Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 45503 - 46789


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  chr1.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  bay-0.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCNGCAAAAGANNNNNNNNNNANN  bor-4.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  br-0.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  bur-0.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  c24.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  col-0.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  cvi-0.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  est-1.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  fei-0.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  got-7.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  ler-1.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  lov-5.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  nfa-8.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGNTTGTGATAA  rrs-10.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGNNNNNNNNNANA  rrs-7.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  sha.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  tamm-2.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  ts-1.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  tsu-1.fa
45503  TTACGACTCACTCTTCTCGATACCTTCTCTGACGATGATTCTGCGACCTTCATATTGCTGCAAAAGAGAGATTGTGATAA  van-0.fa
 
45583  AGCCAGAGAGCAGTAGAAGAAGTTTCCTCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATA  chr1.fa
45583  AGCCAGAGAGCAGNAGAAGAAGTTTCCTCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATA  bay-0.fa
45583  AGCCAGAGAGNAGTAGAAGAAGTTTCCTCAAGCAANNNNNNNNNNNNNNNNNNCGAACTTAACTGTTCCATTGAATGATA  bor-4.fa
45583  AGCCAGAGAGCAGTAGAAGAAGTTTCCTCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATA  br-0.fa
45583  AGCCAGAGAGCAGTAGAAGAAGTTTCCTCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATA  bur-0.fa
45583  AGCCAGAGAGCAGNAGAAGAAGTTTCCTCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATA  c24.fa
45583  AGCCAGAGAGCAGNAGAAGAAGTTTCCTCAAGCAAGATTNTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATA  col-0.fa
45583  AGCCAGAGAGCAGTAGAAGAAGTTTCCTCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATA  cvi-0.fa
45583  AGCCAGAGAGCAGTAGAAGAAGTTTCCTCAAGCANGNNTNTNNNNNNNGATAACGAACTTAACTGTTCCATTGAATGATA  est-1.fa
45583  AGCCAGAGAGCAGNAGAAGAAGTTTCCTCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATA  fei-0.fa
45583  AGCCAGAGAGCAGNAGAAGAAGTTTCCTCAAGCAANNNNNNNNNNNNNNNNNNNNAACTTAACTGTNNNNNNNAATGATA  got-7.fa
45583  AGCCAGAGAGCAGNAGAAGAAGTTTCCTCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATA  ler-1.fa
45583  AGCCAGAGAGCAGTNGAAGAAGTTTCCTCAAGCAAGNNNNNNNNNNNNNNNNNNNNNNTTAACTGTTCCNNTGAATGATA  lov-5.fa
45583  AGCCAGAGAGCAGTAGAAGAAGTTTCCTCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATA  nfa-8.fa
45583  AGCCAGAGAGCAGTAGAAGAAGTTTCCTCAAGCNAGNTTNTNNTNATNGANAACGAACTTAACTGTTCCATTGAATGATA  rrs-10.fa
45583  AGCCAGAGAGCAGNAGAAGAAGTTTCCTCAAGCAAGATTNTNNNNNNNGATAACGAACTTAACTGTTCCATTGAATGATA  rrs-7.fa
45583  AGCCAGAGAGCAGNAGAAGAAGTTTCCTCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATA  sha.fa
45583  AGCCAGAGAGCAGNAGAAGAAGTTTCCTCAAGCAAGANNNNNNNNNNNNNTAACGAACTTAACTGTTCCATTGAATGATA  tamm-2.fa
45583  AGCCAGAGAGCAGNAGAAGAAGTTTCCTCAAGCAAGATTCNTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATA  ts-1.fa
45583  AGCCAGAGAGCAGNAGAAGAAGTTTCCTCAAGCNNNNNNNNNNNNNNNNNNNNNNNACTTAACTGTNNNNNNGAATGATA  tsu-1.fa
45583  AGCCAGAGAGCAGTAGAAGAAGTTTCCTCAAGCAAGATTNTTNTTNTNNANAACGAACTTAACTGTTCCATTGAATGATA  van-0.fa
 
