Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 47705 - 49166


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  chr1.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  bay-0.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  bor-4.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  br-0.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  bur-0.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  c24.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  col-0.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  cvi-0.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  est-1.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  fei-0.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATNCTTTTG  got-7.fa
47705  NCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAANCCTTTTG  ler-1.fa
47705  NCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCNNNNNNNTTTG  lov-5.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  nfa-8.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  rrs-10.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  rrs-7.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  sha.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  tamm-2.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  ts-1.fa
47705  NCNGACTTGAGCTGTGCCTTCGGTAAACTTGGGNTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCNNNNNNNNTTG  tsu-1.fa
47705  TCAGACTTGAGCTGTGCCTTCGGTAAACTTGGGGTCCTCACATCTGTACCGTCCATCAGGTCCAATTCCAAATCCTTTTG  van-0.fa
 
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCAACCGCTTCCTCCACC  chr1.fa
47785  GATCAGCAAACACANTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCNACCGCTNNNNNNNCN  bay-0.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCAACCGCTTCCTCCACC  bor-4.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACNNNNNNGCTTCCNCCACC  br-0.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCAACCGCTTCNTCCACN  bur-0.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCNACCGCTNNNNNNACC  c24.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCAACCGCTTCCTCCACC  col-0.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCNACCGCTTCCTCCACC  cvi-0.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCAACCGCTTNNNNNNCC  est-1.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCAACCGCTTCCTCCACC  fei-0.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCAACCGCTTCCTCCACC  got-7.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCAACCGCTTCNNCCACC  ler-1.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCAACCGCTTCCNCCACC  lov-5.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCNACCGCTTCCTCCACC  nfa-8.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACNNNNNNGCTTCCTCCACC  rrs-10.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCAACCGCTNNNNNNACC  rrs-7.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCNACCGCTNNNNNNACC  sha.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCAACCGCTTCCNCCACC  tamm-2.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCAACCNNNNNNNNNACC  ts-1.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCAACCGCTTCCNCCACC  tsu-1.fa
47785  GATCAGCAAACACATTCTCTAGCAACTGACTGCGACCGGGCTGTGGACTAGCGTCTGCAAACTCNACCGCTTCCTCCACC  van-0.fa
 
