Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 45610 - 46789


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
45610  TCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  chr1.fa
45610  TCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  bay-0.fa
45610  TCAAGCAANNNNNNNNNNNNNNNNNNCGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  bor-4.fa
45610  TCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCATNNNNNN  br-0.fa
45610  TCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  bur-0.fa
45610  TCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  c24.fa
45610  TCAAGCAAGATTNTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  col-0.fa
45610  TCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  cvi-0.fa
45610  TCAAGCANGNNTNTNNNNNNNGATAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  est-1.fa
45610  TCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  fei-0.fa
45610  TCAAGCAANNNNNNNNNNNNNNNNNNNNAACTTAACTGTNNNNNNNAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  got-7.fa
45610  TCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  ler-1.fa
45610  TCAAGCAAGNNNNNNNNNNNNNNNNNNNNNNTTAACTGTTCCNNTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  lov-5.fa
45610  TCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGNTCTTCATNNNNNN  nfa-8.fa
45610  TCAAGCNAGNTTNTNNTNATNGANAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  rrs-10.fa
45610  TCAAGCAAGATTNTNNNNNNNGATAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  rrs-7.fa
45610  TCAAGCAAGATTCTTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  sha.fa
45610  TCAAGCAAGANNNNNNNNNNNNNTAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  tamm-2.fa
45610  TCAAGCAAGATTCNTTTTATGGATAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  ts-1.fa
45610  TCAAGCNNNNNNNNNNNNNNNNNNNNNNNACTTAACTGTNNNNNNGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  tsu-1.fa
45610  TCAAGCAAGATTNTTNTTNTNNANAACGAACTTAACTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTG  van-0.fa
 
45690  TAAAAGAAAGAAAGGCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  chr1.fa
45690  TAAAAGAAANANNGNCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  bay-0.fa
45690  TAAAAGAAANNNNNGCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  bor-4.fa
45690  NNNAAGAAANANNGNCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  br-0.fa
45690  TAAAAGAAAGAAAGGCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  bur-0.fa
45690  TAAAAGAAAGAAAGGCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  c24.fa
45690  TAAAAGAAANNNNNNNNAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  col-0.fa
45690  TAAAAGAAANAAAGNCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  cvi-0.fa
45690  TAAAAGAAANAAAGGCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  est-1.fa
45690  TAAAAGAAAGANNNNNNAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  fei-0.fa
45690  TAAAAGAAANANNGNCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTNTCGTGCTTACGATTGTGCCAAAC  got-7.fa
45690  TAAAAGAAANNNNNNNNAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  ler-1.fa
45690  TAAAAGAANNNNNNNCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  lov-5.fa
45690  NNNAAGAAAGAAAGNCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  nfa-8.fa
45690  TAAAAGANNNNNNNNNAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  rrs-10.fa
45690  TAAAAGAAANNNNNNNNAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  rrs-7.fa
45690  TAAAAGAAANANNGNCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  sha.fa
45690  TAAAAGNNNNNNNNNNNAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCNCGTGCTTACGATTGTGCCAAAC  tamm-2.fa
45690  TAAAAGAAANNNNNNNNAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  ts-1.fa
45690  TAAAAGNNNNNNNNNNNNAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACANNNNNNTGCTTACGATTGTGCCAAAC  tsu-1.fa
45690  TAAAAGAAANNNNNGCAAAGACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAAC  van-0.fa
 
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  chr1.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATNGACCTTGTGTTGGCTTTCGTA  bay-0.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  bor-4.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  br-0.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  bur-0.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  c24.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  col-0.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  cvi-0.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  est-1.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  fei-0.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  got-7.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGNAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  ler-1.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  lov-5.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  nfa-8.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  rrs-10.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  rrs-7.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  sha.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  tamm-2.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  ts-1.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  tsu-1.fa
45770  TTGCTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGTGTTGGCTTTCGTA  van-0.fa
 
