Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 50284 - 50954


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
50284  TTAGTCAAACAAACCGAAACCCAAATCTCCGTCACTCTCTTCTGCTGGCTCATCCTGCAATACCAAAATGAGATCAATTT  chr1.fa
50284  TTAGTCAAACAAACCNNNNNNNNANTCNRRRRRRRRNNCTTCTGCTGGCTCATCCTGCAATACCAAAATGAGATCAATTT  bay-0.fa
50284  TTAGTCAAACAAACCGAAACCCAAATCNRRRRRRRRNNCTTCTGCTGGCTCATCCTGCAATACCANNNNNNNNNNNNNNN  bor-4.fa
50284  TTAGTCAAACAAACCGAANNNNNAANCNRRRRRRRRCTCTTCTGCTGGCTCATCCTGCAATACCAAAATGAGANNNNNNN  br-0.fa
50284  TTAGTCAAACAAACCGAAACCCAAATCNRRRRRRRRCTCTTCTGCTGGCTCATCCTGCAATACCAAAATGAGATCAATTT  bur-0.fa
50284  TTAGTCAAACAAACCGAAACCNAANTCNRRRRRRRRCNCTTCTGCTGGCTCATCCTGCAATACCAAAATGAGATCAATTT  c24.fa
50284  TTAGTCAAACAAACCGAAACCCAAANCNRRRRRRRRCTCTTCTGCTGGCTCATCCTGCAATACCAAAANNNNNNNNNNNN  col-0.fa
50284  TTAGTCAAACAAACCGAAACCCAAATCNRRRRRRRRCNCTTCTGCTGGCTCATCCTGCAATACCAAAATGAGANNNNNNN  cvi-0.fa
50284  TTAGTCAAACAAACCGAAACCCAAATCNRRRRRRRRCTCTTCTGCTGGCTCATCCTGCAATACCAAAATNNNNNNNNNNN  est-1.fa
50284  TTAGTCAAACAAACCGAAACCCAAATCNRRRRRRRRNNCTTCTGCTGGCTCATCCTGCAATACCAAAATGAGATCAATTT  fei-0.fa
50284  TTAGTCAAACAAACCGAAACCCAAATCTRRRRRRRRCTCTTCTGCTGGCTCATCCTGCAATACCAAANNNNNNNNNNNNN  got-7.fa
50284  TTAGTCAAACAAACCGAAACCCAAANCNRRRRRRRRNNCTTCTGCTGGCTCATCCTGCAATACCAAAATNNNNNNNNNNN  ler-1.fa
50284  TTAGTCAAACAAACCGAAACCNAANNCNRRRRRRRRNNNTTCTGCTGGCTCATCCTGCAATACCAAANNNNNNNNNNNNN  lov-5.fa
50284  TTAGTCAAACAAACCGAAACCCAAATCNRRRRRRRRCNCTTCTGCTGGCTCATCCTGCAATACCAAAATGAGATCAATNN  nfa-8.fa
50284  TTAGTCAAACAAACCGAAACCCAAATCTRRRRRRRRCTCTTCTGCTGGCTCATCCTGCAATACCAAAATGNNNNNNNNNN  rrs-10.fa
50284  TTAGTCAAACAAACCGAAACCCAAANCNRRRRRRRRNTCTTCTGCTGGCTCATCCTGCAATACCAANNNNNNNNNNNNNN  rrs-7.fa
50284  TTAGTCAAACAAACCGAAACCNAAANCNRRRRRRRRNNNTTCTGCTGGCTCATCCTGCAATACCAAAATGAGATCAANNN  sha.fa
50284  TTAGTCAAACAAACCGAAANCCAAANCNRRRRRRRRNNNTTCTGCTGGCTCATCCTGCAATACCAANNNNNNNNNNNNNN  tamm-2.fa
50284  TTAGTCAAACAAACCGNAACCCAAANCNRRRRRRRRCNCTTCTGCTGGCTCATCCTGCAATACCAAAATNNNNNNNNNNN  ts-1.fa
50284  TTAGTCAAACAAACCGAAACCCAAANCNRRRRRRRRCNCTTCTGCTGGCTCATCCTGCAATACCANNNNNNNNNNNNNNN  tsu-1.fa
50284  TTAGTCAAACAAACCGAAACCCAAATCNRRRRRRRRCNCTTCTGCTGGCTCATCCTGCAATACCAAAATGAGATNNNNNN  van-0.fa
 
50364  TATATCACTTATTAGTTAGAAGAATGATTTCGTCTATCGTTGCTATTTCATTTACCTTCTTCTTCTCCTCAGCAGCAGGA  chr1.fa
50364  TATATCACTTATTAGTTAGAAGAATGATTTCGTCTATCGTTGCTATTTCATTTACCTTCRTRRRRRRRRRRRRNNCAGGA  bay-0.fa