47865  AACTCGTCTATCTTTTTCTCTATTGACTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTCTATCAAATACTTCTTCAATGC  chr1.fa
47865  AACTCGTCNATCTTTTTCTCTATTGACTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTCTATCAAATACTTCTTCAATGC  bay-0.fa
47865  AACTCGTCNNNNNNNNNNNNNNNNNNNTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTCTNNNNNNNNNNTCTTCAATGC  bor-4.fa
47865  AACTCGTCNATNNNNNNNNNNNNNGACTTTAGCTCTGCTTCCTTTGCAAGCTTGTTNNNNNNNNNNNNNNTCTTCAATGC  br-0.fa
47865  AACTCGTCTATCTTTTTCTCTATTGACTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTCTATCAAATACTTCTTCAATGC  bur-0.fa
47865  AACTCGTCTATCTTTTTCTCTATTGACTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTCTATCAAATACTTCTTCAATGC  c24.fa
47865  AACTCGTCTNNNNNNNNNNNNNNNGACTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTCTATCNNNNNNNTCTTCAATGC  col-0.fa
47865  AACTCGTCTATCTTTTTNNNNNTTGACTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTCTATCAAANACTTCTTCAATGC  cvi-0.fa
47865  AACTCGTCTATCTTNNNNNNNNNNNACTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTCNNNNNNNNNNNTCTTCAATGC  est-1.fa
47865  AACTCGTCTATCTTTTTCTCTNTTGACTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTCTATCAAATACTTCTTCAATGC  fei-0.fa
47865  AACTCGNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTGCTTCCTTTGCAAGCTTGTNNNNNNNNNNNNNNNNNTTCAATGC  got-7.fa
47865  AACTCGTCTATCTTNNNNNNNNNNNACTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTCTNNNNNNNNNNNCTTCAATGC  ler-1.fa
47865  AACTCGTCNNNNNNNNNNNNNNNNNNNNTTAGCTCTGCTTCCTTTGCAAGCTTGTTNNNNNNNNNNNNNNNCTTCAATGC  lov-5.fa
47865  AACTCGTCTATCTTTTTCTCTNTTGACTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTCTATCAAANACTTCTTCAATGC  nfa-8.fa
47865  AACTCGTCTATCTTNNNNNNNNNNNNNNNNNGCTCTGCTTCCTTTGCAAGCTTGTTNNNNNNNNNNNNNNTCTTCAATGC  rrs-10.fa
47865  AACTCGTCNATNTTNNNNNNNNNNGACTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTNNNNNNNNNNNNTCTTCAATGC  rrs-7.fa
47865  AACTCGTCTATNTTTTTCTCTNTTGACTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTCNATCAAATNCTTCTTCAATGC  sha.fa
47865  AACTCGTCTANNNNNNNNNNNNNNNNNTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTCNNNNNNNNNNNNNTTCAATGC  tamm-2.fa
47865  AACTCGNNNNNNNTNNNNNNNNNNGACTTTNGCTCTGCTTCCTTTGCAAGCTTGTTCTCTANNNNNNNNNNCTTCAATGC  ts-1.fa
47865  AACNCGTCTNNNNNNNNNNNNNNNNNNNNTAGCTCTGCTTCCTTTGCAAGCTTGTTCNNNNNNNNNNNNNNNTTCAATGC  tsu-1.fa
47865  AACTCGTCTATCTNNNNNNNNNNNNNCTTTAGCTCTGCTTCCTTTGCAAGCTTGTTCTCTNNNNNNNNCTTCTTCAATGC  van-0.fa
 
47945  TGCGATTGGGTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGCAAAAAAAAATTCAAATTAAAGAGAAGGTTGTTTCAACC  chr1.fa
47945  TGCGATTGGNTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGCAAAAAAAAANTCNNNNNNNAGAGAAGGTTGTTTCAACC  bay-0.fa
47945  TGCGATTGGGTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTGTTTCAACC  bor-4.fa
47945  TGCGATTGGNTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGCAAAAAAANNNNNNNNNNNNNNNNNAGGTTGTTTCAACC  br-0.fa
47945  TGCGATTGGNTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGCAAAAAAAAATTCNNNNNNNNGAGAAGGTTGTTTCAACC  bur-0.fa
47945  TGCGATTGGNTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGCAAAAAAANNNNNNNNNNNNNGAGAAGGTTGTTTCAACC  c24.fa
47945  TGCGATTGGGTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGCAAAAAANNNNNNNNNNNNNNNNNNAGGTTGTTTCAACC  col-0.fa
47945  TGCGATTGGNTCTCTAGCCGCGTATTTGGCTTTCTCNGCTGCAAAAAAANNNNNNNNNNNNNNNGAAGGTTGTTTCAACC  cvi-0.fa
47945  TGCGATTGGGTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGCAAAAAANNNNNNNNNNNNNNNNNNNNNTTGTTTCAACC  est-1.fa
47945  TGCGATTGGNTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGCAAAAAAANNNNNNNNNNNNNNNNAAGGTTGTTTCAACC  fei-0.fa
47945  TGCGATTGGGTCTCTAGCCGCGTATTTGGCTTTCNCAGCTGNAANAANNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNN  got-7.fa
47945  TGCGATTGGGTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGCAAAAAANNNNNNNNNNNNNNNNNNNNNNTNNNNNNACC  ler-1.fa
47945  TGCGATTGGGTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGCAAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNACC  lov-5.fa
47945  TGCGATTGGNTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGCAAAAAAANNNNNNNNNNNNNNNNNNGGTTGTTTCAACC  nfa-8.fa
47945  TGCGATTGGGTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGCAAAAAAANNNNNNNNNNNNNNNNNNNNNTGTTNNNNNN  rrs-10.fa
47945  TGCGATTGGGTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTTNNNNNN  rrs-7.fa
47945  TGCGATTGGGTCTCTAGCCGCGTATTTGGCTTTCTCNGCTGCAAAAAAANNNNNNNNNNNNNNNNNAGGTTGTTTCAACC  sha.fa
47945  TGCGATTGGNTCTCTAGCCGCGTATTTGGCTTTCTCAGCTNNNNNAANNNNNNNNNNNNNNNNNNNNNNNTGTTTCAACC  tamm-2.fa
47945  TGCGATTGGGTCTCTAGCCGCGTATTTGGCTTTCTCNGCTGCAAAAAANNNNNNNNNNNNNNNNNNNNNTTGTTTCAACC  ts-1.fa
47945  TGCGATTGGGTCTCTAGCCGCGTATTTGGCTTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTNNNNNN  tsu-1.fa
47945  TGCGATTGGNTCTCTAGCCGCGTATTTGGCTTTCTCAGCTGCAAAAAAANNNNNNNNNNNNNNNNNAGGTTGTTTCAACC  van-0.fa
 