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAAGAAAGGCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  chr1.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAANANNGNCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  bay-0.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAANNNNNGCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  bor-4.fa
45663  AAGCCGCATCACGTTCTTCATNNNNNNNNNAAGAAANANNGNCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  br-0.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAAGAAAGGCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  bur-0.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAAGAAAGGCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  c24.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAANNNNNNNNAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  col-0.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAANAAAGNCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  cvi-0.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAANAAAGGCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  est-1.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAAGANNNNNNAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  fei-0.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAANANNGNCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  got-7.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAANNNNNNNNAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  ler-1.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAANNNNNNNCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  lov-5.fa
45663  AAGCCGCATCACGNTCTTCATNNNNNNNNNAAGAAAGAAAGNCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  nfa-8.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGANNNNNNNNNAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  rrs-10.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAANNNNNNNNAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  rrs-7.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAANANNGNCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  sha.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGNNNNNNNNNNNAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  tamm-2.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAANNNNNNNNAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  ts-1.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGNNNNNNNNNNNNAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  tsu-1.fa
45663  AAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAANNNNNGCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAAC  van-0.fa
 
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  chr1.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  bay-0.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  bor-4.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  br-0.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  bur-0.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  c24.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  col-0.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  cvi-0.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  est-1.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  fei-0.fa
45743  ACTNTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  got-7.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGNAGATTTCC  ler-1.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  lov-5.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  nfa-8.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  rrs-10.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  rrs-7.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  sha.fa
45743  ACTCNCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  tamm-2.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  ts-1.fa
45743  ANNNNNNTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  tsu-1.fa
45743  ACTCTCGTGCTTACGATTGTGCCAAACTTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCC  van-0.fa
 
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCAGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  chr1.fa
45823  GACATNGACCTTGTGTTGGCTTTCGTACATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  bay-0.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRNNATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  bor-4.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  br-0.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  bur-0.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  c24.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  col-0.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  cvi-0.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRGNATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  est-1.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACNTCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  fei-0.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRNNNNNTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTNTTC  got-7.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRGNATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  ler-1.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRNNNTCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  lov-5.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  nfa-8.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  rrs-10.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRNNATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  rrs-7.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  sha.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATNRNNNTCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  tamm-2.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRNNNTCTTCTTTGGAGTTGAGTTCAAGNCTTCAGGGTTTCTTCTTGTTC  ts-1.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACNNNRNNNNCTTCTTTGGNGTTGAGTTCAAGACTTCAGGGTTTCNTCTTNTTC  tsu-1.fa
45823  GACATAGACCTTGTGTTGGCTTTCGTACATCRGNATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTC  van-0.fa
 
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCTTCATATATAGCAACAAAACCAAAGCA  chr1.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATNNNNNNACCACCTACTTCCTTCATATATAGCAACAAAACCAAANCA  bay-0.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCNNNNNNNNNNNNNACAAAACCAAAGCA  bor-4.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCNTNNNNNNNNNNAACAAAACCAAANCA  br-0.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCTTCATATATAGCAACAAAACCAAAGCA  bur-0.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCTTCATATATNGCAACAAAACCAAAGCA  c24.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCTTCATATANAGCAACAAAACCAAANCA  col-0.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCTTCATATATAGCAACAAAACCAAAGCA  cvi-0.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCTNNNNNNNNNNNAACAAAACCAAANCA  est-1.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCTTCATATATAGCAACAAAACCAAAGCA  fei-0.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTNNNNNNNNNNNNNNNNACAAAACCAAANCA  got-7.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCTTCATATATNGCAACAAAACCAAAGCA  ler-1.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTNNNNNNNNNNNNGCAACAAANCCAAAGCA  lov-5.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCTTCATNNNNNGCAACAAAACCAAAGCA  nfa-8.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCTNNNNNNNNNNCAACAAAACCAAAGCA  rrs-10.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCNNNNNNNNNNNNNACAAAACCAAAGCA  rrs-7.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCTTCATANNNNNNNACAAAACCAAAGCA  sha.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCNNNNNNNNNNNNAACAAAACCAAANNN  tamm-2.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCTTCANNNNNNNNAACAAAACCNAANCA  ts-1.fa
45903  CTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTNNNNNNNNNNNNNNNNCAAAACCNNNNNN  tsu-1.fa
45903  CTGGATTCATGTNNNNNNNNTACCTAACCCGCATTTCCCGACCACCTACTTCCTTCANNNNNAGCAACAAAACCAAAGCA  van-0.fa
 
