCNNNNNNNNNRNNRN  got-7.fa
39538  TTTGCAANNNNNNNNRNNRNNNNNNGTCCCTRRRRRRRRRRRRRRRRRAGNTNRNNNNNNRNNTCCTATNNNNNNRNNRN  ler-1.fa
39538  TTTGCAAGNNNNNNNRNNRNNNNNNNNCNCTRRRRRRRRRRRRRRRRRANNNNRNNNNNNRNNNNNNNNNNNNNNRNNRN  lov-5.fa
39538  TTTGCAAGGGTANNNRNNRNNNNNNNTCCCTRRRRRRRRRRRRRRRRRAGATARCAACACRGTTCCTATGGTTANRTARA  nfa-8.fa
39538  TTTGCAAGGGNNNNNRNNRNNNNNNNNNNNNRRRRRRRRRRRRRRRRRAGATARCAACACRGTTCCTNTNNTNNNRNARN  rrs-10.fa
39538  TTTGCAAGGGTNNNNRNNRNNNNNNNNCNNNRRRRRRRRRRRRRRRRRAGATARCANCACRNTTCCNNNNNNNNNRNNRN  rrs-7.fa
39538  TTTGCAAGGGTANNNRNNRNNNNNNNTCCCTRRRRRRRRRRRRRRRRRAGNTARCANCACRGTTCCTATGGTNAARNNRN  sha.fa
39538  TTTGCAAGGNNNNNNRNNRNNNNNNNNCNNNRRRRRRRRRRRRRRRRRANANNRCNNNACRNNNCCNNNNNNNNNRNNRN  tamm-2.fa
39538  TTTGCAAGGNNNNNNRNNRNNNNNNNNCNNNRRRRRRRRRRRRRRRRRAGANNRCNNNNNRNNTCCTATGGTNNNRNARN  ts-1.fa
39538  TTTGCNNNNNNNNNNRNNRNNNNNNNNNNNNRRRRRRRRRRRRRRRRRNNNNNRNNNNNNRNNNCCNNNNNNNNNRNNRN  tsu-1.fa
39538  TTTGCAAGGGTNNNNRNNRNNNNNNNNCNNNRRRRRRRRRRRRRRRRRAGATARCAACACRGTTCCTATNNNNNNRNNRN  van-0.fa
 
39618  GACATCCAAGAAGCCAATTATTGGCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGAGTGAGAGTGAGAG  chr1.fa
39618  GACATCCAAGARGNNANNNNNTGGCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGANNNNNNNRNNRNN  bay-0.fa
39618  NNCATCCANGNRNCNAANNNNNNNNCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGNNNNNNNNRNNRNN  bor-4.fa
39618  NNNNNCCAANARGCCAATTATTGGCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGAGTNNNNNRNNRNN  br-0.fa
39618  NNCATCCAAGARGCNAATTATTGGCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGAGTGANNNRGNRAG  bur-0.fa
39618  GACATCCAAGARGCNAATTNTTGGCCTTGTCTTGATCGTTGNTGTTGTGGGAAGCCCCACCGTGAGAGTNNNNNRGNRAG  c24.fa
39618  NNCATCCAANARGCCAATTNTTGGCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGAGNNNNNNRNNRNN  col-0.fa
39618  NNCATCCAAGARGCNAATTATTGGCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGAGNNNNNGRGARAG  cvi-0.fa
39618  NNNNNCCAAGARGCNAATNATTGGCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGANNNNNNNRNNRNN  est-1.fa
39618  GACATCCAAGARGNCAANNNNTGGCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGAGTGNNNNRGNRAG  fei-0.fa
39618  NNNNNCCAANNRGNNAANNNNNGGCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGNNNNNNNNRNNRNN  got-7.fa
39618  NNCATCCAAGARGNNNNNNNNNNGCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGNNNNNNNNNNRNNRNN  ler-1.fa
39618  NNCATCCANNNRNNNNNNNNNNNNNCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGNNNNNNNNNNRNNRNN  lov-5.fa
39618  NACANCCAAGARNCNAATTNTTGGCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGNNNNNNNNRGNRAG  nfa-8.fa
39618  NNCATCCAAGARNCNAANNNNNNNCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGAGTNNNNNRNNRAN  rrs-10.fa
39618  NNCANCCAAGARGNNANNNNNNNNCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGNNNNNNNNRNNRNG  rrs-7.fa
39618  GNCANCCAAGARNNNNNNNNTTGGCCTTNTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGANNNNNNNRNNRNG  sha.fa
39618  NNNNNCCAANNRNNNNNNNNNNNNNCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGNNNNNNNNRNNRNN  tamm-2.fa
39618  NNCANCCANNNRNNNANNNNNNNGCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGANNNNNNNNNRNNRNG  ts-1.fa
39618  NNNATCCANNNRNNNNNNNNNNNNNNNTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGANNNNNNNNNRNNRNN  tsu-1.fa