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  chr1.fa
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  bay-0.fa
48025  CTTAGNTAATCAGTACAAGCATCAAGNNNNNNNNNNNNNNNGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  bor-4.fa
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  br-0.fa
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  bur-0.fa
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  c24.fa
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  col-0.fa
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  cvi-0.fa
48025  CTTAGANAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  est-1.fa
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  fei-0.fa
48025  NNNNNNNNNNCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  got-7.fa
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  ler-1.fa
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  lov-5.fa
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  nfa-8.fa
48025  CTTANATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  rrs-10.fa
48025  NNTANATAATCAGTACAAGCATCAAGNNNNNNNNNNNNNNNNATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  rrs-7.fa
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  sha.fa
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  tamm-2.fa
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  ts-1.fa
48025  NNNNNNNNNNCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  tsu-1.fa
48025  CTTAGATAATCAGTACAAGCATCAAGAAGCAGAAGGAAGTCGATATTTACCAGCATCACGGAGCTCATCGGGATCAGCCA  van-0.fa
 
48105  AGGAGTGTCCTCTGAATCTATAAGTCTCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTAGTGACAGCTTCT  chr1.fa
48105  AGGAGTGTCCTCTGAATCTATAAGTCTCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTAGTGACAGCTTCT  bay-0.fa
48105  AGGAGTGTCCTCTGAATCTATANGTCTCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTANNNNNNNNCNNN  bor-4.fa
48105  AGGAGTGTCCTCTGAATCTATAAGTCTCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTAGTGACAGCTTCT  br-0.fa
48105  AGGAGTGTCNNNNANNTCTATAAGTCTCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTAGTGACAGCCTNN  bur-0.fa
48105  AGGAGTGTCCTCTGAATCTATAAGTCTCACATTCAACCAAGGTTGGGCCTNCTCCTCTTCTAGCTCTAGTGACAGCTTCT  c24.fa
48105  AGGAGTGTCCTCTGAATCTATAAGTCTCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTAGTGACAGCTTCT  col-0.fa
48105  AGGAGTGTCCTCTGAATCTATAAGTCTCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTAGTGNCNNCCTNN  cvi-0.fa
48105  AGGAGTGTCCTCTGAATCTATAAGTCNCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTAGTGACAGCTTCT  est-1.fa
48105  AGGAGTGTCCTCTGAATCTATAAGTCTCACATTCAACCAAGGTTGGGCCTTCTCCTCTTCTAGCTCTAGTGACAGCTTCT  fei-0.fa
48105  AGGAGTNNNNNNNANNNNNNNNNNNNNNNNATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTNNNNNNNNNNNCNNN  got-7.fa
48105  AGGAGTGTCCTCTGAATCTATNNNNNNCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTAGTGACAGCTTCT  ler-1.fa
48105  AGGAGTNNNNNNNANNNNNNNNNNNNNNNCATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCNNNNNNNNNNCNNN  lov-5.fa
48105  AGGAGTGTCCTCTGAATCTATAAGTCTCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTAGTGACAGCTTCT  nfa-8.fa
48105  AGGAGTGTCCTCTGAATCTATAANNNNNACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTAGTGACAGCTTCT  rrs-10.fa
48105  AGGAGTGTCCTCTGAATCTATAAGTCNCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTNNNNNNNNNCNNN  rrs-7.fa
48105  AGGAGTGTCCTCTGAATCTATAAGTCTCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTANNNNNNNNCNNN  sha.fa
48105  AGGAGTGTCCTCTGAATCTATANGTCTCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTNNNNNNNNNCNNN  tamm-2.fa
48105  AGGAGTGTCCTCTGAATCTATAAGTCTCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTAGTGACAGCTTCT  ts-1.fa
48105  AGGAGTGTCCTCTGNNNNNNNNNNNNNNACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCNNNNNNNNNNCNNN  tsu-1.fa
48105  AGGAGTGTCCTCTGAATCTATAAGTCTCACATTCAACCAAGGTTGGACCTTCTCCTCTTCTAGCTCTNNNNNCNNNCNNN  van-0.fa
 