45850  CATCAGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  chr1.fa
45850  CATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  bay-0.fa
45850  CATCRNNATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  bor-4.fa
45850  CATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  br-0.fa
45850  CATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  bur-0.fa
45850  CATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  c24.fa
45850  CATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  col-0.fa
45850  CATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  cvi-0.fa
45850  CATCRGNATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  est-1.fa
45850  CNTCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  fei-0.fa
45850  CATCRNNNNNTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTNTTCCTGGATTCATGTCAACAGAGTACCTAA  got-7.fa
45850  CATCRGNATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  ler-1.fa
45850  CATCRNNNTCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  lov-5.fa
45850  CATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  nfa-8.fa
45850  CATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  rrs-10.fa
45850  CATCRNNATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  rrs-7.fa
45850  CATCRGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  sha.fa
45850  CATNRNNNTCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  tamm-2.fa
45850  CATCRNNNTCTTCTTTGGAGTTGAGTTCAAGNCTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTCAACAGAGTACCTAA  ts-1.fa
45850  CNNNRNNNNCTTCTTTGGNGTTGAGTTCAAGACTTCAGGGTTTCNTCTTNTTCCTGGATTCATGTCAACAGAGTACCTAA  tsu-1.fa
45850  CATCRGNATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGTTCCTGGATTCATGTNNNNNNNNTACCTAA  van-0.fa
 
45930  CCCGCATTTCCCGACCACCTACTTCCTTCATATATAGCAACAAAACCAAAGCACTCAACTTTACACTCAACCAGAAGAAA  chr1.fa
45930  CCCGCATNNNNNNACCACCTACTTCCTTCATATATAGCAACAAAACCAAANCACTCAACTTTACACTCAACCAGAAGAAA  bay-0.fa
45930  CCCGCATTTCCCGACCACCTACTTCCNNNNNNNNNNNNNACAAAACCAAAGCACTCAACTTTACACTCAACCAGAANNNN  bor-4.fa
45930  CCCGCATTTCCCGACCACCTACTTCCNTNNNNNNNNNNAACAAAACCAAANCACTCAACTTTACACTCAACCAGAANNNN  br-0.fa
45930  CCCGCATTTCCCGACCACCTACTTCCTTCATATATAGCAACAAAACCAAAGCACTCAACTTTACACTCAACCAGAAGAAA  bur-0.fa
45930  CCCGCATTTCCCGACCACCTACTTCCTTCATATATNGCAACAAAACCAAAGCACTCAACTTTACACTCAACCAGAAGAAA  c24.fa
45930  CCCGCATTTCCCGACCACCTACTTCCTTCATATANAGCAACAAAACCAAANCACTCAACTTTACACTCAACCAGAAGNNN  col-0.fa
45930  CCCGCATTTCCCGACCACCTACTTCCTTCATATATAGCAACAAAACCAAAGCACTCAACTTTACACTCAACCAGAAGAAA  cvi-0.fa
45930  CCCGCATTTCCCGACCACCTACTTCCTNNNNNNNNNNNAACAAAACCAAANCACTCAACTTTACACTCAACCAGNNNNNN  est-1.fa
45930  CCCGCATTTCCCGACCACCTACTTCCTTCATATATAGCAACAAAACCAAAGCACTCAACTTTACACTCAACCAGAAGAAA  fei-0.fa
45930  CCCGCATTTCCCGACCACCTACTNNNNNNNNNNNNNNNNACAAAACCAAANCACTCAACTTTACACTCANNNNNNNNNNN  got-7.fa
45930  CCCGCATTTCCCGACCACCTACTTCCTTCATATATNGCAACAAAACCAAAGCACTCAACTTTACACTCAACCAGANNNNN  ler-1.fa
45930  CCCGCATTTCCCGACCACCTACTTNNNNNNNNNNNNGCAACAAANCCAAAGCACTCAACTTTACACTCAACCAGNNNNNN  lov-5.fa
45930  CCCGCATTTCCCGACCACCTACTTCCTTCATNNNNNGCAACAAAACCAAAGCACTCAACTTTACACTCAACCAGAAGAAA  nfa-8.fa
45930  CCCGCATTTCCCGACCACCTACTTCCTNNNNNNNNNNCAACAAAACCAAAGCACNCAACTTTACACTCAACCNNNNNNNN  rrs-10.fa
45930  CCCGCATTTCCCGACCACCTACTTCCNNNNNNNNNNNNNACAAAACCAAAGCACTCAACTTTACACTCAACCAGAANNNN  rrs-7.fa
45930  CCCGCATTTCCCGACCACCTACTTCCTTCATANNNNNNNACAAAACCAAAGCACTCAACTTTACACTCAACCAGAAGAAA  sha.fa
45930  CCCGCATTTCCCGACCACCTACTTCCNNNNNNNNNNNNAACAAAACCAAANNNNTCAACTTTACACTCAACCAGAAGNNN  tamm-2.fa
45930  CCCGCATTTCCCGACCACCTACTTCCTTCANNNNNNNNAACAAAACCNAANCACTCAACTTTACACTCAACCAGAAGANN  ts-1.fa
45930  CCCGCATTTCCCGACCACCTACTTNNNNNNNNNNNNNNNNCAAAACCNNNNNNCTCAACTTTACACTCAANNNNNNNNNN  tsu-1.fa
45930  CCCGCATTTCCCGACCACCTACTTCCTTCANNNNNAGCAACAAAACCAAAGCACTCAACTTTACACTCAACCAGAAGAAA  van-0.fa
 