39618  NNNNNCCAAGARGCCAATTATTGGCCTTGTCTTGATCGTTGTTGTTGTGGGAAGCCCCACCGTGAGAGTNNNNNRGNRNG  van-0.fa
 
39698  TTTGATATTTGTGGGCCTTTGTAAAATGTTAAGAACAAAGCTCCACTTATACAGATCAAAGTTCCAATCACCTTCAACAT  chr1.fa
39698  NTTGANNTRTNRGGGCCTTTGRRRRRRRRRRRRRRRRRRRRRRRACTTATACAGATCAAAGTTCCAATCACCTTCAACAT  bay-0.fa
39698  NNNNNNNNRTNRGGGCCTTTGRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNCCAATCACCTTCAACAT  bor-4.fa
39698  NTTGATNTRTNRGNGCCTNNNRRRRRRRRRRRRRRRRRRRRRRRACTTATACAGATCAAAGTTCNNNNNNNNNNNNNNNN  br-0.fa
39698  TTTGANNTRTGRGGGCCTTTGRRRRRRRRRRRRRRRRRRRRRRRACTTATACAGATCAAAGTTCCAATCACCTTCAACAT  bur-0.fa
39698  TTTGANNTRNNRNNNCCTNTGRRRRRRRRRRRRRRRRRRRRRRRACNTANNNNTNNNAAAGTTCCAATCACCTTCAACAT  c24.fa
39698  NNNNNNNNRTGRGNGCCTTTGRRRRRRRRRRRRRRRRRRRRRRRACTTATACAGATCAAAGTTCCAATCACCTTCAACAT  col-0.fa
39698  TTTGANNNRTGRGGGCCTTTGRRRRRRRRRRRRRRRRRRRRRRRACTTATACAGATCAAAGTTCCAATCACCTTCAACAT  cvi-0.fa
39698  NNNGANNNRTGRGGGCCTTTGRRRRRRRRRRRRRRRRRRRRRRRACNTATACAGATCAAAGTTCCAATCACCTTCAACAT  est-1.fa
39698  NTTGATNTRTGRGGGCCTTTGRRRRRRRRRRRRRRRRRRRRRRRACNTNNNNNTNNNNNNGTTCCAATCACCTTCAACAT  fei-0.fa
39698  NNTGANNNRNGRNGNCCTNNGRRRRRRRRRRRRRRRRRRRRRRRACNTANANNGNTCAAAGTTCCAATCACCTTCAACAT  got-7.fa
39698  NTNNNNNNRTGRGGGCCTNNGRRRRRRRRRRRRRRRRRRRRRRRACTTATACAGATCAAAGTTCCAATCACCTTCAACAT  ler-1.fa
39698  NTNNNNNNRNGRGGGCCTTNGRRRRRRRRRRRRRRRRRRRRRRRACTTATACAGATCAAAGTTCCAATCACCNTCAACAT  lov-5.fa
39698  TTTGANNNRTNRGGGCCTTTGRRRRRRRRRRRRRRRRRRRRRRRACTTATACAGATCAAAGTTCCAATCACCTTCAACAT  nfa-8.fa
39698  NTTGANNTRTGRGGGCCTTTGRRRRRRRRRRRRRRRRRRRRRRRACTTATACAGATCAAAGTTCCAATCACCTTCAACAT  rrs-10.fa
39698  NTTGANNNRTGRGGGCCTTTGRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNCCAATCACCTTCAACAT  rrs-7.fa
39698  TTTGANNNRTGRNGGCCTTTGRRRRRRRRRRRRRRRRRRRRRRRACNNNNNNNTNNNNNNGTTCCAATCACCTTCAACAT  sha.fa
39698  NNNNNNNNRNGRNNNCCTTNGRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNTNNNNNNNTTCCAATCACCTTCAACAT  tamm-2.fa
39698  NTNNANNNRNGRGGGCCTTTGRRRRRRRRRRRRRRRRRRRRRRRACNTATACAGATCAAAGTTCCAATCACCNTCAACAT  ts-1.fa
39698  NNNNNNNNRNNRNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNCCAATCACCTTCAACAT  tsu-1.fa
39698  NTTGATNTRTGRGGGCCTTTGRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNTNNNNNNNNTCCAATCACCNTCAACAT  van-0.fa
 
39778  TCCTGCTTTGGTCTTTAGAATCTTCACATTTTCAGTCCTAAAAAAAGTAAAATTTTAATGATTATTTTGAAACAAGTTAT  chr1.fa
39778  TCCTGCTTRGGTCNTTAGAATCTTCACATTTTCAGTCCTAAAAAAAGTAAAANNNNNATGATTATTTTGAAACAAGTTAT  bay-0.fa
39778  TCCTGCTTRGNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
39778  NNNNNNNNRNNNNNNNNNNNNNNNCACATTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
39778  TCCTGCTTRGGTCTTTAGAATCTTCACATTTTCAGTCCTAAAAAANNNNNNNNNNNNNNNNNNNNNTTGAAACAAGTTAT  bur-0.fa
39778  TCCTGCTTRGGTCNNNNNNNNNNNNNNNNNNNNNNTCCTAAAAAANNNNNNNNNNNNNNNNNNNNNTTGAAACAAGTTAT  c24.fa
39778  TCCTGCTTRGGTCNTNNGNNNNNTCACATTTTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
39778  TCCTGCTTRGGTCNNNNGAATCTTCACATTTTCAGTCCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
39778  TCCTGCTTRGNNCNNNNNANNCTNCACATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
39778  TCCTGCTTRGGTCNNNNNNNNNNNNNNNNNNNNNNNCCTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNAAACAAGTTAT  fei-0.fa