48185  TTAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  chr1.fa
48185  TTAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  bay-0.fa
48185  NNAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  bor-4.fa
48185  TTAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  br-0.fa
48185  TNAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  bur-0.fa
48185  TTAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  c24.fa
48185  TTAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  col-0.fa
48185  TNAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  cvi-0.fa
48185  TTAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  est-1.fa
48185  TTAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  fei-0.fa
48185  NNNNNGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTNCA  got-7.fa
48185  TTAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  ler-1.fa
48185  NNNNNGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  lov-5.fa
48185  TTAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  nfa-8.fa
48185  TTAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  rrs-10.fa
48185  NNAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  rrs-7.fa
48185  NNAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  sha.fa
48185  NNNNNGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  tamm-2.fa
48185  TTAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  ts-1.fa
48185  NNNNNNACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  tsu-1.fa
48185  NNAGCGACTTCCCTGACCTTCAAGACATCCATACCGTCAACATGAACACCAGGCATCCCAAATGCAGGACCTTTCTTCCA  van-0.fa
 
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATAATAGGCA  chr1.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCNACAAGTTATTCTCGACAACAAAGATAATAGGCA  bay-0.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATNNNNNNNN  bor-4.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACNNNNNNNATAGGNA  br-0.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAANGGCCCACAAGTTATTCTCGACAACAAAGATAATAGGCA  bur-0.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATAATAGGCA  c24.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATAATAGGCA  col-0.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATAATAGGCA  cvi-0.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATAATNNNNN  est-1.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATAATAGGCA  fei-0.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCNNNNNNNCAAAGNNNNNNNNNN  got-7.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATAANNNNNN  ler-1.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATANNNNNNN  lov-5.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATAATAGGCA  nfa-8.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATAATANNNN  rrs-10.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATNNNNNNNN  rrs-7.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATAATAGGCA  sha.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATAANNNNNN  tamm-2.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATAATNNGCN  ts-1.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAANAANGANNNNNNNNN  tsu-1.fa
48265  AATCTCGGGGTCAGAAGTGGCTCTCAAGTGAGACATCCCAATGGCCCACAAGTTATTCTCGACAACAAAGATANNNNNNN  van-0.fa
 
