Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 61905 - 63811


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
61905  TCAGTATTCCAGACTACATCCTCCAATCCAGATGTTTTTGTAGAACTGCAAAAGAGATTTAACTTTTAAGCATAGAAAAC  chr1.fa
61905  RRRRRRRRRRRRACTACATCCTCCAATCCAGATGTTTTTGTRRRRRRRRRAAAGAGATTTRACTTTTAAGCATNGAAAAC  bay-0.fa
61905  RRRRRRRRRRRRACTACATCCTCCAATCCAGATNNNNTNNNRRRRRRRRRNNNNNNNNNNRNNNNNNNNNNNNNNAAAAC  bor-4.fa
61905  RRRRRRRRRRRRACTACATCCTCCAATCCAGATGTTTTTGTRRRRRRRRRNANGAGANNNRNNNNNNNNNCATAGAAAAC  br-0.fa
61905  RRRRRRRRRRRRACTACATCCTCCAATCCAGATGTTTTTGTRRRRRRRRRAAAGAGATTTRACTTTTAAGCATAGAAAAC  bur-0.fa
61905  RRRRRRRRRRRRNNNNNNNNNNNNNNNCCAGATGTTTTNGNRRRRRRRRRNANNAGANNNRNNNNNNNNNNNNNNNNNNT  c24.fa
61905  RRRRRRRRRRRRACTACATCCTCCAATCCAGATGTTTTTGTRRRRRRRRRAANGANNNNNRNNNNNNNNNCATAGAAAAC  col-0.fa
61905  RRRRRRRRRRRRACTACATCCTCCANTACAGATGTTTTTGTRRRRRRRRRAANGAGATTNRNNNTTNAAGCATAGAAAAC  cvi-0.fa
61905  RRRRRRRRRRRRACTACATCCTCCAATCCAGATGTTTTTGTRRRRRRRRRNNNNNNNNNNRNNNNNNNNGCATAGAAAAC  est-1.fa
61905  RRRRRRRRRRRRACTACATCCTCCAATCCAGATGTTTTTGTRRRRRRRRRAAAGAGATTNRANNTTTAAGCATAGAAAAC  fei-0.fa
61905  RRRRRRRRRRRRACNACATCCTCCAATCCAGATGTTTTTGNRRRRRRRRRNNNNNNNNNNRNNNNNNNNNNNNNNNNAAC  got-7.fa
61905  RRRRRRRRRRRRACTACATCCTCCAATCCAGATGTTTTTGTRRRRRRRRRNNNNNNNNNNRNNNNNNNNNCATAGAAAAC  ler-1.fa
61905  RRRRRRRRRRRRACTACATCCTCCAATCCAGATGTNTTNGNRRRRRRRRRNNNGNNNNNNRNNNNNNNNNNNNNNAAAAC  lov-5.fa
61905  RRRRRRRRRRRRACTACATCCTCCAATCCAGATGTTTTTGTRRRRRRRRRAAAGAGANNNRNNNTTTNAGCATAGAAAAC  nfa-8.fa
61905  RRRRRRRRRRRRACTACATCCNNNNNNNCAGANNNNNNNGNRRRRRRRRRANNNNNNNNNRNNNNNNNNNCATAGAAAAC  rrs-10.fa
61905  RRRRRRRRRRRRACTACATCCTCCAATCCAGATGTTTTTGTRRRRRRRRRNANNNNNNNNRNNNNNNNNNNNNAGAAAAC  rrs-7.fa
61905  RRRRRRRRRRRRACTACATCCTCCAATCCAGATGTTTTTGTRRRRRRRRRAANGAGANNNRNNNTTNAAGCATAGAAAAC  sha.fa
61905  RRRRRRRRRRRRACNACATCCTCCAATCCAGATGTTTTNGTRRRRRRRRRNANNNNNNNNRNNNNNNNNNCATANAAAAC  tamm-2.fa
61905  RRRRRRRRRRRRACNACATCCTCCAATCCAGATGTTTTTGNRRRRRRRRRAANGNNNNNNRNNNNNNNNNCATAGAAAAC  ts-1.fa
61905  RRRRRRRRRRRRACTACATCCTCCAATCCAGATGTTTTNGNRRRRRRRRRNNNNNNNNNNRNNNNNNNNNNNNNNNNAAC  tsu-1.fa
61905  RRRRRRRRRRRRACTACATCCTCCAATCCAGATGTTTTTGNRRRRRRRRRAANNNNNNNNRNNNNNNNNNCATAGAAAAC  van-0.fa
 
61985  CGAATTACAACAAATAAAATTAGAGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAATATACCTTGTGAAACTCGAG  chr1.fa
61985  CGAATTACAACAAANAAARTTAGAGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAATATACCTTGTGRRRRRRGAG  bay-0.fa
61985  CGNNNNNNNNNNNNNNNNRNNNNNNGTAACTGAACCGGTTGGTAAAGATNAAACCGAAAATATACCTTGTGRRRRRRGAG  bor-4.fa
61985  CGNNNNNNNNNNNNNNNNRNNNNAGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAATATACCTTGTGRRRRRRGAG  br-0.fa
61985  CGAATTACAACAAATAAARTTAGAGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAATATACCTTGTGRRRRRRGAG  bur-0.fa
61985  NNNNNNNNNNNNNNNNNARNNAGAGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAANANACCTNGTGRRRRRRGAG  c24.fa
61985  CGAANNNNNNNNNNNNNNRNNNNAGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAATATACCTTGTGRRRRRRGAG  col-0.fa
61985  CGAATNACAACAAANNNNRNNNGAGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAATATACCTTGTGRRRRRRGAG  cvi-0.fa
61985  CGNNNNNNNNNNNNNNNNRNNNNNGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAATATACCTTGTGRRRRRRGAG  est-1.fa
61985  CGAATTACAACAAANNNARNNAGAGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAATATACCTTGTGRRRRRRGAG  fei-0.fa
61985  CGANNNNNNNNNNNNNNNRNNNNNGGTAACTGAACCGGTTGGTAAAGATNAANNNNNNNNNNNNCCTTGTGRRRRRRGAG  got-7.fa
61985  CGAATNNNNNNNNNNNNNRNNNNNGGTAACTGAACCGGTTGGTAAAGATTNAACCGAAAATATACCTTGTGRRRRRRGAG  ler-1.fa
61985  CGANNNNNNNNNNNNNNNRNNNNNGGTAACTGAACCGGTTGGTAAAGNNNNNNNCGAAAATATACCTTGTGRRRRRRGAG  lov-5.fa
61985  CGAATNANNNCAAANNNNRNNNGAGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAATATACCTTGTGRRRRRRGAG  nfa-8.fa