45983  CTCAACTTTACACTCAACCAGAAGAAAGATAGACTTGTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGAAGCA  chr1.fa
45983  CTCAACTTTACACTCAACCAGAAGAAAGATAGACTTNTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  bay-0.fa
45983  CTCAACTTTACACTCAACCAGAANNNNNNNNNNNNNNNTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGAAGCA  bor-4.fa
45983  CTCAACTTTACACTCAACCAGAANNNNNNNNNNNNNNTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  br-0.fa
45983  CTCAACTTTACACTCAACCAGAAGAAAGATAGACTTGTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGAAGCA  bur-0.fa
45983  CTCAACTTTACACTCAACCAGAAGAAANNNNNNNTTGTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  c24.fa
45983  CTCAACTTTACACTCAACCAGAAGNNNNNNNNNNNNGTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  col-0.fa
45983  CTCAACTTTACACTCAACCAGAAGAAANNNNNNNTTNTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  cvi-0.fa
45983  CTCAACTTTACACTCAACCAGNNNNNNNNNNNNNNNNTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  est-1.fa
45983  CTCAACTTTACACTCAACCAGAAGAAAGATNNNNNNNTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  fei-0.fa
45983  CTCAACTTTACACTCANNNNNNNNNNNNNNNNNNNNNNNNNTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  got-7.fa
45983  CTCAACTTTACACTCAACCAGANNNNNNNNNNNNNNGTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  ler-1.fa
45983  CTCAACTTTACACTCAACCAGNNNNNNNNNNNNNNNNNNNTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  lov-5.fa
45983  CTCAACTTTACACTCAACCAGAAGAAANNNNNNNTTGTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  nfa-8.fa
45983  CNCAACTTTACACTCAACCNNNNNNNNNNNNNNNNNNNNTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  rrs-10.fa
45983  CTCAACTTTACACTCAACCAGAANNNNNNNNNNNNNNTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGAAGCA  rrs-7.fa
45983  CTCAACTTTACACTCAACCAGAAGAAANNNNNNNNTGTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  sha.fa
45983  NTCAACTTTACACTCAACCAGAAGNNNNNNNNNNNNNNNNTTTGGTTTCCCGGGCTCTTACNGTTCCANCAAGAGNAGCA  tamm-2.fa
45983  CTCAACTTTACACTCAACCAGAAGANNNNNNNNNNNNNNTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  ts-1.fa
45983  CTCAACTTTACACTCAANNNNNNNNNNNNNNNNNNNNNNNTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  tsu-1.fa
45983  CTCAACTTTACACTCAACCAGAAGAAANNNNNNNNNNNTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCA  van-0.fa
 
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  chr1.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  bay-0.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  bor-4.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  br-0.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  bur-0.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  c24.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  col-0.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  cvi-0.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  est-1.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  fei-0.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  got-7.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  ler-1.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  lov-5.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  nfa-8.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  rrs-10.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  rrs-7.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  sha.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  tamm-2.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  ts-1.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  tsu-1.fa
46063  ATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGA  van-0.fa
 
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGT  chr1.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGT  bay-0.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCNNNNNNNCANAANAGTAACCAGT  bor-4.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCATATANTCAAAAGAGTAACCAGT  br-0.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGT  bur-0.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGT  c24.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGT  col-0.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGT  cvi-0.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCNNNNNNNNNNAANAGTAACCAGT  est-1.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGT  fei-0.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCAGT  got-7.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATNNNNNNNNNNNNNNNNNNNACCAGT  ler-1.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCNNNNNNNNNNNNNNNNNNCCAGT  lov-5.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCATATACNCAAAAGAGTAACCAGT  nfa-8.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGT  rrs-10.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCNNNNNNNNNNNNNNGTAACCAGT  rrs-7.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCATATNCTCAAAAGAGTAACCAGT  sha.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGNCAATCATCCATANNNNNNNNNNNNNNNCCAGT  tamm-2.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCNTCCATNNNNNNNNNNNNNTAACCAGT  ts-1.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
46143  TACCTGCAACATCATTTCCAAGCAATGCACACCTCTCACTATACTTGTCAATCATCCANNNNNTCAAAAGAGTAACCAGT  van-0.fa
 