46010  GATAGACTTGTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGAAGCAATGGCGATTTTGGCAGAGTTTATAGAA  chr1.fa
46010  GATAGACTTNTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  bay-0.fa
46010  NNNNNNNNNNNTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGAAGCAATGGCGATTTTGGCAGAGTTTATAGAA  bor-4.fa
46010  NNNNNNNNNNTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  br-0.fa
46010  GATAGACTTGTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGAAGCAATGGCGATTTTGGCAGAGTTTATAGAA  bur-0.fa
46010  NNNNNNNTTGTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  c24.fa
46010  NNNNNNNNNGTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  col-0.fa
46010  NNNNNNNTTNTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  cvi-0.fa
46010  NNNNNNNNNNTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  est-1.fa
46010  GATNNNNNNNTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  fei-0.fa
46010  NNNNNNNNNNNNNNTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  got-7.fa
46010  NNNNNNNNNGTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  ler-1.fa
46010  NNNNNNNNNNNNNTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  lov-5.fa
46010  NNNNNNNTTGTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  nfa-8.fa
46010  NNNNNNNNNNNNTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  rrs-10.fa
46010  NNNNNNNNNNTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGAAGCAATGGCGATTTTGGCAGAGTTTATAGAA  rrs-7.fa
46010  NNNNNNNNTGTTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  sha.fa
46010  NNNNNNNNNNNNNTTTGGTTTCCCGGGCTCTTACNGTTCCANCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  tamm-2.fa
46010  NNNNNNNNNNNNTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  ts-1.fa
46010  NNNNNNNNNNNNNTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  tsu-1.fa
46010  NNNNNNNNNNNTTTTTGGTTTCCCGGGCTCTTACTGTTCCATCAAGAGNAGCAATGGCGATTTTGGCAGAGTTTATAGAA  van-0.fa
 
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  chr1.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  bay-0.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  bor-4.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  br-0.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  bur-0.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  c24.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  col-0.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  cvi-0.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  est-1.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  fei-0.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  got-7.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  ler-1.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  lov-5.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  nfa-8.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  rrs-10.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  rrs-7.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  sha.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  tamm-2.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  ts-1.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  tsu-1.fa
46090  CCCATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACCTGCAACATCATTTCCAAGCAATG  van-0.fa
 