39778  TCCTGCTNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
39778  TCCTGCTTRGGTCNNNNNNNNNNNNNCATTTTNAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
39778  TCCTGCNNRGGNCTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
39778  TCCTGCTTRGGTCTTTNNNNNCTTCACATTTTCAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTNNN  nfa-8.fa
39778  TCCTGCTNRGNNCTTTAGANNNNNNNCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
39778  TCCTGCTTRGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
39778  TCCTGCTTRNNNCNNNNNNNNNNNNNNNNNNNNNNNCCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
39778  TCCTGCTTRNNNCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
39778  TCCTGCTTRNNTCNNNNGANNNNNNNCATTTTCNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
39778  TCCTGNTNRNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
39778  TCCTGCTTRGNNCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
39858  TGAGAATATGAATCATAGTAGAAAGTATTTGTTTTTTTTCTTTCCTGGCGTTACAAAATAGAGTCGCTTTTTAATAATTT  chr1.fa
39858  TGAGAATNTGAATCATAGTAGAANNNNNTNNRNNNNNNNNNNNNCTGGCGTTACAAAATAGAGTCGCTTTTTANTAATTT  bay-0.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTNNNNTTTCCTGGCGTTACAAAATAGNNNNNNNNNNNNNTAATTT  bor-4.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNTTTCCTGGCGTTACAAAATAGAGNNNNNNNNTAATAATTT  br-0.fa
39858  TGAGAATATGAATCATAGTANNNNNNNNNNNRNNNNTTTCTTTCCTGGCGTTACAAAATAGAGTCGCTTTTTAATAATTT  bur-0.fa
39858  TGAGAATATGAATNNNNNNNNNNNNNNNNNNRNNNNNTTCTTTCCTGGCGTTACAAAATAGAGTCGCTTTTTAATAATTT  c24.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNTTTCCTGGCGTTACAAAATAGAGTCNNNNNNNAATAATNT  col-0.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNTCCTGGCGTTACAAAATAGAGTCGNTTTTTAATAATTT  cvi-0.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNTTNTTTCCTGGCGTTACAAAATAGAGNNNNNNNNNAATAATTT  est-1.fa
39858  TGAGAATATGANNNNNANNNNNNNNNNNNNNRNNNTTTTNTTTCCTGGCGTTACAAAATAGAGTCGCTTTTTAATAATTT  fei-0.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNGCGTTACAAAATAGANNNNNNNNNNNNNNNNNT  got-7.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTTTTNTTTCCTGGCGTTACAAAATAGAGTNNNNNNNNAATAATTT  ler-1.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTNNNNTTTCNTGGCGTTACAAAATANNNNNNNNNNNNNATAATTT  lov-5.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNTTTCCTGGCGTTACAAAATAGAGTCGNTTTTTAATAATTT  nfa-8.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTTTTCTTTNCTGGCGTTACAAAATAGAGNNNNNNNNNNNNAATTT  rrs-10.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNTTTCCTGGCGTTACAAAATAGAGTNNNNNNNNAATAATTT  rrs-7.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNTTTCCTGGCGTTACAAAATAGAGTCNNNNNTTAATAATTT  sha.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNTTTCCTGGCGTTACAAAATAGAGTNNNNNNNNNNTAATNT  tamm-2.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNCTGGCGTTACAAAATAGAGNNNNNNNNNNNTAATTT  ts-1.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNTNNNNNNNNGCGTTACAAAATNNNNNNNNNNNNNNNNNNNTN  tsu-1.fa
39858  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNCCTGGCGTTACAAAATAGAGTNNNNNNNTAATAATNT  van-0.fa
 
39938  TCCGCATCATTCCATCAAAGTTTATAAAAATGCGACGTATAGCTAAGAAAAGACATTTTTTCAGGAAAAGCTTTAGAAAG  chr1.fa
39938  TCCGCATCATTCCATCAAAGTTTATAAAAATGCGACGTATAGCTAAGAAAAGACATTTTTTCAGGAAAAGCTTTAGAAAG  bay-0.fa