50364  NNNNNNNNNNNNNNNNNNNNNNNATGATTTCGNCTATCGTTGCTNTTNNNNNNNNNNNNRNRRRRRRRRRRRRANNANNN  bor-4.fa
50364  NNNNNNNNNNNNNNNNNNNNAGAATGATTTCGNCTATCGTTGCTATTTCNNNNNNNNNNRNRRRRRRRRRRRRANCAGGA  br-0.fa
50364  TATATCNNNNNNNAGTTAGAAGAATGATTTCGTCTATCGTTGCTATTTCATTTACCNNCRTRRRRRRRRRRRRANCAGGA  bur-0.fa
50364  TATNNNNNNNNNNNNTTAGAAGAATGATTTCGNCTATCGTTGCTATTTCATTTACCNNNRTRRRRRRRRRRRRNNCAGGA  c24.fa
50364  NNNNNNNNNNNNNNNNNNNNNNAATGATTTCGTCTATCGTTGCTATTTCANNNNNNNNNRNRRRRRRRRRRRRANCAGGA  col-0.fa
50364  NNNNNNNNNNNNNNNNNNNNNGAATGATTTCGNCTATCGTTGCTATTTCATTTACCNNCRTRRRRRRRRRRRRANCAGNA  cvi-0.fa
50364  NNNNNNNNNNNNNNNNNNNNNNNATGATTTCGTCTATCGTTGCTATTTNNNNNNNNNNNRNRRRRRRRRRRRRANCAGGA  est-1.fa
50364  TANNNNNNNNNNNNNNNAGAAGAATGATTTCGTCTATCGTTGCTATTTCATNNNNNNNNRTRRRRRRRRRRRRNNCAGGA  fei-0.fa
50364  NNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCGTCTATCGTTGCTNTNNNNNNNNNNNNNRNRRRRRRRRRRRRAGCAGGA  got-7.fa
50364  NNNNNNNNNNNNNNNNNNNNNNAATGATNTCGTCTATCGTTGCTNTTTCANNNNNNNNNRNRRRRRRRRRRRRNNNNNNN  ler-1.fa
50364  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTCTATCGTTGCTATTTNNNNNNNNNNNRNRRRRRRRRRRRRNNNNNNN  lov-5.fa
50364  NNNNNNNNNNNNNNNNNNGAAGAATGATTTCGTCTATCGTTGCTATTTCATNNNNNNNNRNRRRRRRRRRRRRNNCAGGA  nfa-8.fa
50364  NNNNNNNNNNNNNNNNNNNNNNAATGATTTCGTCTATCGTTGCTATTTCATNNNNNNNNRTRRRRRRRRRRRRAGCAGGA  rrs-10.fa
50364  NNNNNNNNNNNNNNNNNNNNNGAATGATTTCGNCTATCGTTGCTATTTCANNNNNNNNNRNRRRRRRRRRRRRNNNNNNN  rrs-7.fa
50364  NNNNNNNNNNNNNNNNNNGAAGAATGATTTCGTCTATCGTTGCTATTTCATNNNNNNNNRNRRRRRRRRRRRRNNNNNNN  sha.fa
50364  NNNNNNNNNNNNNNNNNNNNNNNATGATTTCGTCTATCGTTGCTNTTTCNNNNNNNNNNRNRRRRRRRRRRRRNNNNNNN  tamm-2.fa
50364  NNNNNNNNNNNNNNNNNNNNNNNATGATTTCGTCTATCGTTGCTNTTTCANNNNNNNNNRNRRRRRRRRRRRRNNNAGNA  ts-1.fa
50364  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNRRRRRRRRRRRRNNNNNNN  tsu-1.fa
50364  NNNNNNNNNNNNNNNNNNNNNNAATGATTTCGTCTATCGTTGCTATTTCNNNNNNNNNNRNRRRRRRRRRRRRAGCAGGA  van-0.fa
 
50444  GCAGCTGCCGCACCACCGCCAGCAGCTGGAGCAGCAGCTGCAACCGGAGCACCACCTCCACCACCAGCACCAACGTTCAT  chr1.fa
50444  GCAGCNGCCGCACCACCGNCARRRRRRRRRRRNNNNNNNNCAANRNNRNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRR  bay-0.fa
50444  NNNNNNNNCGCACCACCGNCARRRRRRRRRRRNGCAGCNGCAACRGGRNCACCANNNRRRRRRRRRRRRRRRRRRRRRRR  bor-4.fa
50444  GCAGCTGCCGCACCACCGNCARRRRRRRRRRRNNNNNNNGCAANRGNRNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRR  br-0.fa