46170  CACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  chr1.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  bay-0.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCNNNNNNNCANAANAGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  bor-4.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCATATANTCAAAAGAGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  br-0.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  bur-0.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  c24.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  col-0.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  cvi-0.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCNNNNNNNNNNAANAGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  est-1.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  fei-0.fa
46170  CACACCTCTCACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCAGTACGTTTGATTCGTCTTGATGGAACTCA  got-7.fa
46170  CACACCTCTCACTATACTTGTCAATCATNNNNNNNNNNNNNNNNNNNACCAGTACGTTTGATTCGTCTTGATGGAACTCA  ler-1.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCNNNNNNNNNNNNNNNNNNCCAGTACGTTTGATTCGTCTTGATGGAACTCA  lov-5.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCATATACNCAAAAGAGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  nfa-8.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCATATACTCAAAAGAGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  rrs-10.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCNNNNNNNNNNNNNNGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  rrs-7.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCATATNCTCAAAAGAGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  sha.fa
46170  CACACCTCTCACTATACTTGNCAATCATCCATANNNNNNNNNNNNNNNCCAGTACGTTTGATTCGTCTTGATGGAACTCA  tamm-2.fa
46170  CACACCTCTCACTATACTTGTCAATCNTCCATNNNNNNNNNNNNNTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  ts-1.fa
46170  CACACCTCTCACTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTTGATTCGTCTTGATGGAACTCA  tsu-1.fa
46170  CACACCTCTCACTATACTTGTCAATCATCCANNNNNTCAAAAGAGTAACCAGTACGTTTGATTCGTCTTGATGGAACTCA  van-0.fa
 
46250  AAGCTAAGTATTTTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTAAGTTGAAAGAGTAAAACTTTGAATTTT  chr1.fa
46250  AAGCTAAGTATTTTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTAAGTTGAAAGAGTAAAACTTTGAATTTT  bay-0.fa
46250  AAGCNNNNNNNNNNNNNNNNNNATTGTGGATGATCTTTGAATNNNCNAAGCTAAGNNNNNNNNNNNNNNNNNNNNNNNNT  bor-4.fa
46250  AAGCTAAGNNNNNNNNNATTACATTGTGGATGATCTTTGAATTTTCAAAGCTAAGTTGAAANNNNNNNACTNNNNNTTTT  br-0.fa
46250  AAGCTAAGTATTTTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTAAGTTGAAAGAGTAAAACTTTGAATTTT  bur-0.fa
46250  AAGCTAAGTATTTTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTAAGTTGAAAGAGTAAAACTTTGAATTTT  c24.fa
46250  AAGCTANNNNNNNNNNNNNNNNNNTGTGGATGATCTTTNNNNNNTCAAAGCTAAGTTNNNNNNNNNNNNNNNNNNATTTT  col-0.fa
46250  AAGCTAAGTATTTTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTAAGTTGAAAGAGTAAAACTTTGAATTTT  cvi-0.fa
46250  AAGCNNNNNNNNNNNNNNNNNNATTGTGGATGATCTTTNNNNNNNNNNNGCTAAGTTGANNNNNNNNNNNNNNNNNNNNT  est-1.fa
46250  AAGCTAAGTATTTTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTAAGTTGAAAGAGTAAAACTTTGAATTTT  fei-0.fa
46250  AANNNNNNNNNNNNNNNNNNNNNNNGTGGATGATCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
46250  AAGCTNNNNNNNNNNNNNNNNNNNNGTGGATGATCTTTNNNNNNNNAAAGCTAAGTTNNNNNNNNNNNNNNNNGNNNNNT  ler-1.fa
46250  AAGNNNNNNNNNNNNNNNNNNNNNNNNGGATGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  lov-5.fa
46250  AAGCTAAGTATTNTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTAAGTTGAAAGANTAAAACTTTGAATTTT  nfa-8.fa
46250  AAGCTAANNNNNNNNNNNNNNCATTGTGGATGATCTTTGANNNNNNNNNGCTAAGTTGAAANNNNNNNACTTTGNATTTT  rrs-10.fa
46250  AAGCTAANNNNNNNNNNNNNNNATTGTGGATGATCTTTGANNNNNNNAANCTNAGTTGNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
46250  AAGCTAAGTATTTTCAAATTACATTGTGGATGATCTTTGAATTTTCAAAGCTAAGTTGANANAGTAAAACTTTGAATTTT  sha.fa
46250  AAGCNNNNNNNNNNNNNNNNNNNNNGTGGATGATCTTNNNNNNNTCNNNNNTAAGTTGAANNNNNNNNNNNNNNNNNTTT  tamm-2.fa
46250  AAGCTNNNNNNNNNNNNNNNNCATTGTGGATNATCTTTNNNNNNNCAAAGCTAAGTTGANNNNNNNNNNNTTTGAATTTT  ts-1.fa
46250  AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
46250  AAGCTAAGNNNNNNNNAATTNCATTGTNNNNNNNNNNNNNNNNNNNNNAGCTAANTTGAANNNNNNNNNCNNNNNNNTTT  van-0.fa
 