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTAAGTATTTTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTA  chr1.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTAAGTATTTTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTA  bay-0.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCNNNNNNNNNNNNNNNNNNATTGTGGATGATCTTTGAATNNNCNAAGCTA  bor-4.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTAAGNNNNNNNNNATTACATTGTGGATGATCTTTGAATTTTCAAAGCTA  br-0.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTAAGTATTTTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTA  bur-0.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTAAGTATTTTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTA  c24.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTANNNNNNNNNNNNNNNNNNTGTGGATGATCTTTNNNNNNTCAAAGCTA  col-0.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTAAGTATTTTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTA  cvi-0.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCNNNNNNNNNNNNNNNNNNATTGTGGATGATCTTTNNNNNNNNNNNGCTA  est-1.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTAAGTATTTTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTA  fei-0.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAANNNNNNNNNNNNNNNNNNNNNNNGTGGATGATCTTNNNNNNNNNNNNNNNN  got-7.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTNNNNNNNNNNNNNNNNNNNNGTGGATGATCTTTNNNNNNNNAAAGCTA  ler-1.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGNNNNNNNNNNNNNNNNNNNNNNNNGGATGATCNNNNNNNNNNNNNNNNNN  lov-5.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTAAGTATTNTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTA  nfa-8.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTAANNNNNNNNNNNNNNCATTGTGGATGATCTTTGANNNNNNNNNGCTA  rrs-10.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTAANNNNNNNNNNNNNNNATTGTGGATGATCTTTGANNNNNNNAANCTN  rrs-7.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTAAGTATTTTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTA  sha.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCNNNNNNNNNNNNNNNNNNNNNGTGGATGATCTTNNNNNNNTCNNNNNTA  tamm-2.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTNNNNNNNNNNNNNNNNCATTGTGGATNATCTTTNNNNNNNCAAAGCTA  ts-1.fa
46223  NCGTTTGATTCGTCTTGATGGAACTCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCNNNNNNNNNNNNNNNNNN  tsu-1.fa
46223  ACGTTTGATTCGTCTTGATGGAACTCAAAGCTAAGNNNNNNNNAATTNCATTGTNNNNNNNNNNNNNNNNNNNNNAGCTA  van-0.fa
 
46303  AGTTGAAAGAGTAAAACTTTGAATTTTCATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACA  chr1.fa
46303  AGTTGAAAGAGTAAAACTTTGAATTTTCATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACA  bay-0.fa
46303  AGNNNNNNNNNNNNNNNNNNNNNNNNTCATAAAGGCATTGTAGGATCAATCAAATCTGGANNNNNNNNNNTNNNNNNNNN  bor-4.fa
46303  AGTTGAAANNNNNNNACTNNNNNTTTTCATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACA  br-0.fa
46303  AGTTGAAAGAGTAAAACTTTGAATTTTCATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGNNNTNNNNNTACA  bur-0.fa
46303  AGTTGAAAGAGTAAAACTTTGAATTTTCATAAAGGCATTGTAGGATCAATCAAATCTGGATAANNNNNNNTNNNNNNNCA  c24.fa
46303  AGTTNNNNNNNNNNNNNNNNNNATTTTCATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACA  col-0.fa
46303  AGTTGAAAGAGTAAAACTTTGAATTTTCATAAAGGCATTGTAGGATNNNNNNGNNNNNNNNNNNNNNNNNTNNNNNNNCA  cvi-0.fa
46303  AGTTGANNNNNNNNNNNNNNNNNNNNTCATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACA  est-1.fa
46303  AGTTGAAAGAGTAAAACTTTGAATTTTCATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGNNNNNNTNNNNCNACA  fei-0.fa
46303  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAGGCATTGTAGGATCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
46303  AGTTNNNNNNNNNNNNNNNNGNNNNNTCATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACA  ler-1.fa
46303  NNNNNNNNNNNNNNNNNNNNNNNNNTTCATAAAGGCATTGTAGGATCAATCAAATNTNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
46303  AGTTGAAAGANTAAAACTTTGAATTTTCATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACA  nfa-8.fa
46303  AGTTGAAANNNNNNNACTTTGNATTTTCATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACA  rrs-10.fa
46303  AGTTGNNNNNNNNNNNNNNNNNNNNNNCATAAAGGCATTGTAGGATCAATCAAATCTGGATANNNNNNNNTNNNNNNNNN  rrs-7.fa
46303  AGTTGANANAGTAAAACTTTGAATTTTCATAAAGGCATTGTAGGATCAATCAAATCTGGATANNNNNNNNTNNNNNNNNN  sha.fa
46303  AGTTGAANNNNNNNNNNNNNNNNNTTTCATAAAGGCATTGTAGGATCAATCAAATCTGGANNNNNNNNNNTNNNNNNNNN  tamm-2.fa
46303  AGTTGANNNNNNNNNNNTTTGAATTTTCATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACA  ts-1.fa
46303  NNNNNNNNNNNNNNNNNNNNNNNNNNNCATAAAGGCATTGTAGGATCAATCAAATCTNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
46303  ANTTGAANNNNNNNNNCNNNNNNNTTTCATAAAGGCATTGTAGGATCAATCAAATCTGNNNNNNNNNNNNTNNNNNNNNN  van-0.fa
 