50444  GCAGCTGCCGCACCACCGCCARRRRRRRRRRRNGCAGCNGCAACRGGRNNACNNNNNRRRRRRRRRRRRRRRRRRRRRRR  bur-0.fa
50444  GCAGNNNNNGCACCACCGCCNRRRRRRRRRRRNNNNNNNNCAACRGNRNNACCNNNNRRRRRRRRRRRRRRRRRRRRRRR  c24.fa
50444  GCAGCNGCCGCACCACCGNCARRRRRRRRRRRNNCAGCNGCAACRGNRNNACCANNNRRRRRRRRRRRRRRRRRRRRRRR  col-0.fa
50444  GCAGCNGCCGCACCACCGNCARRRRRRRRRRRNGCAGCNGCAACRGGRNNACCANNNRRRRRRRRRRRRRRRRRRRRRRR  cvi-0.fa
50444  GCAGCTGCCGCACCACCGCCARRRRRRRRRRRNGNAGCNGCAACRGGRGCACCNNNNRRRRRRRRRRRRRRRRRRRRRRR  est-1.fa
50444  GCAGCNNNNNNACCACCGNCNRRRRRRRRRRRNNNNNNNNCAACRGGRNNNCCANNNRRRRRRRRRRRRRRRRRRRRRRR  fei-0.fa
50444  GCAGCTGCCGCACCACCGCCARRRRRRRRRRRNNNNNNNNNNNNRNNRNNNNCNNNNRRRRRRRRRRRRRRRRRRRRRRR  got-7.fa
50444  NNNNNNNNCGCACCACCGNCARRRRRRRRRRRNNNNNNNNCAACRGNRNNACNNNNNRRRRRRRRRRRRRRRRRRRRRRR  ler-1.fa
50444  NNNNNNNNNGCACCACCGNCNRRRRRRRRRRRNNNNNNNNCNACRGNRNNACCANNNRRRRRRRRRRRRRRRRRRRRRRR  lov-5.fa
50444  GCAGCNGCCGCACCACCGCCARRRRRRRRRRRNNNNNNNGCAACRGNRNNACCNNNNRRRRRRRRRRRRRRRRRRRRRRR  nfa-8.fa
50444  GCAGCTGCCGCACCACCGCCARRRRRRRRRRRNGCAGCTGCAACRGGRGCACCANNNRRRRRRRRRRRRRRRRRRRRRRR  rrs-10.fa
50444  NNNNNNNNCGCACCACCGCCARRRRRRRRRRRNNCNNNNGCAACRGGRGCACCNNNNRRRRRRRRRRRRRRRRRRRRRRR  rrs-7.fa
50444  NNNNNNNNNGCACCACCGNCNRRRRRRRRRRRNNNNNNNNCAACRNNRNNACCANNNRRRRRRRRRRRRRRRRRRRRRRR  sha.fa
50444  NNNNNNNNNGCACCACCGCCARRRRRRRRRRRNGNNGCNGCAACRGGRNNACCANNNRRRRRRRRRRRRRRRRRRRRRRR  tamm-2.fa
50444  GNNNNNNNCGCACCACCGNCNRRRRRRRRRRRNNNNNCNGCAACRGNRNNACCNNNNRRRRRRRRRRRRRRRRRRRRRRR  ts-1.fa
50444  NNNNNNGCCGCACCACCGNCARRRRRRRRRRRNNNNNNNNNAACRGGRNNACNNNNNRRRRRRRRRRRRRRRRRRRRRRR  tsu-1.fa
50444  GCAGCTGCCGCACCACCGCCARRRRRRRRRRRAGCAGCNGCAACRGGRGCACCANNNRRRRRRRRRRRRRRRRRRRRRRR  van-0.fa
 
50524  GATGAGATCAGTCACGTTACGTTTCTCAGCCATCTTGGCGAATAGCATTGGCCAGTATGACTCAATACTAACACCAGCAG  chr1.fa
50524  RRRGAGATCAGNRACRTTNCGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAATRRNAACACCAGCRR  bay-0.fa
50524  RRRGAGATCAGTRACRTTACGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAATRRTAACACCAGCRR  bor-4.fa
50524  RRRGAGATCAGTRACRTTACGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAATRRNAACACCAGCRR  br-0.fa
50524  RRRGAGATCAGTRACRTTACGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAATRRTAACACCAGCRR  bur-0.fa
50524  RRRGAGATCAGTRACRTTNCGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAATRRNAACACCAGCRR  c24.fa
50524  RRRGAGATCAGTRACRTTACGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAATRRTAACACCAGCRR  col-0.fa
50524  RRRGAGATCAGTRACRTTACGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAATRRNAACACCAGCRR  cvi-0.fa
50524  RRRGAGATCAGTRACRTTACGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAATRRNAACACCAGCRR  est-1.fa
50524  RRRGAGATCNGNRNCRTTACGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAATRRNAACACCAGCRR  fei-0.fa
50524  RRRGAGATCAGTRACRTTACGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAATRRTAACACCAGCRR  got-7.fa
50524  RRRGNNATCAGTRACRTTACGTTTNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCNATRRTANCACCAGCRR  ler-1.fa
50524  RRRGAGATCAGNRACRTTNCGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAANRRNANCACCAGCRR  lov-5.fa
50524  RRRGAGATCAGTRACRTTACGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAATRRTAACACCAGCRR  nfa-8.fa
50524  RRRGAGATCAGTRACRTTACGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAATRRTAACACCAGCRR  rrs-10.fa
50524  RRRGAGATCAGTRACRTTACGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAATRRNAACACCAGCRR  rrs-7.fa
50524  RRRGAGATCAGTRNCRTTNCGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAANRRNAACACCAGCRR  sha.fa
50524  RRRGAGATCAGTRACRTTACGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAANRRTAACACCAGCRR  tamm-2.fa
50524  RRRGAGATCAGTRACRTTNCGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAANRRNNACACCAGCRR  ts-1.fa
50524  RRRGNGATCAGNRNCRNTACGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNTNACTCNNNRRNANCACCAGCRR  tsu-1.fa
50524  RRRGAGATCAGTRACRTTACGTTTCRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRATGACTCAATRRTAACACCAGCRR  van-0.fa
 
50604  CTTTCACCAAGGTCGCGATTTTGTCAGCCTATCAACGACATAAACAAACACAAGTAAAGATCTTTACCCAATTCAAAACA  chr1.fa
50604  RTTTCACCAARGTRGNNATTNTGRRRNCCTATCAACGACANAAACAAANANNNNNNNNNNNNNNNRNNNAATTCAAAACA  bay-0.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCCTATCAACGACATAAACNNNNNNNNNNNNNNNNNNNNRNNNAATNNNNNNNN  bor-4.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCCTATCAACGANNNNNNCAANNNNNNNNNNNNNNNNNNRNNNAATTCAAAACA  br-0.fa