48345  GTTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  chr1.fa
48345  GTTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  bay-0.fa
48345  NNTTATAGAGAGCAGCCATGTTGAGNCACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  bor-4.fa
48345  GTTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  br-0.fa
48345  GTTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  bur-0.fa
48345  GTTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGNG  c24.fa
48345  GTTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  col-0.fa
48345  GTTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGNG  cvi-0.fa
48345  NNTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  est-1.fa
48345  GTTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGANNNNN  fei-0.fa
48345  NNNTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  got-7.fa
48345  NNTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  ler-1.fa
48345  NNTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  lov-5.fa
48345  GTTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  nfa-8.fa
48345  NNNTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  rrs-10.fa
48345  NNTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  rrs-7.fa
48345  GTTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  sha.fa
48345  NTTTATAGAGAGCAGCCATGTTGNGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGNG  tamm-2.fa
48345  GTTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  ts-1.fa
48345  GTTTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  tsu-1.fa
48345  NNNTATAGAGAGCAGCCATGTTGAGACACTCGAAGAACTGTCCGTTGTTACAAGTTCCATCTCCGAAAAAGGCGACAGTG  van-0.fa
 
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  chr1.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCANNNNNGGCGACAGGAATGCCTTC  bay-0.fa
48425  ACATCATCACAATNCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  bor-4.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  br-0.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  bur-0.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  c24.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  col-0.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  cvi-0.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  est-1.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  fei-0.fa
48425  ACATCATCACAATCCNGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  got-7.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  ler-1.fa
48425  ACATCANCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  lov-5.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  nfa-8.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  rrs-10.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  rrs-7.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  sha.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  tamm-2.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  ts-1.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  tsu-1.fa
48425  ACATCATCACAATCCTGTTTCAAGACTTCCCTCCTGTACTTGGAGCTAAAGGCAGCACCAGTGGCGACAGGAATGCCTTC  van-0.fa
 
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTTCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  chr1.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTTCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  bay-0.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTTCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  bor-4.fa
48505  ACCAATANAAGCAAAGCCACCAAGCATGTTGTGTTCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  br-0.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTTCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  bur-0.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTTCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  c24.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTTCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  col-0.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTTCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  cvi-0.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTTCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  est-1.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTTCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  fei-0.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTNNNNNNNGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  got-7.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGNNNNNNNNNGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  ler-1.fa
48505  ACCAATNAAAGCAAAGCCACCAAGCATGTTNNNNNNNNNNNNNNACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  lov-5.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTTCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  nfa-8.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTTCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  rrs-10.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTTCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  rrs-7.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTNCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  sha.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTNNNNNGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  tamm-2.fa
48505  ACCAATAAAANCAAAGCCACCAAGCATGTTGTGTTNTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  ts-1.fa
48505  ACCAATAAAAGCAAAGCCACCAAGNNNNNNGTNNNNNNNNGAGAACATGTGCATGGATCCACCTTGGCCTCTGCNGCATC  tsu-1.fa
48505  ACCAATAAAAGCAAAGCCACCAAGCATGTTGTGTTCTTTGGAGAACATGTGCATGGATCCACCTTGGCCTCTGCAGCATC  van-0.fa
 
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  chr1.fa
48585  CAGTAACCTTGCCGAAGAGCNNNNNCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  bay-0.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  bor-4.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  br-0.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  bur-0.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGNCACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  c24.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  col-0.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGNCACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  cvi-0.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGNCACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  est-1.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  fei-0.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGNCACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  got-7.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  ler-1.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  lov-5.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  nfa-8.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGNCACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  rrs-10.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  rrs-7.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  sha.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  tamm-2.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  ts-1.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  tsu-1.fa
48585  CAGTAACCTTGCCGAAGAGCTCGCTCATAACAGCACGAGCAGAGACACCTTTGCTGAGGGCATGGACATGGTCACGGTAG  van-0.fa
 