46383  GAGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  chr1.fa
46383  GAGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  bay-0.fa
46383  NNGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  bor-4.fa
46383  GAGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTANCTTCTAGGGATATTACACACGTAGAG  br-0.fa
46383  GAGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  bur-0.fa
46383  GAGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  c24.fa
46383  GAGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  col-0.fa
46383  GAGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  cvi-0.fa
46383  GAGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  est-1.fa
46383  GAGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  fei-0.fa
46383  NNNNTTNCAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  got-7.fa
46383  GAGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  ler-1.fa
46383  NNNNTTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  lov-5.fa
46383  GAGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  nfa-8.fa
46383  GAGANTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  rrs-10.fa
46383  NNGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  rrs-7.fa
46383  GAGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  sha.fa
46383  NNNATTACAGTTCCAAAAGGCTGAAACANGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  tamm-2.fa
46383  GAGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  ts-1.fa
46383  NNNNNTNCAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCNNNNNNGGATATTACACACGTAGAG  tsu-1.fa
46383  NAGATTACAGTTCCAAAAGGCTGAAACATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAG  van-0.fa
 
46463  CTCGCAAGGTCTCGGTTTCTTTACTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTTAACTA  chr1.fa
46463  CTCGCAAGGTCTCGGTTTCTTTACTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGGTTNTGCTTCTCCTTNNNRRR  bay-0.fa
46463  CTCGCAAGGTCTCGGTTTCTTTACTGGTTCTGCTTTGGAGACGACACTATCTTTNTNNGNTTCTGCTTCTCNTNNNNRRR  bor-4.fa
46463  CTCGCAAGGTCTCGGTTTCTTTACTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTNNNNRRR  br-0.fa
46463  CTCGCAAGGTCTCGGTTTCTTTACTGGTTCTGCTTTAGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTTNNRRR  bur-0.fa
46463  CTCGCAAGGTCTCGGTTTCTTTACTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRR  c24.fa
46463  CTCGCAAGGTCTCGGTTTCTTTNCTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRR  col-0.fa
46463  CTCGCAAGGTCTCGGTTTCTTTACTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRR  cvi-0.fa
46463  CTCGCAAGGTCTCGGTTTCTTTACTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTNNNNRRR  est-1.fa
46463  CTCGCAAGGTCTCGGTTTCTTTACTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRR  fei-0.fa
46463  CTCGCAAGGTCTCGGTTTCTTTNNNNNNNNNNNNNNANNNNNNNNNNNNTCTTTNNNNNNNTNTGCTTCTCCNNNNNRRR  got-7.fa
46463  CTCGCAAGGTCTCGGTTTCTTTACTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRR  ler-1.fa
46463  CTCGCAAGGTCTCGGTTTCTTTACTGNNNNNNNNTNANNNNNNNNNNNNNNNNNNNNGGGTTCTGCTTCTCNNNNNNRRR  lov-5.fa
46463  CTCGCAAGGTCTCGGTTTCTTTACTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRR  nfa-8.fa
46463  CTCGCAAGGTCTCGGTTTCTTTNCTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGNNNNNNNTTCTCCTTNNNRRR  rrs-10.fa
46463  CTCGCAAGGTCTCGGTTTCTTTNCTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTNNNNRRR  rrs-7.fa
46463  CTCGCAAGGTCTCGGTTTCTTTNCTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRR  sha.fa
46463  CTCGCAAGGTCTCGGTTTCTTTACTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGNTTCTGCTTCTNNNNNNNRRR  tamm-2.fa
46463  CTCGCAAGGTCTCGGTTTCTTTACTGGTTCTGCTTTGGAGACGACACTATCTTNATTGGGTTCTGCTTCTNNNNNNNRRR  ts-1.fa
46463  CTCGCAAGGTCTCGGTTTCTNNNNNNGTTCTGCTTTGGAGACGACACTATCNNNNNNNGNNTNTGCTTCNNNNNNNNRRR  tsu-1.fa
46463  CTCGCAAGGTCTCGGTTTCTTTACTGGTTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRR  van-0.fa
 