50604  RTTTCACCAARGTRNCGATTTTGRRRGCCTATCAACGACANAAACAAACACAAGNAANNNNNNNNRCCCAATNCAAAACA  bur-0.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCCTATCAACGACANAAACAANCACANNNNNNNNNNNNNRCCCAATTCAAAACA  c24.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCCTATCAACGACATAAACAANNNNNNNNNNNNNNNNNNRNNNAATTCNAAACA  col-0.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCCTATCAACGACATAAACAAANACNAGNNNNNNNNNNNRCCCAATTCAAAACA  cvi-0.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCCTATCAACGACATAAACANNNNNNNNNNNNNNNNNNNRNNNAATTCNAAACA  est-1.fa
50604  RTTTCACCNARGTRGNGATTTTGRRRGCCTATCAACGACATAAACAAACACAAGTAANNNNNNNNRCCCAATTCAAAACA  fei-0.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCCTATCAACGACANNNNCANNNNNNNNNNNNNNNNNNNRNNNNNTNNNNNNNN  got-7.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCNTNTCAACGACANANNNNNNNNNNNNNNNNNNNNNNNRNNNAATTCAAAACA  ler-1.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCCTATCAACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNAATTCNNNNNN  lov-5.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCCTATCAACGACANAAACAAANNNNNNNNNNNNNNNNNRCCCAATTCAAAACA  nfa-8.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCCTATCAACGACATAAACAANNNNNNNNNNNNNNNNNNRNNNAATTCAAAACA  rrs-10.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCCTATCAACGACATNAACANNNNNNNNNNNNNNNNNNNRNNNAATNNNNNNCA  rrs-7.fa
50604  RTTTCACCAARGNRGCGATTTTGRRRGCCTATCAACGACANNAACANNNNNNNNNNNNNNNNNNNRNCCAATTCAAAACA  sha.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCCTATCAACGACANANNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNN  tamm-2.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCCTATCAACGACANAAACAANNNNNNNNNNNNNNNNNNRNNNAATTCAAAACA  ts-1.fa
50604  RTTTCACNNARGTRGCGATTTTGRRRGCCTATCAACGANNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNN  tsu-1.fa
50604  RTTTCACCAARGTRGCGATTTTGRRRGCCTATCAACGACATAAACANNNNNNNNNNNNNNNNNNNRNNNAATTCAAAACA  van-0.fa
 
50684  CATTTAGACAGATACATAAAATACTTGTTCAATTCCTGACCAAATAATACTATACCAAATCCTTATCACTCCATAAGAAT  chr1.fa
50684  CATTTAGACAGATACATAAAATACTTGTTCAATTCCTGACCAAATAATACTATACCAAATCCTTATCACTCCATAAGAAT  bay-0.fa
50684  NNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAATTCCTGACCANNNNNNNNNNNNNNNNATCCTTATCANNNNNNNNNNNN  bor-4.fa
50684  CANNNNNNNNNNNNNNNNNNNNNNNTGTTCAATTCCTGACCAAANNNNNNNNNNNNAAATCCTTATCANNNNNNNNNNNN  br-0.fa
50684  CATTTAGACAGATACATAAAATACTTGTTCAATTCCTGACCAAATAATACTATACCAAATCCTTATCACTCCATAAGAAT  bur-0.fa
50684  CATTTNGACAGATACATAAAATACTTGTTCAATTCCTGACCAAATAATACTATACCAAATCCTTATCACTCCATAAGAAT  c24.fa
50684  CANNNNNNNNNNNNNNNNNNNNNNNTGTTCAATTCCTGACCAAANNNNNNNNNNCCAAATCCTTATCACNNNNNAAGANT  col-0.fa