39938  TCCGCATCATTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGNNNNNNNNNTAGAAAG  bor-4.fa
39938  TCCGCATCATTCCATCAANGTTTATAAAAATGCGACGTATAGCTANNNNNAGACATNTTTTCAGGAANANNTNTAGAAAG  br-0.fa
39938  TCCGCATCATTCCATCAAAGTTTATAAAAATGCGACGTATAGCTAAGAAAAGACATTTTTTCAGGAAAAGCTTTAGAAAG  bur-0.fa
39938  TCCGCATCATTCCATCAAAGTTTATAAAAATGCGACGTATAGCTAAGAAAAGACATTTTTTCAGGAAAAGCTTTAGAAAG  c24.fa
39938  TCCGCATCATTCCATNNNNNNNNATAAAAATGCGACGTATAGCTANNNNNNNNNNTTNTTTCAGGNNNNNNNNNNNAAAG  col-0.fa
39938  TCCGCATCATTCCATCAAAGTTTATAAAAATGCGACGTATAGCTAANAAAAGACATTTTTTCAGGNNNNNNTTTAGAAAG  cvi-0.fa
39938  TCCGCATCATTCCANNNNNNNNNNTAAAAATGCGACGTATAGCTAAGNNNNNNNNNNNNTTCANNNNNNNNNNNAGAAAG  est-1.fa
39938  TCCGCATCATTCCATCAANGTTTATAAAAATGCGACGTATAGCTAAGAAAAGACATTTTTTCAGGAAAAGCTTTAGAAAG  fei-0.fa
39938  TCCGCATCATTCCANNNNNNNNNNNNNANATGCGACGTATAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAG  got-7.fa
39938  TCCGCATCATTCCATCNNNNNNNATAAAAATGCGACGTATAGCTAANNNNNNNNNNNNNNTCAGNNNNNNNNNNAGAAAG  ler-1.fa
39938  TCCGCATCATTCCATNNNNNNNNATAAAAATGCGACGTATAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAG  lov-5.fa
39938  TCCGCATCATTCCATCAAAGTTTATAAAAATGCGACGTATAGCTAAGAAAAGACANTTTTTCAGGAAANGNTTTAGAAAG  nfa-8.fa
39938  TCCGCATCATTCCATCAANNNNNNNNAAAATGCGACGTATAGCNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAG  rrs-10.fa
39938  TCCGCATCATTCCANNNNNNNNNNNNNNNNNNNNNNNNATAGCTNNNNNNNNACATTNTTTCANNNNNNNNNNTAGANAG  rrs-7.fa
39938  TCCGCATCATTCCATCAAANTTTATAAAAATGCGACGTATAGCTAAGNAAAGACNTTTTTTCANNNNNNNNNNNNNNNNN  sha.fa
39938  TCCGCATCATTCCANNNNNNNNNNNNNAAATGCGACGTATAGCTNNNNNNNNNNNNNNNNTCNNNNNNNNNNNNNNNNNN  tamm-2.fa
39938  TCCGCATCATTCCATCANNNNTTATAAAAATGCGACGTATAGCTAANNNNNNNNANTTTTTCAGNNNNNNNNNNNNAAAG  ts-1.fa
39938  TCCGCATCATTCCANNNNNNNNNNNNAAAATGCGACGTATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAG  tsu-1.fa
39938  TCCGCATCATTCCATCANANNTNATAAAAATGCGACGTATAGCTANNNNNNNNNANTTTTTCAGGNNNNNNNNNAGAAAG  van-0.fa
 
40018  AGGGCTCAGTGGATGCAGTTACGTATACTTAAGGTAATTTGATGGAAAAGAAAACCAATCAGATTGCATTACAATTAATA  chr1.fa
40018  AGGGCTCAGTGGATGCAGTTACGTATACTTAAGGTAATTTGATGGAAAAGAAAACCAATCAGATTGCATTACAATTAANA  bay-0.fa
40018  AGGGCTCAGTGGATGCAGTTACGTNNNNNNNNNNNNNNNNNNNNNAAAANAAAACCAATCAGNNNNNNNNNNNNNNNNNN  bor-4.fa
40018  AGGGCTCAGTGGATGCAGTTACGTANNNNNNNGGTAANNNGNTGGAAAANAAAACCAANCAGATTGCNNNNNNNNNNNNN  br-0.fa
40018  AGGGCTCAGTGGATGCAGTTACGTATACTTAAGGTAATTTGATGGAAAAGAAAACCAATCAGATTGCATTACAATTNNNN  bur-0.fa
40018  AGGGCTCAGTGGATGCAGTTACGTATACTTAAGGTAATTTGATGGAAAAGAAAACCAATCAGATTGCATTACAATTANNN  c24.fa
40018  AGGGCTCAGTGGATGCAGTTACGTANNNNNNNNNNNNNNNNNTGGAAAANAAAACCAANCANATNGNNNNNNNNNNNNNN  col-0.fa
40018  AGGGCTCAGTGGATGCAGTTACGTATACTTAAGGTAATTTGATGGAAAAGAAAACCAATCAGATTGCATTNNNNNNNNNN  cvi-0.fa
40018  AGGGCTCAGTGGATGCAGTTACGTANNNNNNNNNNNNNNNNNNGGAAAANAAAACCAATCAGATTGNNNNNNNNNNNNNN  est-1.fa
40018  AGGGCTCAGTGGATGCAGTTACGTATACTTAAGGTAATTTGATGGAAAAGAAAACCAATCAGATTGCATTACANNNNNNN  fei-0.fa
40018  AGGGCTCAGTGGATGCAGTTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
40018  AGGGCTCAGTGGATGCAGTTACGTANNNNNNNNNNNNNNNNNNNGAAAANAAAACCAATCAGATTNNNNNNNNNNNNNNN  ler-1.fa
40018  AGGGCTCAGTGGATGCAGTTANNNNNNNNNNNNNNNNNNNNNNNGAAAANAANACNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