46543  CTTCTTCTTCTTTTTCTTCATCGAGAACTGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  chr1.fa
46543  RRRRRNRNNNRNRRNNNTCATCGAGAACTGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  bay-0.fa
46543  RRRRRNRNNNRNRRNNNTCATCNAGAACTGATANNNNNNNNGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  bor-4.fa
46543  RRRRRNRNNNRNRRNNNTCATCGAGAACTGATAANNNNNNAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  br-0.fa
46543  RRRRRNRNNNRNRRTCTTCATCGAGAACTGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  bur-0.fa
46543  RRRRRNRNNNRNRRNNNNNNNTNNNNNNNGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  c24.fa
46543  RRRRRNRNNNRNRRNNNTCATCGAGAACTGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  col-0.fa
46543  RRRRRNRNNNRNRRNCNTCATCGAGAACTGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  cvi-0.fa
46543  RRRRRNRNNNRNRRNNNNNNNNNNGAACTGATAANNNNNNAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  est-1.fa
46543  RRRRRNRNNNRNRRNNNNNNNTNNNNNNTGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  fei-0.fa
46543  RRRRRNRNNNRNRRNNNTCNNNNNNNACTGATNNNNNNNNNNNNNNNNNNTTGATTTGAAGTGGTTGAGCTACAAAGGGA  got-7.fa
46543  RRRRRNRNNNRNRRNNNTCATCGAGAACTGATAATNCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  ler-1.fa
46543  RRRRRNRNNNRNRRNNNTCATCGNGAACTGATAANNNNNAAGNNNNNNNNTTGATTTGAAGTGGTTGAGCTACAAAGGGA  lov-5.fa
46543  RRRRRNRNNNRNRRNNTTCATCGAGAACTGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  nfa-8.fa
46543  RRRRRNRNNNRNRRNNTTCATCGAGAACTGATNNNNNNNAAGAAGNGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  rrs-10.fa
46543  RRRRRNRNNNRNRRNNTTCATCGAGAACTGATAATTCNGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  rrs-7.fa
46543  RRRRRNRNNNRNRRNNNTCATCNNNNNNNNNNGNNNNNNNNNAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  sha.fa
46543  RRRRRNRNNNRNRRNNNTNANNNNNNNNNNNNGNNNNNNNNNNNNNNACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  tamm-2.fa
46543  RRRRRNRNNNRNRRNNNNCANCGNGAACTGATANNNNNNAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  ts-1.fa
46543  RRRRRNRNNNRNRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTTGAAGTGGTTGAGCTACAAAGGGA  tsu-1.fa
46543  RRRRRNRNNNRNRRNNTTCATCGAGAACTGATAATTNTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGA  van-0.fa
 