61985  CGAATNNNNNNNNNNNNNRNNNGAGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAANATACCTTGTGRRRRRRGAG  rrs-10.fa
61985  CGNNNNNNNNNNNNNNNNRNNNGAGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAATATACCTTGTGRRRRRRGAG  rrs-7.fa
61985  CGAATTACAACANNNNNNRNNNGAGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAATATACCTTGTGRRRRRRGAG  sha.fa
61985  CGNNNNNNNNNNNNNNNNRNNNNAGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAATATACCTTGTGRRRRRRGAG  tamm-2.fa
61985  CGAATNNNNNNNNNNNNNRNNNNNGGTAACTGAACCGGTTGGTAAAGATNAAACCGAAAATATACCNNGNNRRRRRRGNN  ts-1.fa
61985  CGNNNNNNNNNNNNNNNNRNNNNNGGTAACTGAACCGGTTGGTAAAGNNNNNNNNNNNNNNNNNNCTTGTGRRRRRRGAG  tsu-1.fa
61985  CGNNNNNNNNNNNNNNNNRNNNNNGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAAATATACCTTGTGRRRRRRGAG  van-0.fa
 
62065  GGTATCATCGCCGGTTTTCCTAAGCTCTACCACGTGCAACGATGGTGCCACTTCAAACACCTATTATAACCGATAACCAA  chr1.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTATAACCGANANNCNA  bay-0.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTNTAACCGANANNCNA  bor-4.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTATAACCGANANNCNA  br-0.fa
62065  GGTATCARCRCCGGTTTTNCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTATAACCGANANNCNA  bur-0.fa
62065  GGTNNCNCCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGCGCCACTRRAAACACCTATTATAACCGATAACCAA  c24.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTATAACCGANAACCAA  col-0.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTATAACCGANAACCNA  cvi-0.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTATAACCGANANNCNA  est-1.fa
62065  GGTATCNRCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTATAACCGATAACCNA  fei-0.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAANCACNNNNNNNNNNNNNNANNCNN  got-7.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTATAACNNNNNNNCNA  ler-1.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCNCTRRAAACACCTATNANAACCGANANNCNN  lov-5.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTATAACCGANANNCNA  nfa-8.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTANAACCGANANNCNA  rrs-10.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTATAACCGANANNCNN  rrs-7.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTATAACCGANANNCNA  sha.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTATAACCNNNNNNCAA  tamm-2.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTATNACNNNNNNNNNA  ts-1.fa
62065  GGTANNARCRCCNGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACANNNNNNNNNNNNNNNNNNNAN  tsu-1.fa
62065  GGTATCARCRCCGGTTTTCCRRRRRRRTACCACGTGCAACGATGGTGCCACTRRAAACACCTATTATAACCNNNNNNNNA  van-0.fa
 
62145  ACCAAAATAATCAGGTACCGGCCGTATTCATGAAAATCTAAAACCGTACTAAACCGGAATGTTATCATTCCTATCTGTTT  chr1.fa
62145  ACCAAAANAATCAGGTACCGGCCGTATTCATGAAAATCTAAAACCGNACTAAACCGGAATNNNNNNNTTCCTATCTGTTT  bay-0.fa
62145  ACCAAAANAATCAGGTACCGGCCGTATTCATGAANATCTAAAACCGNACTAAACCGGAANNNNNNNNNNNNNNNNNNNNN  bor-4.fa
62145  ACCAAAANAATCAGGTACCGGCCGTATTCATGAAAATCTAAAANNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  br-0.fa
62145  ACCAAAATAATCAGGTACCGGCCGTATTCATGAAAATCTAAAACCGNNNNTNNCCGGNNNNNNNTCATTCCTATCTGTTT  bur-0.fa
62145  ACCAAAATAATCAGGTACCGGCCGTANNNNNCNNNNNNNNAAACCGNACTAAACCGGAATNNNNNNNNNNCTNTCTGTTT  c24.fa
62145  ACCAAAANAATCAGGTACCGGCCGTATTCATGAAAATCTAAAACCGNACTAAACCGGANNNNNNNNNNNNNNNNNNGTTT  col-0.fa
62145  ACCAAAATAATCAGGTACCGGCCGTATTCATGAAAATCTAAAACCGTACTAAACCGGAATNNNNNNNNNNCTATCTGTTT  cvi-0.fa
62145  ACCAAAANAATCAGGTACCGGCCGTATTCATGAAAATCTAAAACCGNACTAAACCGGAANNNNNNNNNNNNNNNNNNNNN  est-1.fa
62145  ACCAAAATAATCAGGTACCGGCCGTATTCATGAAAATCTAAAACCGNNNNNNNNNNNNNNNNNNNCATTCCTATCTGTTT  fei-0.fa
62145  NNNNNNNNNNNCAGGTACCGGCCGTATTCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
62145  ACCAAAANAATCAGGTACCGGCCGTATTCATGAAAATCTAAAACCGNACTAAACCGGNNNNNNNNNNNNNNNNNNNNNTT  ler-1.fa
62145  NNNANNANAATCAGGTACCGGCCGTATTCATGAAAATCTAAAANNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