50684  CATTTNGANAGNTNNANANNANACTTGTTCAATTCCTGACCAAATAATACTATACCAAATCCTTATCACTCCATAAGAAT  cvi-0.fa
50684  CANNNNNNNNNNNNNNNNNNNNNNNNNNTCAATTCCTGACCAAANNNNNNNNNNNNNAATCCTTATNNNNNNNNAAGAAN  est-1.fa
50684  CATTTNGNNANATACATAAAANACTTGTTCAATTCCTGACCAAATAATACTATACCAAATCCTTATCACTCCATAAGAAT  fei-0.fa
50684  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTCCTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
50684  CANNNNNNNNNNNNNNNNNNNNNNNTGTTCAATTCCTGACCAAANNNNNNNNNNNNNNNTCCTTATNNNNNNNNNNNNNN  ler-1.fa
50684  NNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAATTCCTGACCNNNNNNNNNNNNNNNNNNTCCTTANNNNNNNNNNNNNNN  lov-5.fa
50684  CATTNNNNNNNNNNNNNAAAATACTTGTTCAATTCCTGACCAAATAATNCTATACCAAATCCTTATCACNCCATAAGAAT  nfa-8.fa
50684  CANNNNNNNNNNNNNNNNNNNNNNNNNTTCAATTCCTGACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
50684  CNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAATTCCTGACCAAANNNNNNNNNNNNNNNNNCTTATNNNNNNNNNNNNNN  rrs-7.fa
50684  CATTNNNNNNNNNNNNNNNNNNNNNTGTTCAATTCCTGACCAAATNNNNNNATACCAAATCCTTATCACNNNNNAAGAAT  sha.fa
50684  NNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAATTCCTGACCANNNNNNNNNNNNNNNNATCCTTATCNNNNNNNNNNNNN  tamm-2.fa
50684  CNNNNNNNNNNNNNNNNNNNNNNNNNGTTCAATTCCTGACCAAANNNNNNNNNNNNNNATCCTTATCACNNNNNNNNNNN  ts-1.fa
50684  NNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAATTCCTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
50684  CANNNNNNNNNNNNNNNNNNNNNNNTGTTCAATTCCTGACCNNNNNNNNNNNNNNNNNNTCCTTATCNNNNNNNNNNANN  van-0.fa
 
50764  CATTTTCACTAAGTTTCTAACTATCAAGTCAAAAGAAACGGTTCCAAAACCCTACTGACTAAAGCAAAGAGACCAATCAA  chr1.fa
50764  CATTTTCACTAAGTTTRRRACTATCAAGTCAAAAGAAACGGTTCCAAAACCCTACTGACNAAAGCAAAGAGACCAATCAA  bay-0.fa
50764  NNNNNNNNNNNNNNNNRRRNNNNNNNNNNCAAAAGAAACGGTTCCANNNNNNNNNNNNNNNNNGCAAAGANACCAATCAN  bor-4.fa
50764  NNNNNNNNNNNNNNNNRRRACNATCNNNNNAAAAGAAACGGTTCCANNNNNNNNNNNNNNNNAGCAAAGANACNAANCAA  br-0.fa
50764  CATTTTCACTAAGTTTRRRACTATCAAGTCAAAAGAAACGGNTCCAAAACCCTACTGACTAAAGCAAAGAGACCAATCAA  bur-0.fa
50764  CATTTTCACTAAGTNTRRRACTATCAAGTCAAAAGAAACGGNTCCAANNNNNNNNNNNNNNNAGCAAAGAGACCAATCAA  c24.fa
50764  CANTNNNNNNNNNNNNRRRNNNNNNNNNNCAAAAGAAACGGNTCCAAAACCCTACTGACTAAAGCAAAGAGACCAATCAA  col-0.fa
50764  CATTTTCACTAAGTNNRRRACTATCAAGTCAAAAGAAACGGTTCCAAAACCCTACTGACTAAAGCAAAGAGACCAATCAA  cvi-0.fa