46623  CGAGAAAGAGAAGAGTGATGAAAAGAATTGGAAGAAGAGAATTGAAGTTTCAGAGATTCTAAGTAAGAGTAAGAAGAAGA  chr1.fa
46623  CGAGAAAGNNNNNNNRGNNGAAAANANRNGNAAGAAGAGAATTGNAGTTTCAGAGATTCTAAGTAAGAGNAAGAAGAAGA  bay-0.fa
46623  CGAGAANGNNNNNNNRNNNGAANNNNNRNNNNNNNNNNNNNNNGAAGTTTCAGAGANNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
46623  CGAGNNNNNNNNNNNRNNNGAANNNNNRNNNNNNNNNNNAATTGNAGTTTCAGAGATTCNNNNNNNNNNNNNNNNGAANN  br-0.fa
46623  CGAGAAAGAGAAGNGRGNTGAAAAGAARTGNAAGAAGAGAATTGNAGTTTCAGAGATTCTAAGTAAGAGNNNNNNNNNNN  bur-0.fa
46623  CGAGAAAGNGNNNNNRNNNGAAAAGANRNNNAAGAAGAGAATTGNAGTTTCAGAGATTCTAAGTAANNNNNNNNNGNNNN  c24.fa
46623  CGANAAAGANNNNNNRNNNGAAAANNNRNNNNNGNNNNNNATTGAAGTTTCAGAGATTCNNNNNNNNNNNNAGANNNNNN  col-0.fa
46623  CGAGANNNNNNNNNNRNNNGAAAANNNRNNNAAGNNNNNAATTGAAGTTTCAGAGATTCTAAGTAANNNNNNGAAGAANN  cvi-0.fa
46623  CGNNNNNNNNNNNNNRNNNGAAAANNNRNNNNNNNNNNNAATTGAAGTTTCAGAGATTCTNNNNNNNNNNNNNNNNNNNN  est-1.fa
46623  CGAGAAAGNNNNNNNRNNNGAAAANNNRNNNNNGAAGAGAATTGNAGTTTCNGAGATTCTAAGTNNNNNNNNGAAGANGA  fei-0.fa
46623  CGAGANNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANAANN  got-7.fa
46623  CGAGANNNNNNNNNNRNNNGAAAANNNRNNNNNNNNNNNAATTGANGTTTCAGAGATTCNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
46623  CGAGNNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
46623  CGAGAAANNNNNNNNRNNNGAAAANNNRNNNANGAAGAGAATTGNAGTTTCAGAGATTCNAAGTAAGANNNNNAAGAAGA  nfa-8.fa
46623  CGAGAAAGANNNNNNRNNNNNNNNNNNRNNNAAGNNNNNNNNNGAAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
46623  CGAGANNNNNNNNNNRNNNNAAANNNNRNNNNNNNNNNNNNNNNNAGTTTCAGAGATTCNNNNNNNNNNNNNNANNNNGN  rrs-7.fa
46623  CGAGNNNNNNNNNNNRNNNNNNANNNNRNNNNNNNNNNNNNNNGNAGTTTCAGAGATTCTAAGTANNNNNNNNNNNNNNN  sha.fa
46623  CGAGAAAGNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNTNCAGAGATTCTANNNNNNNNNNNNANGNNNN  tamm-2.fa
46623  CGAGANNNNNNNNNNRNNNNNNNNNNNRNNNNNGANNNNNNNNNNNGTTTCAGAGATTCTAANNNNNNNNNNNNNNNNNN  ts-1.fa
46623  CGANNNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
46623  CGAGAAAGANNNNNNRNNNGAAANNNNRNNNNNNNNNNNNATTGNAGTTTCAGAGANNNNNNNNNNNNNNNNNAAGANNN  van-0.fa
 