62145  ACCAAAANAATCAGGTACCGGCCGTATTCATGAAAATCTAAAACCGNACTAAACCGGAANNNNNNNNNNNCTATCTGTTT  nfa-8.fa
62145  NNCNNNNNAATCAGGTACCGGCCGTATTCNNNNNNNNNNNNNNNNNNNNTAAACCGGNNNNNNNNNNNNNNNNNNNNNNT  rrs-10.fa
62145  NNNANNANAATCAGGTACCGGCCGTATTCATGAAAATCTAAAACCGNACTAAACCGGNNNNNNNNNNNNNNNNNNNNNTT  rrs-7.fa
62145  ACCAAAANAATCAGGTACCGGCCGTATTCATGAAAATCTAAAACCGNACTAAACCGGANNNNNNNNNNNNCNATCTGTTT  sha.fa
62145  ACCAAAANAATCAGGTACCGGCCGTATTCATGAAAATCTAAAACCGNACTAAACCGGANNNNNNNNNNNNNNNNNNNTTT  tamm-2.fa
62145  ACCAAAANAATCAGGTACCGGCCGTATTCATGAAAATCTAAAACCGNACTAAACCGGNNNNNNNNNNNNNNNNTCTGTTT  ts-1.fa
62145  NCNANNNNNNNCAGGTACCGGCCGTATTCATGAAANNNNNNNACCGNACTAAACCGNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
62145  NNCNAAATAATCAGGTACCGGCCGTATTCATGAAAATCTAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTT  van-0.fa
 
62225  TTGTTCATAACTCTGTAGCTACAGAGTGCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGAAATTTACTTAAACAAT  chr1.fa
62225  TTGTTCATAACTNNNNNNNNNNRNNNRGCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARTTTRRRRRRNRNRN  bay-0.fa
62225  TTGTTCATAANNNNNNNNNNNNRNNNRGCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARNNNRRRRRRNRNRN  bor-4.fa
62225  TTGTTCATAACTNNNNNNNNNNRNNNRGCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARTTTRRRRRRNRNRN  br-0.fa
62225  TTGTTCATAACTCNNNNNNNNNRNNNRGCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARTTTRRRRRRNRNRN  bur-0.fa
62225  TTGTTCATAACTCNNNNNNNNNRNNNRNNNNNNNNNNNNNNNNNNNNNCCACTTTTGTCNNNNNNRNNNRRRRRRNRNRN  c24.fa
62225  TTGTTCATAACTNNNNNNNNNNRNNNRGCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARTNNRRRRRRNRNRN  col-0.fa
62225  TTGTTCATAACTCNNNNNNNNNRGAGRGCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARTTTRRRRRRNRNRN  cvi-0.fa
62225  TTGTTCATAACTNNNNNNNNNNRNNNRGCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARTTTRRRRRRNRNRN  est-1.fa
62225  TTGTTCATAACTCNNNNNNNNNRNNNRNCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARTTTRRRRRRNRNRN  fei-0.fa
62225  NNNNNNNNNNNNNNNNNNNNNNRNNNRNCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGANRNNNRRRRRRNRNRN  got-7.fa
62225  TTGTTCATAACNNNNNNNNNNNRNNNRGCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARTTTRRRRRRNRNRN  ler-1.fa
62225  NNGTTCATNNNNNNNNNNNNNNRNNNRGCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARNNNRRRRRRNRNRN  lov-5.fa
62225  TTGTTCATAACTNNNNNNNNNNRNNNRNNTGACNANNNCGAGTTACGACCACTTTTGTCTGCGAARTTTRRRRRRNRNRN  nfa-8.fa
62225  NTGTTCATAACNNNNNNNNNNNRNAGRGCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARTNNRRRRRRNRNRN  rrs-10.fa
62225  TTGTTCATAANNNNNNNNNNNNRNNGRGCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARNNTRRRRRRNRNRN  rrs-7.fa
62225  TTGTTCATAACNNNNNNNNNNNRNNNRNNNGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARTTTRRRRRRNRNRN  sha.fa
62225  TTGTTCATAACNNNNNNNNNNNRNNNRNNNGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARNTNRRRRRRNRNRN  tamm-2.fa
62225  TTGTTCATAACNNNNNNNNNNNRNNNRNNNGACNANNNCGAGTTACGACCACTTTTGTCTGCGAARTTNRRRRRRNRNRN  ts-1.fa
62225  NNNNNNNNNNNNNNNNNNNNNNRNNNRNNNGACCTTTACGAGTTACGACCACTTTTGTCTGCGNNRNNNRRRRRRNRNRN  tsu-1.fa
62225  TTGTTCATAACTCNNNNNNNNNRNAGRGCTGACCTTTACGAGTTACGACCACTTTTGTCTGCGAARTTNRRRRRRNRNRN  van-0.fa
 
62305  GTTTAACAAAGACACAACAACATTAATTGACACAGAGAAATCAAGAAGAAGAAGAAGAAGAAGAAGAACAAACCTTGTAG  chr1.fa
62305  NNTTAACAAAGACACAACAACATTAATTGACACAGAGAAATCNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTGTAG  bay-0.fa
62305  NNNNAACAAAGACANAACAACATTAATNGACACAGAGAANNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNAG  bor-4.fa
62305  NNNNAACAAAGACNCAACAACATTAATTGACACAGAGAANNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTNNAG  br-0.fa
62305  GTTTAACAAAGACACAACAACATTAATTGACACAGAGAAATNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTGTAG  bur-0.fa
62305  NNTTAACAAAGNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNN  c24.fa