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACAGAGATTACAGTTCCAAAAGGCTGAAAC  chr1.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACAGAGATTACAGTTCCAAAAGGCTGAAAC  bay-0.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGANNNNNNNNNNTNNNNNNNNNNNGATTACAGTTCCAAAAGGCTGAAAC  bor-4.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACAGAGATTACAGTTCCAAAAGGCTGAAAC  br-0.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGNNNTNNNNNTACAGAGATTACAGTTCCAAAAGGCTGAAAC  bur-0.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGATAANNNNNNNTNNNNNNNCAGAGATTACAGTTCCAAAAGGCTGAAAC  c24.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACAGAGATTACAGTTCCAAAAGGCTGAAAC  col-0.fa
46330  CATAAAGGCATTGTAGGATNNNNNNGNNNNNNNNNNNNNNNNNTNNNNNNNCAGAGATTACAGTTCCAAAAGGCTGAAAC  cvi-0.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACAGAGATTACAGTTCCAAAAGGCTGAAAC  est-1.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGNNNNNNTNNNNCNACAGAGATTACAGTTCCAAAAGGCTGAAAC  fei-0.fa
46330  NNTAAAGGCATTGTAGGATCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNCAGTTCCAAAAGGCTGAAAC  got-7.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACAGAGATTACAGTTCCAAAAGGCTGAAAC  ler-1.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATNTNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACAGTTCCAAAAGGCTGAAAC  lov-5.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACAGAGATTACAGTTCCAAAAGGCTGAAAC  nfa-8.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACAGAGANTACAGTTCCAAAAGGCTGAAAC  rrs-10.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGATANNNNNNNNTNNNNNNNNNNNGATTACAGTTCCAAAAGGCTGAAAC  rrs-7.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGATANNNNNNNNTNNNNNNNNNGAGATTACAGTTCCAAAAGGCTGAAAC  sha.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGANNNNNNNNNNTNNNNNNNNNNNNATTACAGTTCCAAAAGGCTGAAAC  tamm-2.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGGATAAGAAGTACCACCTCTACAGAGATTACAGTTCCAAAAGGCTGAAAC  ts-1.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNCAGTTCCAAAAGGCTGAAAC  tsu-1.fa
46330  CATAAAGGCATTGTAGGATCAATCAAATCTGNNNNNNNNNNNNTNNNNNNNNNNAGATTACAGTTCCAAAAGGCTGAAAC  van-0.fa
 
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGG  chr1.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGG  bay-0.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGG  bor-4.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTANCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGG  br-0.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGG  bur-0.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGG  c24.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTNCTGG  col-0.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGG  cvi-0.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGG  est-1.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGG  fei-0.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTNNNNN  got-7.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGG  ler-1.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGN  lov-5.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGG  nfa-8.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTNCTGG  rrs-10.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTNCTGG  rrs-7.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTNCTGG  sha.fa
46410  ANGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGG  tamm-2.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGG  ts-1.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCNNNNNNGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTNNNNNNG  tsu-1.fa
46410  ATGTCAAGAAGCTGAGCAATGTCGTAGCTTCTAGGGATATTACACACGTAGAGCTCGCAAGGTCTCGGTTTCTTTACTGG  van-0.fa
 