46703  AGAGATTAGGGTTTTGTATTTGGGAATTGCATTGTGAGACGATCGAGAAGAAGAAGATAAGGGAATTGCGAAGCAGGAGG  chr1.fa
46703  ANNNRTTNGGGTTTNNRNNTTGGGAATTGCATTGTGAGACGATNRNGAAGAAGAAGATAAGGGAATTGCGAAGCAGGAGG  bay-0.fa
46703  NNNNRNNNNNNTTNNNRNNNTGGGAATTGCATTGTGAGACGATCRNGNAGAANNNNNNNAGGGAATTGCGAAGCAGGAGG  bor-4.fa
46703  NNNNRNNNGGGTTNNNRNNNTGGGAATTGCATTGTGAGACGATNRAGAAGAAGANNNNAAGGGAATTGCGAAGCAGGAGG  br-0.fa
46703  NNNNRTNNGGGTTTNGRNNTTGGGAATTGCATTGTGAGACGATCRAGAAGAAGANGATAAGGGAATTGCGAAGCAGGAGG  bur-0.fa
46703  NNNNRTTNGGGTTTNNRNNTTGGGAATTGCATTGTGAGACGANNRAGAAGAAGAAGATAAGGGAATTGCGAAGCAGGAGG  c24.fa
46703  NNNNRNNNNNGTTNNNRNTNTGGGAATTGCATTGTGAGACGATCRAGAAGAAGNNNNNAAGGGAATTGCGAAGCAGGAGG  col-0.fa
46703  NNNNRNNNGGGTTNNNRNNNTGGGAATTGCATTGTGAGACGANCRAGAAGAAGAAGATAAGGGAATTGCGAAGCAGGAGG  cvi-0.fa
46703  NNNNRNNNNNNNNNNNRNNNTGGGAATTGCATTGTGAGACGNTCRAGAAGAAGAAGATAAGGGAATTGCGAAGCAGGAGG  est-1.fa
46703  NNNNRNNNGGGTTNNNRNNTTGGGAATTGCATTGTGAGACGNNNRNGNAGAAGAAGATAAGGGAATTGCGAAGCAGGAGG  fei-0.fa
46703  NNNNRNNNNNNNNNNNRNNNNNNNAATTGCATTGTGAGACGATCRAGAAGAAGANNNTAAGGGAATTGCGAAGCAGGAGG  got-7.fa
46703  NNNNRNNNNGGTTNNNRNNNTGGGAATTGCATTGTGAGACGATNRNGNAGANNNNNNNAAGGGANTTGCGAAGCAGGAGG  ler-1.fa
46703  NNNNRNNNNNNNNNNNRNNNTGGGAATTGCATTGTGAGACGANCRNGAAGNNNNNNNNNNGGGAATTGCGAAGCAGGAGG  lov-5.fa
46703  NNNNRNNNGGGTTNNNRNNNTGGGAATTGCATTGTGAGACGANNRAGAAGAAGAAGNTAAGGGAATTGCGAAGCAGGAGG  nfa-8.fa
46703  NNNNRNNNNNNNTNNNRNTTTGGGAATTGCATTGTGAGACGATCRAGAAGAAGANGATAAGGGAATTGCGAAGCAGGAGG  rrs-10.fa
46703  NNNNRNNNGGGTTNNNRNNNTGGGAATTGCATTGTGAGACGATCRAGAAGAAGNNNNNNNGGGAATTGCGAAGCAGGAGG  rrs-7.fa
46703  NNNNRNNNGGGTTNNNRNNNTGGGAATTGCATTGTGAGACGANNRNGNAGAAGAAGATAAGGGAATTGCGAAGCAGGAGG  sha.fa
46703  NNNNRNNNNNNNNNNNRNNNNGGGAATTGCATTGTGAGACGANNRAGAAGNNNNNNNNNAGGGAATTGCGAAGCAGGAGG  tamm-2.fa
46703  NNNNRNNNNNGTTNNNRNNNNGGGAATTGCATTGTGAGACGNNNRNGNAGAAGNNNNNNNGGGAATTGCGAAGCAGGAGG  ts-1.fa
46703  NNNNRNNNNNNNNNNNRNNNNNGGAATTGCATTGTGAGACGATNRNNNAGNNNNNNNNNNNNGAATTGCGAAGCAGGAGG  tsu-1.fa
46703  NNNNRNNNGGGTTNNNRNNTTGGGAATTGCATTGTGAGACGATCRAGAAGAAGAAGNTAAGGGAATTGCGAAGCAGGAGG  van-0.fa
 
46783  CCGCCAT   chr1.fa
46783  CCGCCAT   bay-0.fa
46783  CCGCCAT   bor-4.fa
46783  CCGCCAT   br-0.fa
46783  CCGCCAT   bur-0.fa
46783  CCGCCAT   c24.fa
46783  CCGCCAT   col-0.fa
46783  CCGCCAT   cvi-0.fa
46783  CCGCCAT   est-1.fa
46783  CCGCCAT   fei-0.fa
46783  CCGCCAT   got-7.fa
46783  CCGCCAT   ler-1.fa
46783  CCGCCAT   lov-5.fa
46783  CCGCCAT   nfa-8.fa
46783  CCGCCAT   rrs-10.fa
46783  CCGCCAT   rrs-7.fa
46783  CCGCCAT   sha.fa
46783  CCGCCAT   tamm-2.fa
46783  CCGCCAT   ts-1.fa
46783  CCGCCAT   tsu-1.fa
46783  CCGCCAT   van-0.fa
 
visited.