50764  NNNNNNNNNNNNNNNNRRRNNNNNNNNNTCAAAAGAAACGGTTCCAAAACCCTACTGACTAAAGCAAAGAGACCAANCAN  est-1.fa
50764  CATTTTCACTAAGNNNRRRACNATCAAGTCAAAAGAAACGGNTCCANNNNNNNNNNNNNNNNAGCAAAGAGACCAATCAA  fei-0.fa
50764  NNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNNAGAAACGGTTCCAAAACCCTACTGACTAAAGCAAAGANNNNNNNNNN  got-7.fa
50764  NNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNAAAGAAACGGNTCCAAAACCCTACTGACTAAAGCAAAGANACNAANCNN  ler-1.fa
50764  NNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNAAAGAAACGGTTCCAAAACCCTACTGACTAAAGCAANNNNNNNNNNNNN  lov-5.fa
50764  CATTTTCACTAAGNNNRRRACNATCAAGTCAAAAGAAACGGTTCCAAAACCCTACTGACTAAAGCAAAGAGACCAATCAA  nfa-8.fa
50764  NNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNAAAGAAACGGTTCCAAAACCCTACTGACTAAAGCAAAGAGACCAANCAA  rrs-10.fa
50764  NNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNAAAGAAACGGNTCNNNNNNNNNNNNNNNNNNNGCAAAGAGACCAATNNN  rrs-7.fa
50764  CATTTTCACNAANNNNRRRANNATCAAGNCAAAAGAAACGGTTCCANNNNNNNNNNNNNNNNAGCAAAGAGACCAANCAA  sha.fa
50764  NNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNAAAGAAACGGTTCCNNNNNNNNNNNNNNNNNAGCAAAGANACNAANCNN  tamm-2.fa
50764  NNNNNNNNNNNNNNNNRRRNNNANNNNNNNAAAAGAAACGGNTCCAAAACCCTACTGACTAAAGCAAAGANACNAANCAA  ts-1.fa
50764  NNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNAAGAAACGGTTCCNNNNNNNNNNNNNNNNNNGCAANNNNNNNNNNNNN  tsu-1.fa
50764  NNNNNNNNNNNNNNNNRRRNNNNNNNNGTCAAAAGAAACGGTTCCAAAACCCTACTGACTAAAGCAAAGAGACCAATCAA  van-0.fa
 
50844  GATTTAGAAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCGATACCCTCGTCCTCGAGGATCATAACAGCGT  chr1.fa
50844  GATTTAGAAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRANACCCTCRNCNRRRRRRRRRRRRRRRRRRR  bay-0.fa
50844  NNNNNNNAAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRTCCRRRRRRRRRRRRRRRRRRR  bor-4.fa
50844  GATTTAGAAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRTCCRRRRRRRRRRRRRRRRRRR  br-0.fa
50844  GATTTAGAAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRTCCRRRRRRRRRRRRRRRRRRR  bur-0.fa
50844  GATTTAGAAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRTCNRRRRRRRRRRRRRRRRRRR  c24.fa
50844  GANNNNNNAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRTCNRRRRRRRRRRRRRRRRRRR  col-0.fa
50844  GATTTAGAAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRTCCRRRRRRRRRRRRRRRRRRR  cvi-0.fa
50844  GNNNNNGNAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCNCRNCNRRRRRRRRRRRRRRRRRRR  est-1.fa