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTTAACTACTTCTTCTTCTTTTTCTTCATCGAGAA  chr1.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGGTTNTGCTTCTCCTTNNNRRRRRRRRNRNNNRNRRNNNTCATCGAGAA  bay-0.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTNTNNGNTTCTGCTTCTCNTNNNNRRRRRRRRNRNNNRNRRNNNTCATCNAGAA  bor-4.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTNNNNRRRRRRRRNRNNNRNRRNNNTCATCGAGAA  br-0.fa
46490  TTCTGCTTTAGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTTNNRRRRRRRRNRNNNRNRRTCTTCATCGAGAA  bur-0.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRRRRRRRNRNNNRNRRNNNNNNNTNNNNN  c24.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRRRRRRRNRNNNRNRRNNNTCATCGAGAA  col-0.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRRRRRRRNRNNNRNRRNCNTCATCGAGAA  cvi-0.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTNNNNRRRRRRRRNRNNNRNRRNNNNNNNNNNGAA  est-1.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRRRRRRRNRNNNRNRRNNNNNNNTNNNNN  fei-0.fa
46490  NNNNNNNNNANNNNNNNNNNNNTCTTTNNNNNNNTNTGCTTCTCCNNNNNRRRRRRRRNRNNNRNRRNNNTCNNNNNNNA  got-7.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRRRRRRRNRNNNRNRRNNNTCATCGAGAA  ler-1.fa
46490  NNNNNNNTNANNNNNNNNNNNNNNNNNNNNGGGTTCTGCTTCTCNNNNNNRRRRRRRRNRNNNRNRRNNNTCATCGNGAA  lov-5.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRRRRRRRNRNNNRNRRNNTTCATCGAGAA  nfa-8.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGNNNNNNNTTCTCCTTNNNRRRRRRRRNRNNNRNRRNNTTCATCGAGAA  rrs-10.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTNNNNRRRRRRRRNRNNNRNRRNNTTCATCGAGAA  rrs-7.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRRRRRRRNRNNNRNRRNNNTCATCNNNNN  sha.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGNTTCTGCTTCTNNNNNNNRRRRRRRRNRNNNRNRRNNNTNANNNNNNN  tamm-2.fa
46490  TTCTGCTTTGGAGACGACACTATCTTNATTGGGTTCTGCTTCTNNNNNNNRRRRRRRRNRNNNRNRRNNNNCANCGNGAA  ts-1.fa
46490  TTCTGCTTTGGAGACGACACTATCNNNNNNNGNNTNTGCTTCNNNNNNNNRRRRRRRRNRNNNRNRRNNNNNNNNNNNNN  tsu-1.fa
46490  TTCTGCTTTGGAGACGACACTATCTTTATTGGGTTCTGCTTCTCCTTNNNRRRRRRRRNRNNNRNRRNNTTCATCGAGAA  van-0.fa
 
46570  CTGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGAAAGAGAAGAGTGATGAAAAGAA  chr1.fa
46570  CTGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGAAAGNNNNNNNRGNNGAAAANAN  bay-0.fa
46570  CTGATANNNNNNNNGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGAANGNNNNNNNRNNNGAANNNNN  bor-4.fa
46570  CTGATAANNNNNNAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGNNNNNNNNNNNRNNNGAANNNNN  br-0.fa
46570  CTGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGAAAGAGAAGNGRGNTGAAAAGAA  bur-0.fa
46570  NNGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGAAAGNGNNNNNRNNNGAAAAGAN  c24.fa
46570  CTGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGANAAAGANNNNNNRNNNGAAAANNN  col-0.fa
46570  CTGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGANNNNNNNNNNRNNNGAAAANNN  cvi-0.fa
46570  CTGATAANNNNNNAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGNNNNNNNNNNNNNRNNNGAAAANNN  est-1.fa
46570  NTGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGAAAGNNNNNNNRNNNGAAAANNN  fei-0.fa
46570  CTGATNNNNNNNNNNNNNNNNNNTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGANNNNNNNNNNRNNNNNNNNNNN  got-7.fa
46570  CTGATAATNCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGANNNNNNNNNNRNNNGAAAANNN  ler-1.fa
46570  CTGATAANNNNNAAGNNNNNNNNTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGNNNNNNNNNNNRNNNNNNNNNNN  lov-5.fa
46570  CTGATAATTCTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGAAANNNNNNNNRNNNGAAAANNN  nfa-8.fa
46570  CTGATNNNNNNNAAGAAGNGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGAAAGANNNNNNRNNNNNNNNNNN  rrs-10.fa
46570  CTGATAATTCNGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGANNNNNNNNNNRNNNNAAANNNN  rrs-7.fa
46570  NNNNNGNNNNNNNNNAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGNNNNNNNNNNNRNNNNNNANNNN  sha.fa
46570  NNNNNGNNNNNNNNNNNNNNACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGAAAGNNNNNNNRNNNNNNNNNNN  tamm-2.fa
46570  CTGATANNNNNNAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGANNNNNNNNNNRNNNNNNNNNNN  ts-1.fa
46570  NNNNNNNNNNNNNNNNNNNNNNNNNGATTTGAAGTGGTTGAGCTACAAAGGGACGANNNNNNNNNNNNRNNNNNNNNNNN  tsu-1.fa
46570  CTGATAATTNTGAAGAAGAGACCTTGATTTGAAGTGGTTGAGCTACAAAGGGACGAGAAAGANNNNNNRNNNGAAANNNN  van-0.fa
 