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  chr1.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACANCCTCTTGGCCATTGTACAAGTGAAC  bay-0.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  bor-4.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  br-0.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  bur-0.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  c24.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  col-0.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  cvi-0.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  est-1.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  fei-0.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGNCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGANC  got-7.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  ler-1.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  lov-5.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  nfa-8.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  rrs-10.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  rrs-7.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  sha.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  tamm-2.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  ts-1.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCNAGTAGAAACAGCCTCTTGGCCATTGTACAAGNNNNN  tsu-1.fa
48665  GTACTAACGACAGAGTCAGACTTGGTAAGGAGCTTGATAAAGCCAGTAGAAACAGCCTCTTGGCCATTGTACAAGTGAAC  van-0.fa
 
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACCTAGTATCATATCTTCATACA  chr1.fa
48745  AANACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACCTAGTATCATATCTTCATACA  bay-0.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTANCNNNNNNNNNNNNTTCATACA  bor-4.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACCTAGTATNNNNNNTTCATACA  br-0.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACCTAGTATCATATCTTCATACA  bur-0.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACCTAGTATCATATCTTCATACA  c24.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACCTAGNNNNNNNNNNTCATACA  col-0.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACCTAGTATCATATCTTCATACA  cvi-0.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACNNNNNNNNNNNNNTTCATACA  est-1.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACCTAGTATCATATCTTCATACA  fei-0.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGANNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTNNNNNNNNNNNNNNNNTCATNCA  ler-1.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTANNNNNNNNNNNNNNNNNATACN  lov-5.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACCTAGTATCATATCTTCATACA  nfa-8.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACNNNNNNNNNNNNCTTCATACA  rrs-10.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTNNNNNNNNNNNNNNCTTCATACA  rrs-7.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACCTNGTATCATATCTTCATACA  sha.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACNNNNNNNNNNNNNNNCATACA  tamm-2.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACCNNNNNNNNNNNCTTCATACA  ts-1.fa
48745  NNAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
48745  AAAACCAAACATCTTGCCTCGGTAATACATTTGAGCACACATGTCTTCGAAAGATCTACCTNGTNTNNNNNCNTCATACA  van-0.fa
 
48825  ACTCCAATCCTTCCTCTTTGGTTATCAACTATTTCAAATTACTTAAATCAATACAACAAATCTCACAACTTGTAAAATTC  chr1.fa
48825  ACTCCAATCCTTCCTCTTTGGTTATCAACTATTTCAAATTACTTAAATCNNNNNNACAAATCTCACAACTTGTAAAATTC  bay-0.fa
48825  ACTCCAATCCTTCCTCTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAATCTCACANCNNNNNNNNNNC  bor-4.fa
48825  ACTCCAATCCTTCCTCTTTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAAATCTCACAACTTGTAAAATTC  br-0.fa
48825  ACTCCAATCCTTCCTCTTTGGTTATCAACTATTTCAAATTACTTAAATCAANACAACAAATCTCACAACTTGTAAAATTC  bur-0.fa
48825  ACTCCAATCCTTCCTCTTTGGTTATCAACTATTTCAAATTNNNNNNNNNNNNNNNACAAATCTCACAACTTGTAAAATTC  c24.fa
48825  ACTCCAATCCTTCCTCTTTGGTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNAATCTCNCAACTTGTAAAATTC  col-0.fa
48825  ACTCCAATCCTTCCTCTTTGGTTATCAACNNNNNNNNNNNNNNNNNNNNNNNNNNACAAATCTCACAACTTGTAAAATTC  cvi-0.fa
48825  ACTCCAATCCTTCCTCTTTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAAATCTCACAACTTGTAAAATTC  est-1.fa
48825  ACTCCAATCCTTCCTCTTTGGTTATCAACTATNNNNNNNNNNNNNNNNNNNNNNNACAAATCTCACAACTTGTAAAATTC  fei-0.fa
48825  NNNCCAATCCTTCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
48825  ACTCCAATCCTTCCTCTNTGGTTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAATCTCNCAACTTGTAAAATTC  ler-1.fa
48825  NNNNNAATCCTTCCTCTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANTCTNANAANTTGTNNNNTTC  lov-5.fa
48825  ACTCCAATCCTTCCTCTTTGGTTATCAACTNNNNNNNNNNNNNNNNNNNNNNNNNACAAATCTCACAACTTGTAAAATTC  nfa-8.fa
48825  ACTCCAATCCTNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
48825  ACTCCAATCCTTCCTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCTCACAACTTGTAANATTC  rrs-7.fa
48825  ACTCCAATCCTTCCTCTTTGGTTNTNNANNNNNNNNNNNNNNNNNNNNNNNNNNNACAAATCTCACAACTTGTAAAATTC  sha.fa
48825  ACTCCAATCCTTCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAATNNNNNANNNNNNNAAATNC  tamm-2.fa
48825  ACTCCAATCCTTCCTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNCAACTTGTAAAATTC  ts-1.fa
48825  NNNCCAATCCTTCCNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
48825  ACTCCAATCCTTCCTCTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAATCTCACAACTTGTAAAATTC  van-0.fa
 