50844  GATTTAGAAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRTCCRRRRRRRRRRRRRRRRRRR  fei-0.fa
50844  NNNNNNNNNNNNNNCAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRNNCRRRRRRRRRRRRRRRRRRR  got-7.fa
50844  NNNNNNNNAATAGACAAGCAGGNGTCAAAGGAAAGATACCGTGATAGCRATACCCTNRNNNRRRRRRRRRRRRRRRRRRR  ler-1.fa
50844  NNNNNNNNNNNAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRNNCRRRRRRRRRRRRRRRRRRR  lov-5.fa
50844  GATTTAGAAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRTCCRRRRRRRRRRRRRRRRRRR  nfa-8.fa
50844  GATTTNGAAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRTCNRRRRRRRRRRRRRRRRRRR  rrs-10.fa
50844  NNNNNNNNAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRTCCRRRRRRRRRRRRRRRRRRR  rrs-7.fa
50844  GATTTNGAAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRNNCRRRRRRRRRRRRRRRRRRR  sha.fa
50844  NNNNNNNNAATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRTCNRRRRRRRRRRRRRRRRRRR  tamm-2.fa
50844  GNNNNNNNNANAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRTCNRRRRRRRRRRRRRRRRRRR  ts-1.fa
50844  NNNNNNNNNNNAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCNCRTCNRRRRRRRRRRRRRRRRRRR  tsu-1.fa
50844  GNNNNNNNNATAGACAAGCAGGAGTCAAAGGAAAGATACCGTGATAGCRATACCCTCRTCCRRRRRRRRRRRRRRRRRRR  van-0.fa
 
50924  AGCTGCAAGCAAGCTCTCCAACTGTCGACAT   chr1.fa
50924  RRRRRRRANCRANRTCTCCRACNGNCGACAT   bay-0.fa
50924  RRRRRRRAGCRAGRTCTCCRACNGNCGACAT   bor-4.fa
50924  RRRRRRRAGCRAGRTCTCCRACTGNCGACAT   br-0.fa
50924  RRRRRRRAGCRAGRTCTCCRACTGNCGACAT   bur-0.fa
50924  RRRRRRRANCRAGRTCTCCRACTGNCGACAT   c24.fa
50924  RRRRRRRAGCRAGRTCTCCRACNGTCGACAT   col-0.fa
50924  RRRRRRRAGCRAGRTCTCCRACTGNCGACAT   cvi-0.fa
50924  RRRRRRRAGCRAGRTCTCCRACTGTCGACAT   est-1.fa
50924  RRRRRRRANCRAGRTCTCCRACNGNCGACAT   fei-0.fa
50924  RRRRRRRANCRAGRTCTCCRNCTGTCGACAT   got-7.fa
50924  RRRRRRRANCRAGRTCTCCRANNGTCGACAT   ler-1.fa
50924  RRRRRRRNNNRAGRTCNCCRANNGNCGACAT   lov-5.fa
50924  RRRRRRRAGCRAGRTCTCCRACTGTCGACAT   nfa-8.fa
50924  RRRRRRRAGCRAGRTCTCCRACTGTCGACAT   rrs-10.fa
50924  RRRRRRRAGCRAGRTCTNCRACTGNCGACAT   rrs-7.fa
50924  RRRRRRRANNRAGRTCTCCRACNGNCGACAT   sha.fa
50924  RRRRRRRANCRAGRTCTCCRACNGTCGACAT   tamm-2.fa
50924  RRRRRRRANCRAGRTCTCCRACTGNCGACAT   ts-1.fa
50924  RRRRRRRNNCRAGRTCNCNRANNNNNGACAT   tsu-1.fa
50924  RRRRRRRAGCRAGRTCTCCRACTGNCGACAT   van-0.fa
 
visited.