46650  TTGGAAGAAGAGAATTGAAGTTTCAGAGATTCTAAGTAAGAGTAAGAAGAAGAAGAGATTAGGGTTTTGTATTTGGGAAT  chr1.fa
46650  RNGNAAGAAGAGAATTGNAGTTTCAGAGATTCTAAGTAAGAGNAAGAAGAAGAANNNRTTNGGGTTTNNRNNTTGGGAAT  bay-0.fa
46650  RNNNNNNNNNNNNNNNGAAGTTTCAGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNTTNNNRNNNTGGGAAT  bor-4.fa
46650  RNNNNNNNNNNNAATTGNAGTTTCAGAGATTCNNNNNNNNNNNNNNNNGAANNNNNNRNNNGGGTTNNNRNNNTGGGAAT  br-0.fa
46650  RTGNAAGAAGAGAATTGNAGTTTCAGAGATTCTAAGTAAGAGNNNNNNNNNNNNNNNRTNNGGGTTTNGRNNTTGGGAAT  bur-0.fa
46650  RNNNAAGAAGAGAATTGNAGTTTCAGAGATTCTAAGTAANNNNNNNNNGNNNNNNNNRTTNGGGTTTNNRNNTTGGGAAT  c24.fa
46650  RNNNNNGNNNNNNATTGAAGTTTCAGAGATTCNNNNNNNNNNNNAGANNNNNNNNNNRNNNNNGTTNNNRNTNTGGGAAT  col-0.fa
46650  RNNNAAGNNNNNAATTGAAGTTTCAGAGATTCTAAGTAANNNNNNGAAGAANNNNNNRNNNGGGTTNNNRNNNTGGGAAT  cvi-0.fa
46650  RNNNNNNNNNNNAATTGAAGTTTCAGAGATTCTNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNRNNNTGGGAAT  est-1.fa
46650  RNNNNNGAAGAGAATTGNAGTTTCNGAGATTCTAAGTNNNNNNNNGAAGANGANNNNRNNNGGGTTNNNRNNTTGGGAAT  fei-0.fa
46650  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANAANNNNNNRNNNNNNNNNNNRNNNNNNNAAT  got-7.fa
46650  RNNNNNNNNNNNAATTGANGTTTCAGAGATTCNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNGGTTNNNRNNNTGGGAAT  ler-1.fa
46650  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNRNNNTGGGAAT  lov-5.fa
46650  RNNNANGAAGAGAATTGNAGTTTCAGAGATTCNAAGTAAGANNNNNAAGAAGANNNNRNNNGGGTTNNNRNNNTGGGAAT  nfa-8.fa
46650  RNNNAAGNNNNNNNNNGAAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNTNNNRNTTTGGGAAT  rrs-10.fa
46650  RNNNNNNNNNNNNNNNNNAGTTTCAGAGATTCNNNNNNNNNNNNNNANNNNGNNNNNRNNNGGGTTNNNRNNNTGGGAAT  rrs-7.fa
46650  RNNNNNNNNNNNNNNNGNAGTTTCAGAGATTCTAAGTANNNNNNNNNNNNNNNNNNNRNNNGGGTTNNNRNNNTGGGAAT  sha.fa
46650  RNNNNNNNNNNNNNNNNNNNNTNCAGAGATTCTANNNNNNNNNNNNANGNNNNNNNNRNNNNNNNNNNNRNNNNGGGAAT  tamm-2.fa
46650  RNNNNNGANNNNNNNNNNNGTTTCAGAGATTCTAANNNNNNNNNNNNNNNNNNNNNNRNNNNNGTTNNNRNNNNGGGAAT  ts-1.fa
46650  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNRNNNNNGGAAT  tsu-1.fa
46650  RNNNNNNNNNNNNATTGNAGTTTCAGAGANNNNNNNNNNNNNNNNNAAGANNNNNNNRNNNGGGTTNNNRNNTTGGGAAT  van-0.fa
 