40018  AGGGCTCAGTGGATGCAGTTACGTATACTTAAGGTAATTTGATGGAAAAGAAAACCAATCAGATTGCANNNNNNNNNNNN  nfa-8.fa
40018  AGGGCTCAGTGGATGCAGTTACGTANNNNNNNNNNNNNNNNNNNNNNNAGAAAACCAANNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
40018  AGGGCTCAGTGGATGCAGTTACGTNNNNNNNNNNNNNNNNNNNGGAAAAGAAAACCAANCAGATTGCNNNNNNNNNNNNN  rrs-7.fa
40018  NGGGCTCAGTGGATGCAGTTACGTATANTTNAGNTAATTTGATGGAAAANAAAACCAANCAGATTGCATTNNNNNNNNNN  sha.fa
40018  NNGGCTCAGTGGATGCAGTTACGTNNNNNNNNNNNNNNNNNNNNGAAAANAANACNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
40018  AGGGCTCAGTGGATGCAGTTACGNNNNNNNNNNNNNNNNTGATGGAAAAGAAAACCAANCAGATTNNNNNNNNNNNNNNN  ts-1.fa
40018  AGGGCTCAGTGGATGCAGTTACNNNNNNNNNNNNNNNNNNNNNNGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
40018  AGGGCTCAGTGGATGCAGTTACGTNNNNNNNNNNNNNNNNNNNNNAAAANAAAACCAANCAGATTGCNNNNNNNNNNNNN  van-0.fa
 
40098  AGAAAATATAATGTTCTATATTATGTTGTCAATACTTTCAGTAGTGCTTTTTAAAAATCTAGATTAATATATATTATCAA  chr1.fa
40098  AGAAAATANAANNNNCTATATTATGTTGTCAATACTTTCAGTAGTGCTTTTTAAANNNRNNNNRNNNNNNNNNNNNRNNN  bay-0.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNRNNN  bor-4.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATACTTTCAGTANNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNRNNN  br-0.fa
40098  NNNNNNNNNNNNNNNNNNNATTATGTTGTCAATACTTTCAGTAGTGCTTTTTAAANNNRNNNNRNNNNNNNNNNNNRNNN  bur-0.fa
40098  NNNNNNNNNNNNNNNNNNNATTATGTTGTCAATACTTTCAGTAGTGCTTTTTAAANNNRNNNNRNNNNNNNNNNNNRNNN  c24.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAATACTTTNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNRNNN  col-0.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAATACTTTCAGTAGTGCTTTTTAANNNNRNNNNRNNNNNNNNNNNNRNNN  cvi-0.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATACTTTCAGTNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNRNNN  est-1.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNTTGTCAATACTTTCAGTAGTGCTTTTTAANNNNRNNNNRNNNNNNNNNNNNRNNN  fei-0.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNRNNN  got-7.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATACTTTNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNRNNN  ler-1.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNRNNN  lov-5.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNGTCAATACTTTCAGTAGTGCTTTTTAAANNNRNNNNRNNNNNNNNNNNNRNNN  nfa-8.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATACTTTCANNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNRNNN  rrs-10.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTTTCAGTNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNRNNN  rrs-7.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNGTCAATACTTTCAGTAGTGCTTTTTAANNNNRNNNNRNNNNNNNNNNNNRNNN  sha.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNRNNN  tamm-2.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNRNNN  ts-1.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNRNNN  tsu-1.fa
40098  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATACTTTCAGNNNNNNNNNNNNNNNNNRNNNNRNNNNNNNNNNNNRNNN  van-0.fa
 
40178  TTGATGATAAAGAGGTTAGATGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCAACATGCTT  chr1.fa
40178  NNGATGATAAAGARGRRNGNTGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARNCNT  bay-0.fa