62305  NNNNAACAAAGACACAACAACATTAATTGACACAGAGAANNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNGTAG  col-0.fa
62305  NNTTAACAAAGACACAACAACATTAATTGACACAGAGAAATNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTGTAG  cvi-0.fa
62305  NNNTAACAAAGACNCAACAACATTAATTNACACAGAGAAANNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNGTAG  est-1.fa
62305  NNTTAACAAAGACACAACAACATTAATTGACACAGAGAAATNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTGTAG  fei-0.fa
62305  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNGAGANNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNAG  got-7.fa
62305  NNNNNACAAANNNNNNNNNNNNNNAATTGACACAGAGAANNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNN  ler-1.fa
62305  NNNNNNCAAAGNNNNNNNNNNNNNNNNNGANNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNN  lov-5.fa
62305  NNNTAACAAAGACACAACAACATTAATTGNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNGTAG  nfa-8.fa
62305  NNTTAACAAAGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNN  rrs-10.fa
62305  NNNNAACAAAGACACAACAACATTAATNGACACAGAGAANNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNGNAG  rrs-7.fa
62305  NNNNAACAAAGACACAACAACATTAATTGACACAGAGAANNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTGTAG  sha.fa
62305  NNNNNACAAAGACANAACAACATTAATTGACACAGAGANNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNAG  tamm-2.fa
62305  NNNNNACAAAGACANNNNNACATTAATTGNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNAG  ts-1.fa
62305  NNNNNNNNNNNNNNNNNNNNNATTNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNN  tsu-1.fa
62305  NNNNAACAAAGACACAACAACATTAATTGACACAGAGAANNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTGTAG  van-0.fa
 
62385  TTGTCTTGTTGAAATCATGAATCCTTGATTAAATTTCTATAAGAAGAAAAGTTTCAGTGAGAAGAAGATCATAGCAAAGA  chr1.fa
62385  TTGTCTTGTTGAAATCATGAATCCTTGATTAAATTTCTATAAGAAGAAAAGTTTCAGNGARRRRRRRRRCNNAGCAAANN  bay-0.fa
62385  TTGTCTTGTTGAAATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGTTTCAGNNNRRRRRRRRRNANAGCAAAGA  bor-4.fa
62385  TTGTCTTGTTGAAATCATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTTCAGNNNRRRRRRRRRNNNNGCAAAGA  br-0.fa
62385  TTGTCTTGTTGAAATCATGAATCCTTNNNNNNNNNNNNNNNNNNNNAAAAGTTTCAGTGARRRRRRRRRCNNAGCAAAGA  bur-0.fa
62385  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAAGTTTCAGNGNRRRRRRRRRCANAGCAAAGA  c24.fa
62385  TTGTCTTGTTGAAATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGTTTCAGNGNRRRRRRRRRNNNAGCAAAGA  col-0.fa
62385  TTGTCTTGTTGAAATCATGAATCCTTGATNNNNNNNNNNNNNNNAGAAAAGTTTCAGNGNRRRRRRRRRCANAGCAAAGA  cvi-0.fa
62385  TTGTCTTGTTGAAATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGTNTCAGNGNRRRRRRRRRCNNAGCAAAGA  est-1.fa
62385  TTGTCTTGTTGAAATCATGAATCNNNNNNNNNNNNNNNNNNNNNNNNAAAGTTTCAGNNNRRRRRRRRRCNNAGCAAAGA  fei-0.fa
62385  TTGNNNNNNNNNNNTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRNNNNNCAAAGA  got-7.fa
62385  NNGTCTTGTTGAAATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTNCAGNNNRRRRRRRRRNNNAGCAAAGA  ler-1.fa
62385  NNNNNNNNTNGAAATCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRNNNAGCAAAGA  lov-5.fa
62385  TTGTCTTGTTGAAATCATGANNNNNTNANNNNNNNNNNNNNNNNNNAAAAGTTTNNNNNNRRRRRRRRRNNNAGCAAAGA  nfa-8.fa
62385  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNTTCAGTNNRRRRRRRRRCNNAGCAAAGA  rrs-10.fa
62385  TTGTCTTGTTGAAATCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTTCAGTNARRRRRRRRRNANAGCAAAGA  rrs-7.fa
62385  TTGTCTTGTTGAAATCATGAATCCTTGANNNNNNNNNNNNNNNNAGAAAAGTTTCNGNGNRRRRRRRRRNANAGCAAAGA  sha.fa
62385  TTGTCTTGTTGAAATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGTTTCAGNGARRRRRRRRRNNNAGCAAAGA  tamm-2.fa
62385  TTGTCTTGTTGAAATCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNRRRRRRRRRNNNNGCAAAGA  ts-1.fa
62385  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRNNNNNNANNNN  tsu-1.fa
62385  TTGTCTTGTTGAAATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTTCAGTGARRRRRRRRRCNNAGCAAAGA  van-0.fa
 
62465  TGAGAAGAGCAAGTCAAAGAAGATATTGGGCTTGTTGTCTTGTAATAAGTAATTGGGCTAATTGCTATGTTAGTCCCATA  chr1.fa
62465  NNNGAAGAGCAAGTCAAAGAARRRRRTNGGCTTGTTGRRTTGTRRRRRRRRRRRGGGCTAATTGRTATGTTAGTCCCATA  bay-0.fa
62465  TGAGAAGAGCAAGTCANANNNRRRRRTGGGCTTGTTGRRNNNNRRRRRRRRRRRNNNCTAATTGRTATGTTAGTNNNNNN  bor-4.fa
62465  NGAGAAGAGCAAGTCAAAGAARRRRRTGGGCTTGTTGRRNNNNRRRRRRRRRRRGGGCTAATTGRTATGTTAGTCCCATA  br-0.fa
62465  TGAGAAGAGCAAGTCAAAGANRRRRRTGNGCTTGTTGRRTTGNRRRRRRRRRRRGGGCTAATTGRTATGTTAGTCCCATA  bur-0.fa
62465  TGAGAAGAGCAAGTCAAAGAARRRRRTGGGCTTGTTGRRTTGNRRRRRRRRRRRNNNCTAATTGRNNNNNNNNNNNNNNN  c24.fa
62465  TGAGAAGAGCAAGTCAAANNARRRRRTGGGCTTGTTGRRTTNNRRRRRRRRRRRNGGCTAATTGRTATGTTAGTNNNNNN  col-0.fa
62465  TGAGAAGAGCAAGTCAAAGAARRRRRTGGGCTTGTTGRRTTGNRRRRRRRRRRRGGGCTAATTGRTATGTTAGTCCCATA  cvi-0.fa
62465  TGAGAAGAGCAAGNCAAAGNARRRRRTGGGCTTGTTGRRNNNNRRRRRRRRRRRNNGCTAATTGRTNNGTTAGNNNNNNN  est-1.fa
62465  TGAGAAGAGCAAGTCAAAGAARRRRRTGGGCTTGTTGRRTTGTRRRRRRRRRRRGGGCTAATTGRTATGTTAGTCCCATA  fei-0.fa
62465  TGAGAAGANNNNNNNNNANNNRRRRRTNGGCTTGNNNRRNNNNRRRRRRRRRRRNNNNNANNNNRTNNGTNNNNNNNNNN  got-7.fa
62465  NGAGAAGAGCAAGNCNNNNNNRRRRRNGNGCTTGTTGRRNNNNRRRRRRRRRRRNNNCTAANNGRTATGTTAGTCCNNNN  ler-1.fa
62465  NGAGAAGAGNNNNNNNNNNNNRRRRRNNNNNTTGNNGRRNNNNRRRRRRRRRRRNNNNNAANNNRNNNGTTAGNNNNNNN  lov-5.fa
62465  TGAGAAGAGCAAGTCAAAGAARRRRRTGGGCTTGTTGRRTNNNRRRRRRRRRRRNNNCTAATNNRNNNNNNNNNNNNNNN  nfa-8.fa
62465  TGAGAAGANCAAGTCAAAGNARRRRRTGGGCTTGTTGRRTNNNRRRRRRRRRRRNNGCTAATTGRTATGTTAGNCNNANN  rrs-10.fa
62465  TGAGAAGAGCAAGNCAAANNNRRRRRTGNGCTTGTTGRRTNNNRRRRRRRRRRRNNGCTAATTGRTATGTTAGTCCNNNN  rrs-7.fa
62465  TGAGAAGAGCAAGTCAAAGAARRRRRTGGGCTTGTTGRRNNGTRRRRRRRRRRRGGGCTAATTGRTATGTTAGTCCCATA  sha.fa
62465  TGAGAAGAGCAAGTCAAANNNRRRRRNGNGCTTGTTGRRNNNNRRRRRRRRRRRNNNCTAATNGRTATGTTAGTCCNNNN  tamm-2.fa
62465  TGAGAAGAGCAANNNNNANAARRRRRNNNGCTTGTNNRRNNNNRRRRRRRRRRRNNNCTAANNNRNNNNNNNNNNNNNNN  ts-1.fa
62465  NGAGAAGAGCANNNNNNNNNNRRRRRNNNGCTTGNNNRRNNNNRRRRRRRRRRRNNNNTNANNNRNNNNNNNNNNNNNNN  tsu-1.fa
62465  NGAGAAGAGCAAGNCAAAGNARRRRRTGGGCTTGTTGRRNNNNRRRRRRRRRRRGGGCTAATTGRTATGTTAGTCCNATN  van-0.fa
 
62545  TAAGTAAAGTGTTGTTTAAGTAAGTCAAGTCTAGGTTAGAGTAGTTGTTGTTAGAGTTCCAATACAAGTAGGAGGGTTGT  chr1.fa
62545  TAAGTAAAGTGTTGRRRRRRRRRRTCAAGTCTNGRRRNGAGTAGTTGTTGTTAGAGTRRRRRRACAAGTAGGNNNRRRRR  bay-0.fa
62545  NNNNNNNNNNNNNNRRRRRRRRRRNNNAGTCTAGRRRNGNNNNNNTGTTGTTAGAGNRRRRRRNNNAGTAGGANGRRRRR  bor-4.fa
62545  TAANNNNNNNNNNNRRRRRRRRRRNNNAGTCTAGRRRNGAGTAGTTGTTGTTAGAGTRRRRRRACAAGTAGGNGGRRRRR  br-0.fa
62545  TAAGTAAAGTGTNGRRRRRRRRRRTCAAGTCTAGRRRAGAGTAGTTGTTGTTAGAGTRRRRRRACAAGTAGGAGGRRRRR  bur-0.fa
62545  NNNNNNNNNNNNNNRRRRRRRRRRTCAAGTCTAGRRRAGAGTAGTTGTTGTTAGAGTRRRRRRACAAGTAGGAGGRRRRR  c24.fa
62545  NAANNNNNNNNNNNRRRRRRRRRRNNNAGTCNAGRRRNGAGTNGTTGTTGTTAGAGTRRRRRRACAAGTAGGAGGRRRRR  col-0.fa
62545  TAAGTAAAGTGNNNRRRRRRRRRRTCAAGTCTAGRRRAGAGTAGTTGTTGTTAGAGTRRRRRRACAAGTAGGAGGRRRRR  cvi-0.fa
62545  NNNNNNNNNNNNNNRRRRRRRRRRNNNAGTCTAGRRRNGAGTAGTTGTTGTTAGAGNRRRRRRNNAAGTAGGNGGRRRRR  est-1.fa
62545  TAAGTAAAGTGTNGRRRRRRRRRRTCNAGTCTAGRRRAGAGTAGTTGTTGTTAGAGTRRRRRRACAAGTAGGAGGRRRRR  fei-0.fa
62545  NNNNNNNNNNNNNNRRRRRRRRRRNNNAGTCTANRRRNNNNNNNNNGTNGTNAGNNNRRRRRRNNNAGTAGGNNNRRRRR  got-7.fa
62545  NNNNNNNNNNNNNNRRRRRRRRRRNNNAGTCNNNRRRNNAGTNGTTGTTGTTAGAGTRRRRRRNNAAGTAGGNNGRRRRR  ler-1.fa
62545  NNNNNNNNNNNNNNRRRRRRRRRRNNNAGTCNNNRRRNNNNNNNNNGNTGTTAGNGNRRRRRRNNAAGTAGGNNNRRRRR  lov-5.fa
62545  NNNNNNNNNNNNNGRRRRRRRRRRTCAAGTCNAGRRRAGAGTAGTTGTTGTTAGAGTRRRRRRNCAAGTAGGAGGRRRRR  nfa-8.fa
62545  NNNNNNNNNNNNNNRRRRRRRRRRNNNAGTCTANRRRNGNGTNGTTGTTGNNNNNNNRRRRRRANAAGTAGGNGGRRRRR  rrs-10.fa
62545  NNNNNNNNNNNNNNRRRRRRRRRRNNNAGTCTAGRRRNGNGTNGTTGTTGTTAGAGTRRRRRRACAAGTAGGAGGRRRRR  rrs-7.fa
62545  TAAGTAAAGTGNNGRRRRRRRRRRTCAAGTCTAGRRRAGAGTAGTTGTTGTTAGAGTRRRRRRACNAGTAGGNGGRRRRR  sha.fa