46730  TGCATTGTGAGACGATCGAGAAGAAGAAGATAAGGGAATTGCGAAGCAGGAGGCCGCCAT   chr1.fa
46730  TGCATTGTGAGACGATNRNGAAGAAGAAGATAAGGGAATTGCGAAGCAGGAGGCCGCCAT   bay-0.fa
46730  TGCATTGTGAGACGATCRNGNAGAANNNNNNNAGGGAATTGCGAAGCAGGAGGCCGCCAT   bor-4.fa
46730  TGCATTGTGAGACGATNRAGAAGAAGANNNNAAGGGAATTGCGAAGCAGGAGGCCGCCAT   br-0.fa
46730  TGCATTGTGAGACGATCRAGAAGAAGANGATAAGGGAATTGCGAAGCAGGAGGCCGCCAT   bur-0.fa
46730  TGCATTGTGAGACGANNRAGAAGAAGAAGATAAGGGAATTGCGAAGCAGGAGGCCGCCAT   c24.fa
46730  TGCATTGTGAGACGATCRAGAAGAAGNNNNNAAGGGAATTGCGAAGCAGGAGGCCGCCAT   col-0.fa
46730  TGCATTGTGAGACGANCRAGAAGAAGAAGATAAGGGAATTGCGAAGCAGGAGGCCGCCAT   cvi-0.fa
46730  TGCATTGTGAGACGNTCRAGAAGAAGAAGATAAGGGAATTGCGAAGCAGGAGGCCGCCAT   est-1.fa
46730  TGCATTGTGAGACGNNNRNGNAGAAGAAGATAAGGGAATTGCGAAGCAGGAGGCCGCCAT   fei-0.fa
46730  TGCATTGTGAGACGATCRAGAAGAAGANNNTAAGGGAATTGCGAAGCAGGAGGCCGCCAT   got-7.fa
46730  TGCATTGTGAGACGATNRNGNAGANNNNNNNAAGGGANTTGCGAAGCAGGAGGCCGCCAT   ler-1.fa
46730  TGCATTGTGAGACGANCRNGAAGNNNNNNNNNNGGGAATTGCGAAGCAGGAGGCCGCCAT   lov-5.fa
46730  TGCATTGTGAGACGANNRAGAAGAAGAAGNTAAGGGAATTGCGAAGCAGGAGGCCGCCAT   nfa-8.fa
46730  TGCATTGTGAGACGATCRAGAAGAAGANGATAAGGGAATTGCGAAGCAGGAGGCCGCCAT   rrs-10.fa
46730  TGCATTGTGAGACGATCRAGAAGAAGNNNNNNNGGGAATTGCGAAGCAGGAGGCCGCCAT   rrs-7.fa
46730  TGCATTGTGAGACGANNRNGNAGAAGAAGATAAGGGAATTGCGAAGCAGGAGGCCGCCAT   sha.fa
46730  TGCATTGTGAGACGANNRAGAAGNNNNNNNNNAGGGAATTGCGAAGCAGGAGGCCGCCAT   tamm-2.fa
46730  TGCATTGTGAGACGNNNRNGNAGAAGNNNNNNNGGGAATTGCGAAGCAGGAGGCCGCCAT   ts-1.fa
46730  TGCATTGTGAGACGATNRNNNAGNNNNNNNNNNNNGAATTGCGAAGCAGGAGGCCGCCAT   tsu-1.fa
46730  TGCATTGTGAGACGATCRAGAAGAAGAAGNTAAGGGAATTGCGAAGCAGGAGGCCGCCAT   van-0.fa
 
visited.