40178  NNNNNNNNNNNNNRGRRNGATGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCNRCARGCTT  bor-4.fa
40178  NNNNNNATNAANNRGRRAGATGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCTT  br-0.fa
40178  NNNATGATAAAGARGRRAGATGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCTT  bur-0.fa
40178  NNNNNGATAAAGARGRRAGATGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCNT  c24.fa
40178  NNNNNNNNNNNNNRGRRAGATGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCTT  col-0.fa
40178  NNNNNNATAAAGARGRRAGATGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCTT  cvi-0.fa
40178  NNNNNNNNNNNNNRGRRAGATGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCTT  est-1.fa
40178  NNNNNGATAAAGARGRRAGATGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCTT  fei-0.fa
40178  NNNNNNNNNNNNNRNRRNNATGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCTT  got-7.fa
40178  NNNNNNNNNNNNNRNRRNGNTGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCTT  ler-1.fa
40178  NNNNNNNNNNNNNRGRRNGNTGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCTT  lov-5.fa
40178  NNNNNNATAANNNRGRRAGATGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCTT  nfa-8.fa
40178  NNNNNNNNNNNNNRGRRAGATGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCTT  rrs-10.fa
40178  NNNNNNNNNNNNNRNRRAGNTGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCNT  rrs-7.fa
40178  NNNNNNNTNANNNRGRRAGNTGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCNT  sha.fa
40178  NNNNNNNNNNNNNRGRRNNNTGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCTT  tamm-2.fa
40178  NNNNNNNNNNNNNRGRRNGNTGGTTCCATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATNGCAGGCARCARNCNN  ts-1.fa
40178  NNNNNNNNNNNNNRNRRNNNNGGTTCNATCGTTACCTGAAAATAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCNT  tsu-1.fa
40178  NNNNNNNNNNNNNRGRRAGATGGTTCCATCGTTACCNNNNCNNAAGGGCCAAAGCGAAGGTGATTGCAGGCARCARGCTT  van-0.fa
 
40258  ACCAAAGCACACGAAACAGTTGCTGACGTGTACGACAGACCAAGCAAAAAGAAAAACTGCATCAAACTCGCCCTGTCAAT  chr1.fa
40258  ACCAANNCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNANRNNNNAANRNNNARRAAACTCGCCCTGRRAAT  bay-0.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNNNRNNNNNNNRNNNNRRAANCTCGCCCTGRRNNN  bor-4.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNNNRNNNNNANRNNNNRRAANCTCGCCCTGRRAAT  br-0.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNNNRNNNNNANRNNNNRRAAACTCGCCCTGRRAAT  bur-0.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNNNRNNNANANRNNCNRRAANCTCGCCCTGRRAAT  c24.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNNNRNNNNAANRNNNNRRAAACTCGCCCTGRRAAT  col-0.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNANRNNNANNNRNNCARRAAACTCGCCCTGRRAAT  cvi-0.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNANRNNNANNNRNNNARRAAACTCGCCCTGRRAAT  est-1.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNNNRNNNNNNNRNNNNRRAAACTCGCCCTGRRAAT  fei-0.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNANRNNNANNNRNNCARRNAACTCGCCCTGRRAAN  got-7.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNANRNNNNNNNRNNNNRRAANCTCGCCCTGRRNNN  ler-1.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNNNRNNNAANNRNNNNRRAAACTCGCCCTGRRAAN  lov-5.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNNNRNNNNNNNRNNCNRRNAACTCGCCCTGRRAAT  nfa-8.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCAANRANNAAANRNNCARRAANCTCGCCCTNRRNNN  rrs-10.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNANRNNNANNNRNNCNRRAANCTCGCCCTGRRAAT  rrs-7.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNNNRNNNNNNNRNNNNRRAANCTCGCCCTGRRAAT  sha.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNNNRNNNNNNNRNNNNRRAAACTCGCCCTGRRANN  tamm-2.fa