48905  CAAAAGAAGGAGACGAGGAGAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  chr1.fa
48905  CAAAAGANNNNNNNNNNNNNAGGAAGCGTACCAGGCTGGTATTNTTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  bay-0.fa
48905  NAAAAGANNNNNNNNNNNAGAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  bor-4.fa
48905  CAAAAGANNNNNNNNNNGAGAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  br-0.fa
48905  CAAAAGAAGGNGANGANGAGAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  bur-0.fa
48905  CAAAAGANNNNNNNGANGAGAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  c24.fa
48905  CAAAAGANNNNNNNNNNGAGAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  col-0.fa
48905  CAAAAGANNNNNNNGANNAGAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  cvi-0.fa
48905  CAAAAGANNNNNNNNNNNNGAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  est-1.fa
48905  CAAAAGANNNNNNNNNNNNGAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  fei-0.fa
48905  NNAAAGAANNNNNNNNNNNNAGGAAGCGTACCAGGCTGGTATTATTGGTGGNTTGCTTCTCCTTGACAACTTCCTGGACA  got-7.fa
48905  CAAAAGANNNNNNNNNNNNNNGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  ler-1.fa
48905  NAAAAGANNNNNNNNNNNNNAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  lov-5.fa
48905  CAAAAGAAGGNGNNNNNNNGAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  nfa-8.fa
48905  CAAAAGAAGGAGACGANGAGAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  rrs-10.fa
48905  CAAAAGANNNNNNNNNNNNNAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  rrs-7.fa
48905  CAAAAGANNNNNNNNNNNNNAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  sha.fa
48905  CAAAAGANNNNNNNNNNNNNNGGAAGCGTACCAGGCTGGTATTNTTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  tamm-2.fa
48905  CAAAAGANNNNNNNNNNNNNAGGAAGCGTACCAGGCTGGTATTATTGGTGGNTTGCTTCTCCTTGACAACTTCCTGGACA  ts-1.fa
48905  NNAAAGANNNNNNNNNNNNNAGGAAGCGTACCAGGCTGGNATTATTGGTGGNTTGCTTCTCCTTGACAACTTCCTGGACA  tsu-1.fa
48905  CAAAAGAAGGNGANGANGAGAGGAAGCGTACCAGGCTGGTATTATTGGTGGATTGCTTCTCCTTGACAACTTCCTGGACA  van-0.fa
 