62545  NNNNNNNNNNNNNNRRRRRRRRRRNNNAGTCNAGRRRNNNNNNNNTGTTGTTAGAGTRRRRRRNNNAGTAGGNNNRRRRR  tamm-2.fa
62545  NNNNNNNNNNNNNNRRRRRRRRRRNNNAGTCNNGRRRNGNGTNGTTGTTGTTAGAGTRRRRRRNNAAGTAGGNGGRRRRR  ts-1.fa
62545  NNNNNNNNNNNNNNRRRRRRRRRRNNNNNNNNNNRRRNNNNNNNNNNNNNNNAGNNNRRRRRRNNNAGNAGGNNNRRRRR  tsu-1.fa
62545  TAANNNNNNNNNNNRRRRRRRRRRNNNNNNNNNNRRRAGAGTAGTTGTTGTTAGAGTRRRRRRACAAGTAGGAGGRRRRR  van-0.fa
 
62625  GTAAGAGTGCCTAGAACTAGGAGAAGTAGTACATGTATGTGTTGTGTTGTAAGAAATCATCAATATCATGAATGTAGTCT  chr1.fa
62625  RRRRRARTRRRTAGAACTAGGAGAAGTAGTNRARRRRRNNNNTGRGTTGTAAGAAATCATCAANATCATGAATGTAGTCT  bay-0.fa
62625  RRRRRARTRRRTAGAACTAGGAGAAGTNNNNRNRRRRRNNNNNNRNNNGTAAGANNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
62625  RRRRRARTRRRTAGAACTAGGAGAAGTAGNNRARRRRRGNGNTNRGNNGTAAGAAATCANCAATNNNNNNNNNNNNNNNN  br-0.fa
62625  RRRRRARTRRRTAGAACTAGGAGAAGTAGTARARRRRRGNGTTGRGTTGTAAGAAATCATCAATATCATGAATGTAGTCT  bur-0.fa
62625  RRRRRARTRRRTAGAACTAGGANNNNNNNNNRNRRRRRNNNNNNRNTNGTAAGAAANNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
62625  RRRRRARTRRRTAGAACTAGGAGAAGTAGNNRNRRRRRGNNTNNRGTTGTAAGAANNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
62625  RRRRRARTRRRNNNNNTNNNNNNNNNNNNNNRARRRRRGNGTNGRGTTGTAAGAAATCATCAANATCATGAATNNNNNNN  cvi-0.fa
62625  RRRRRARTRRRTAGAACTAGGAGAAGTANNNRNRRRRRNNNNNNRNNNGTAAGAANNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
62625  RRRRRARTRRRNAGAACTAGGAGAAGTAGTNRARRRRRGTGTTGRGTTGTAAGAAATCATCAATATCATGANNNNNNNNN  fei-0.fa
62625  RRRRRNRTRRRNAGAACTAGGAGAAGNNNNNRNRRRRRNNNNNNRNNNGNAANNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
62625  RRRRRARTRRRTAGAACTAGGNGNNNNNNNNRNRRRRRNNNNNNRNNNGTAAGANNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
62625  RRRRRARTRRRTAGAACTAGGAGANNNNNNNRNRRRRRNNNNNNRNNNGTAAGANNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
62625  RRRRRARTRRRTAGAACTAGNNNNNNNNNNNRNRRRRRNNNNNNRNNNGTAAGAANNNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
62625  RRRRRARTRRRTAGAACTAGGAGAAGTAGNNRNRRRRRNNNNTNRGTTGTAAGAAANCNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
62625  RRRRRARTRRRTAGAACTAGGAGAAGTANNNRNRRRRRNNNNTNRGTTGTAAGAAATNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
62625  RRRRRARTRRRTAGAACTAGGAGAAGTAGNNRNRRRRRNNNNTGRGTTGTAAGAAATCATCAANANNANGAATNNNGNNN  sha.fa
62625  RRRRRARTRRRTAGAACTAGGAGAAGTANNNRNRRRRRNNNNNNRNTNGNAAGAANNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
62625  RRRRRARTRRRTAGAACTANNNNNNNNNNNNRNRRRRRNNNNNNRNNNGTAAGANNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
62625  RRRRRNRTRRRNAGAACTAGGAGNNNNNNNNRNRRRRRNNNNNNRNNNGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
62625  RRRRRARTRRRTAGAACTAGGAGAAGTAGTNRARRRRRGNGTTNRGTTGTAAGAANNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
62705  TTTATTAAAGAGTAAAAACGAGTTCTTGTGTTTGTCTCTAAACAAAAACAAAACAGAGTGAAACAAAGACAGAGATAGAG  chr1.fa
62705  TTTANTAAAGAGTAAAAACGAGNTCRTNTGNTTRTCTCRRRRRRRRRRNNAAACAGNNNNRANNAANNNRNNNNNNNNNN  bay-0.fa
62705  NNNNNNNNNNNNNNNNAACGAGNTCRNGTGNNNRNNNNRRRRRRRRRRNNNNNNANNNNNRNNNNNNNNRNNNNNNNNNN  bor-4.fa
62705  NNNNNNNNNNNNNNNAAACGAGNTCRNGTGNTNRNNNNRRRRRRRRRRNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNN  br-0.fa
62705  TTNNNNNNNGAGTAAAAACGAGNTCRTGTGNTTRNCTCRRRRRRRRRRNNAAACAGAGNGRAACAAANNRNNNNANAGAG  bur-0.fa
62705  NNNNNNNNNNNNNNNAAACGAGNTCRTGNGNNNRNNNNRRRRRRRRRRNNANACAGNNNNRNNNNNNNNRNNNNNNNNNN  c24.fa
62705  NNNNNNNNNNNNNAAAAACGAGNTCRTGNGNTNRNNNNRRRRRRRRRRNNANANANNNNNRANNANNNNRNNNNNNNNNN  col-0.fa
62705  NNNNNNNNNGAGTAAAAACGAGNTCRTGNGTTTRNNTCRRRRRRRRRRNNANACAGANNNRNNNNNNNNRNNNNNNNNNN  cvi-0.fa
62705  NNNNNNNNNNNNNNNAAACGAGNTCRTGTGTNNRNNNNRRRRRRRRRRNNNNANNNNNNGRANNANNNNRNNNNNNNNNN  est-1.fa
62705  NNNNNNNNNGAGTAAAAACGAGTTCRTGTGNTTRNCTCRRRRRRRRRRNNNNNNNNNNNNRNNNAANNNRNNNNNNNNNG  fei-0.fa
62705  NNNNNNNNNNNNNNNNAACGAGTTNRNGNGNNNRNNNNRRRRRRRRRRNNNNACNNNNNNRNNNNNNNNRNNNNNNNNNN  got-7.fa