40258  ACCAAAGNRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGNNNNRNNNNNNNRNNNNRRNANCTCGCCCTGRRAAN  ts-1.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCNNNNNNNRNNNAANNRNNNNRRAAACTCGCCCTGRRNAN  tsu-1.fa
40258  ACCAAAGCRRRRRRRRRRRRTRRRRRRRRRRRRRRRAGACCAAGCNNNRNNNANANRNNCARRAANCTCGCCCTGRRAAN  van-0.fa
 
40338  TTAAACCCATAAATTAATTAAAAGATCTTTAATAATTTAGCTTATGATTAGTACAAACTATTAAACTATAAGAATAAATT  chr1.fa
40338  TTAAACCCANAAATTNNNNNNNNNNNNNNNAATAATTTAGCTTATGATTAGTACAAACTATTAAACTANAAGAATAAATT  bay-0.fa
40338  TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATT  bor-4.fa
40338  TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  br-0.fa
40338  TTAAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTTATGATTAGTACAAACTATNNNNNNNNNNGAATAAATT  bur-0.fa
40338  TTAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGATTAGTACAANNNNNNNNNNNNNNNNAANAAATT  c24.fa
40338  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT  col-0.fa
40338  TTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTANNNNNNNNNNNNNNNNNNNNNNNNNNAATT  cvi-0.fa
40338  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATT  est-1.fa
40338  TTAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTANNNNNNNNNNNNNNNNNNNNNNNNNNNATT  fei-0.fa
40338  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  got-7.fa
40338  TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  ler-1.fa
40338  TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  lov-5.fa
40338  TTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTNNNNNNNNNNNNNNNNNNNNNNNNANAAATT  nfa-8.fa
40338  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATT  rrs-10.fa
40338  TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATT  rrs-7.fa
40338  TTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATT  sha.fa
40338  TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  tamm-2.fa
40338  TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATT  ts-1.fa
40338  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT  tsu-1.fa
40338  TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  van-0.fa
 
40418  GCAAATGGCCGACAAAATAATATAATAAAATGCAATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAATGAT  chr1.fa
40418  GCAAATGGCCGACAAAANNANRNRRNNNAATGCAATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACNGACGAAARRRR  bay-0.fa
40418  GCAAATGGCCGACAAANNNNNRNRRNNNNNNNNNATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  bor-4.fa
40418  GCAAATGGCCGACAANNNNNNRNRRNNNNNNNNAATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  br-0.fa
40418  GCAAATGGCCGACAAAATANNRNRRNNNNATGCAATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  bur-0.fa
40418  GCAAATGGCCGACAAAANNNNRNRRNNNNNTGCAATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  c24.fa
40418  GCAAATGGCCGACAANNNNNNRNRRNNNNNNNNNATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  col-0.fa