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGAGGGAACGGGTGGATCCGAGGAAAGA  chr1.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGAGNGAACGGGTGGATCCGAGNAAAGA  bay-0.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGAGGGAACGGGTGGATCCGAGGAAAGA  bor-4.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTNGAGTGATTGAGTCTGCGAAGGGAGAGNGAACGGGTGGATCCGAGGAAAGA  br-0.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGNNNNNNNGGGTGGATCCGAGGAAAGA  bur-0.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGAGGGAACGGGTGGATCCGAGGAAAGA  c24.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGAGGGAACGGGTGGATCCGAGGAAAGA  col-0.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAANNNNNNNNNNNCGGGTGGATCCGAGGAAAGA  cvi-0.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGANGGAACGGGTGGATCCGAGGAAAGA  est-1.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGAGGGAACGGGTGGATCCGAGGAAAGA  fei-0.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGNGAAGGGAGANGGAACGGGTGGATCCGAGGAAAGA  got-7.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGNNNNNNNNNGTGGATCCGAGGAAAGA  ler-1.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAANGGAGAGGGAACGGGTGGATCCGAGGAAAGN  lov-5.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGAGGGAACGGGTGGATCCGAGGAAAGA  nfa-8.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGAGNGAACGGGTGGATCCGAGGAAAGA  rrs-10.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGANGGAACGGGTGGATCCGAGGAAAGA  rrs-7.fa
48985  GAGACGACGGGANATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGAGGGAACGGGTGGATCCGAGGAAAGA  sha.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGNNNNNNNNNNNNNNTGGATCCGAGGAAAGA  tamm-2.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGANNNNNNNNNNNTGGATCCGAGGAAAGA  ts-1.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGAGGGNACGGGTGGATCCGAGGAAAGN  tsu-1.fa
48985  GAGACGACGGGAGATCGACGGGTGGCGTTGGAGTGATTGAGTCTGCGAAGGGAGAGGGAACGGGTGGATCCGAGGAAAGA  van-0.fa
 
49065  AGAAGGAGGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  chr1.fa
49065  AGAAGNAGGAGCNAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  bay-0.fa
49065  AGAAGGAGGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTNNN  bor-4.fa
49065  AGAAGNAGGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  br-0.fa
49065  AGAAGGAGGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTNN  bur-0.fa
49065  AGNNNNNNNNNNNNNCNNGATCGGGAGCAAGAGACGNNNNNNTTGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  c24.fa
49065  AGAAGNAGGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  col-0.fa
49065  AGAANGAGGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  cvi-0.fa
49065  AGAAGGAGGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  est-1.fa
49065  AGNNNNNNNNNNNNNCNNGATCGGGAGCAAGAGACGATTCTCTTGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  fei-0.fa
49065  AGAANNAGGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  got-7.fa
49065  ANNNNNNNGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGANCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  ler-1.fa
49065  NNNNNNNNGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGANCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  lov-5.fa
49065  AGAAGGAGGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  nfa-8.fa
49065  AGAAGGAGGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  rrs-10.fa
49065  AGAAGGAGGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTNNN  rrs-7.fa
49065  AGAAGNAGGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  sha.fa
49065  AGNNNNNNGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  tamm-2.fa
49065  AGANNNAGGAGCCAATCGGATCGGGAGCAAGAGACGATTCTCATGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  ts-1.fa
49065  NNNNNNNNNNNNNNNCNNGATCGGGAGCAAGAGACNNNNNNNTNNNNNNNNNNGCAGAGGAACCGTGGCAGTGAGCTTAG  tsu-1.fa
49065  AGAAGGAGGAGCCAATCGGATCGGGAGCAAGAGACGANTNNCTTGGGATCCATGCAGAGGAACCGTGGCAGTGAGCTTAG  van-0.fa
 
49145  TGGGAGCGAAAGCCGTCGCCAT   chr1.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   bay-0.fa
49145  ANGGAGCGAAAGCCGTCGCCAT   bor-4.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   br-0.fa
49145  NNNGAGCGAAAGCCGTCGCCAT   bur-0.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   c24.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   col-0.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   cvi-0.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   est-1.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   fei-0.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   got-7.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   ler-1.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   lov-5.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   nfa-8.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   rrs-10.fa
49145  NNNNAGCGAAAGCCGTCGCCAT   rrs-7.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   sha.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   tamm-2.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   ts-1.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   tsu-1.fa
49145  TGGGAGCGAAAGCCGTCGCCAT   van-0.fa
 
visited.