62705  NNNNNNNNNNNNNNNAAACGNGNNNRNNNGNNNRNNNNRRRRRRRRRRNNNNNCNNNNNNRNNNNNNNNRNNNNNNNNNN  ler-1.fa
62705  NNNNNNNNNNNNNNNNNACNAGNNNRNNNNNNNRNNNNRRRRRRRRRRNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNN  lov-5.fa
62705  NNNNNNNNNNNNNNNAAACGAGNTCRTGTGNTNRNNNCRRRRRRRRRRNNANACAGNNNNRNNNNNNNNRNNNNNNNNNN  nfa-8.fa
62705  NNNNNNNNNNNNNNNNAACGAGNNNRNNNNNNNRNNNNRRRRRRRRRRNNNAACAGANNNRNNNAANNNRNNNNNNNNNN  rrs-10.fa
62705  NNNNNNNNNNNNNAAAAACGAGNTNRNGNGNTNRNNNNRRRRRRRRRRNNNAANANNNNNRNNNAANNNRNNNNNNNNNN  rrs-7.fa
62705  NNNNNNNNNNNNTAAAAACGAGNTCRTGNGNNNRNNNNRRRRRRRRRRNNNNACAGANNNRNNNANNNNRNNNNNNNNNN  sha.fa
62705  NNNNNNNNNNNNNNNAAACGAGNTCRNNNGNNNRNNNNRRRRRRRRRRNNNAACAGANNNRNNNANNNNRNNNNNNNNNN  tamm-2.fa
62705  NNNNNNNNNNNNNNNAAACGAGNNNRNGNGNNNRNNNNRRRRRRRRRRNNNNACANNNNNRNNNNNNNNRNNNNNNNNNN  ts-1.fa
62705  NNNNNNNNNNNNNNNNNACGAGNNNRNNNNNNNRNNNNRRRRRRRRRRNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNN  tsu-1.fa
62705  NNNNNNNNNNNNNNNAAACGAGTTCRTNTGTTNRNNNNRRRRRRRRRRNNNAACAGANNNRANNAANNNRNNNNNNNNNN  van-0.fa
 
62785  AGAAAGTGTAGAAACACAACATGTGTTTACTGATATTGAAGCCATTCATCTTCTAGTAACTCTGCAATACTTATACTCTG  chr1.fa
62785  NGAAAGTGTAGAAACANNNNNNNNNTTTACTGATATTGAAGCCATTCATCTTCRNGRAACTCTGCANNARRRRRRRRRRR  bay-0.fa
62785  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTGAAGCCATTCATCNNNRNNRNANTCTGCANNNRRRRRRRRRRR  bor-4.fa
62785  NNNNNGTGTAGAAACNNNNNNNNTGTTTACTGATATTGAAGCCATTCATCNTCRAGRAACTCTGCAANNRRRRRRRRRRR  br-0.fa
62785  AGAAAGTGTAGAAACACAANNNNTGTTTACTGATATTGAAGCCATTCATCTTCRAGRAACTCTGCAATARRRRRRRRRRR  bur-0.fa
62785  AGAAAGTGTAGAAACANNNNNNNNNTTTACTGATATTGAAGCCATTCATCTTCRNNRNNNNNNNNNNNNRRRRRRRRRRR  c24.fa
62785  NNNNNGTGTAGAANNNNNNNNNNNNNNNNCTGATATTGAAGCCATTCATCNTCRAGRAACTCTGCAANARRRRRRRRRRR  col-0.fa
62785  NNNAAGTGTAGAAACANNNNNNNNGTTTACTGATATTGAAGCCATTCATCTTCRNGRAACTCTGCAANARRRRRRRRRRR  cvi-0.fa
62785  NNNNNNTGTAGAAANNNNNNNNNNNNNNNCTGATATTGAAGCCATTCATCNTCRNGRAANTCTGCANNNRRRRRRRRRRR  est-1.fa
62785  AGAAAGTGTAGAAACNNNNNNNNNGTTTACTGATATTGAAGCCATTCATCTTCRNGRAACTCTGCAATARRRRRRRRRRR  fei-0.fa
62785  NNNNNNNNTAGAAACNNNNNNNNNNNNNNCTGATATTGAAGCCATTCATCNTCRNGRAANTCTNNNNNNRRRRRRRRRRR  got-7.fa
62785  NNNNNGTGTAGANNNNNNNNNNNNNNNNNNNGATATTGAAGCCATTCATCNNCRNGRAANTCTGCANNNRRRRRRRRRRR  ler-1.fa
62785  NNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNGATATTGAAGCCATTCNTCNNCRNNRAANNNNNNNANNRRRRRRRRRRR  lov-5.fa
62785  NNNNAGTGTAGANNNNNNNNNNNNNNNNNNNGATATTGAAGCCATTCATCTTCRNNRNNNNNNNNNNNNRRRRRRRRRRR  nfa-8.fa
62785  NNNNNNNNNNNNNNNNNNNNNNNNNNTTACTGATATTGAAGCCATTCATCTNCRNNRANCTCTGCANNNRRRRRRRRRRR  rrs-10.fa
62785  NNNNNNTGTAGAAANNNNNNNNNNNNNNACTGATATTGAAGCCATTCATCTTCRAGRAACTCTGCANNNRRRRRRRRRRR  rrs-7.fa
62785  NNAAAGTGTAGAANNNNNNNNNNNNNNTNCTGATATTGAAGCCATTCATCTTCRNGRAACTCTGCAANNRRRRRRRRRRR  sha.fa
62785  NNNNNNNGTAGAAANNNNNNNNNNNNNNNNNGATATTGAAGCCATTCATCNTCRNGRAANTCTGCANNNRRRRRRRRRRR  tamm-2.fa
62785  NNNNNNNGTAGANNNNNNNNNNNNNNNNNNNNATATTGAAGCCATTCATCNNNRNNRNNNNNNNNNNNNRRRRRRRRRRR  ts-1.fa
62785  NNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNRRRRRRRRRRR  tsu-1.fa
62785  NNNNNNTGTAGAAACANNNNNNNNNTTTACTGATATTGAAGCCATTCATCTTCRNGRAACTCTGCAANNRRRRRRRRRRR  van-0.fa
 
62865  CATTTCAGAAATACTGTATTACTTTATTTTGCTTAAATTTAGAAATAATTCTAAGAAGAATGGTTCCGTTCTCACATTGT  chr1.fa
62865  RATTTCAGAAATACTGTATTACTTTATTTTGCTTAAATTTAGAANNNNNNNNAAGAAGAATGGTTCCGTTCTCACATTGT  bay-0.fa
62865  RNNNTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAATGGTTCCGTTCTCACATNNN  bor-4.fa
62865  RATTTCAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGAATGGTTCCGTTCTCACATTGT  br-0.fa
62865  RATTTCAGAAATACTNNNNNANNNNNTTNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGAATGGTTCCGTTCTCACATTGT  bur-0.fa
62865  RANTTCAGAANNNNNNNNNNNCNNTNTTTTGCNNNNNNNNNNNNNNNNNNNNNNGAAGAATGGTTCCGTTGTCACATTGT  c24.fa