40418  GCAAATGGCCGACAAAANNNNRNRRNNNNNNNCAATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  cvi-0.fa
40418  GCAAATGGCCGACAAAANNNNRNRRNNNNNNNNNATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  est-1.fa
40418  GCAAATGGCCGACAAAATNNNRNRRNNNNNNNNAATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  fei-0.fa
40418  GCAAATGGCCGACAANNNNNNRNRRNNNNNNNNNNTTAGGTTTGNGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  got-7.fa
40418  GCAAATGGCCGACAANNNNNNRNRRNNNNNNNNAATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  ler-1.fa
40418  GCAAATGGCCGACAANNNNNNRNRRNNNNNNNNNNNNNNGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  lov-5.fa
40418  GCAAATGGCCGACAANNNNNNRNRRNNNNNTGCAATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  nfa-8.fa
40418  GCAAATGGCCGACANNNNNNNRNRRNNNNNNNNAATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  rrs-10.fa
40418  GCAAATGGCCGACAAANNNNNRNRRNNNNNNNNAATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  rrs-7.fa
40418  GCAAATGGCCGACAANNNNNNRNRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGAGAAGGCCACTGACGAAARRRR  sha.fa
40418  GCAAATGGCCGACAANNNNNNRNRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGAGAAGGCCACTGACGAAARRRR  tamm-2.fa
40418  GCAAATGGCCGACAANNNNNNRNRRNNNNNNNNNNNTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  ts-1.fa
40418  GCAAATGGCCGACANNNNNNNRNRRNNNNNNNNNNNNNGGTTTGNGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  tsu-1.fa
40418  GCAAATGGCCGACAANNNNNNRNRRNNNNNNNNAATTAGGTTTGAGAGGACTAACCCGAGAAGGCCACTGACGAAARRRR  van-0.fa
 
40498  CGACCATTAGCCTAAACGTTATTTGTGGTCTTGTTTTCCTATTTAACAACAATAGAAATTCTTTAGAAAATTCATTAAAA  chr1.fa
40498  RRRRRRRRRRRRRRAACGTTATTTGTGNRNTTGTTTTCCTATTTAACAACAATAGAAATTCTTTAGAAAATTCATTAAAA  bay-0.fa
40498  RRRRRRRRRRRRRRAACGTTATTTGNNNRNNNGTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
40498  RRRRRRRRRRRRRRAACGTTATTTGNGNRNNTGTTTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
40498  RRRRRRRRRRRRRRAACGTTATTTGTGGRNTTGTTTTCCTATTTAACAACAATANANNNNNNNTNNNNNNNNNNNNNNNN  bur-0.fa
40498  RRRRRRRRRRRRRRAACGTTATTTGTGGRNTTGTTTTCCTATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
40498  RRRRRRRRRRRRRRAACGTTATTTGNNNRNNNGTTTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
40498  RRRRRRRRRRRRRRAACGTTATTTGTGNRNTTGTTTTCCTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
40498  RRRRRRRRRRRRRRAACGTTATTTGNNNRNNNGTTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
40498  RRRRRRRRRRRRRRAACGTTATTTGTNNRNTTGTTTTCCTATTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
40498  RRRRRRRRRRRRRRNNNGTTATTNGNNNRNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
40498  RRRRRRRRRRRRRRAACGTTATTTGNNNRNNNGTTTTCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
40498  RRRRRRRRRRRRRRANCGTNATTTGNNNRNNNGTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
40498  RRRRRRRRRRRRRRAACGTTATTTGTGNRNTTGTTTTCCTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
40498  RRRRRRRRRRRRRRAACGTTATTTGTGNRNTTGTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
40498  RRRRRRRRRRRRRRANNGTTATTTGNGNRNNNGTTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
40498  RRRRRRRRRRRRRRAACGTTATTTGNNNRNNTGTTTTCCTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
40498  RRRRRRRRRRRRRRNACGTTATTTGNN<