62865  RATNTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAATGGTTCCGTTCTCACATTGT  col-0.fa
62865  RNNNNNTNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNGAAGAATGGTTCCGTTCTCACATTGT  cvi-0.fa
62865  RNNTTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAATGGTTCCGTTCTCACATTGT  est-1.fa
62865  RATTTCAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAATGGTTCCGTTCTCACATTGT  fei-0.fa
62865  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGTTCCGTTCTCACATNNN  got-7.fa
62865  RNNNTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGGTTCCGTTCTCACATTGN  ler-1.fa
62865  RNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCCGTTCTCACATTGT  lov-5.fa
62865  RNNNTCAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTTCCGTTCTCACATTGT  nfa-8.fa
62865  RNNNTCNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATGGTTCCGTTCTCACATTGT  rrs-10.fa
62865  RANNTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAATGGTTCCGTTCTCACATTGT  rrs-7.fa
62865  RATTTCAGANNNNNNNNNNNNNNNNNNNTTGCNNNNNNNNNNNNNNNNNNNNNNNAAGAATGGNTCNNTTGTCNCANTGT  sha.fa
62865  RNNNTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNN  tamm-2.fa
62865  RNNNTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTCCGTTCTCACATTGT  ts-1.fa
62865  RNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGGTTCCGTTCTCACNNNNN  tsu-1.fa
62865  RANTTCAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGAATGGTTCCGTTCTCACATTGT  van-0.fa
 
62945  ATTTTCAGATAACATTTTTATCGAGGATATTAACAAAACACGCTATCATATAACACTAGTATGGACTCAAATTTGTAGTT  chr1.fa
62945  ATTTTCAGATAACATTTTTATCGAGGATATTAACAAAACACGCTATCATATAACACTAGTATGGACTCAAATTTGTAGTT  bay-0.fa
62945  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAACAAAACACGCTATCATATNNNNNNNNNNNGGACTCAAATTTGNNNNN  bor-4.fa
62945  ATTNNNNNNNNNNNNNTTTATCGANNNNNTTAACAAAACACGCTATCATATAACACTAGTATGGACTCAAATTTGTNGNN  br-0.fa
62945  ATTTTCAGATAACATTTTTATCGAGGATATTAACAAAACACGCTATCATATAACACTAGTATGGACTCAAATTTGTAGTT  bur-0.fa
62945  ATTTTCAGATAACATTTTTATCGAGGATATTAACAAAACACGCTATCATATAACACTAGTATGGACTCAAATTTGTAGTT  c24.fa
62945  ATTNNNNNNNNNNNNTTTTATCGAGGATATTAACAAAACACGCTATCATATAACANTANTATGGACTCAAATTTGTAGTT  col-0.fa
62945  ATTTTCANNNNNNNNNNNNNNNNNNNATATTAACAAAACACGCTATCATATAACACTAGTATGGACTCAAATTTGTAGTT  cvi-0.fa
62945  NTTNNNNNNNNNNNNNNNNNNNNAGGATATTAACAAAACACGCTATCATANNNNNNNNNNATGGACTCAAATTTGTNGNN  est-1.fa
62945  ATTTTCAGATAACATTTTTATCGAGGATATTAACAAAACACGCTATCATATAACACTAGTATGGACTCAAATTTGTAGTT  fei-0.fa
62945  NNNNNNNNNNNNNNNNNNNNNNNNNNNNATTAACAAAACACGCNATCATANNNNNNNNNNNNNNNCNCAAATNNNNNNNN  got-7.fa
62945  NNNNNNNNNNNNNNNNNNNNNNNNNNATATTAACAAAACACGCTATCATANNNNNNNNGTATGGACTCAAATTTGTNNNN  ler-1.fa
62945  ATNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAACAAAACACGCTATCATNNNNNNNNNNNATGGACTCAAATNNNNNNNN  lov-5.fa
62945  ATTTTCAGATAACATTTTTATCGAGGATATTAACAAAACACGCTATCATATAACACTAGTATGGACTCAAATTTGTAGTT  nfa-8.fa
62945  ATTNNNNNNNNNNNNNNNTANCGNGGNTATTAACAAAACACGCTATCATATAACANNNNTATGGACTCAAATTTGTAGTT  rrs-10.fa
62945  ATNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAACAAAACACGCTATCATATNNNNNNNGTATGGACTCAAATTTGTANNN  rrs-7.fa
62945  ATTTTCAGATAACATTTTTATCGAGGATATTAACAAAACACGCTATCATATAACACTAGTATGGACTCAAATTTGTAGTT  sha.fa
62945  NNNNNNNNNNNNNNNNNNNNNNGNGGATATTAACAAAACACGCTATCATANNNNNNNNNNATGGACTCAAATTTGTNGNN  tamm-2.fa
62945  ANNNNNNNNNNNNNNNNTTATCGANNNNNTTAACAAAACACGCTATCATATANNNNNNNTATGGACTCAAATTTGTNGNN  ts-1.fa
62945  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAACAAAACACGCNATNNNNNNNNNNNNNNNNNGACTCNNNNNNNNNNNN  tsu-1.fa
62945  ATTTNNNNNNNNNNNTTNNNNNNNNNNNNNTAACAAAACACGCTATCATATAACACTAGTATGGACTCAAATTTNNNNNN  van-0.fa
 
63025  GTATCATAAGTCATAACAAAAAAAAAACAGCTTAAACGAAAACTAACGTCAATAGCTTTTACTGTATCCAACAATATCTC  chr1.fa
63025  GTATCATAAGTCNNNNNNNAAAAANNNNNNNNNNNACGAAAACTAACGTCAATAGRTTTTACTGTATCCAACAATATCTC  bay-0.fa
63025  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAACTAACGNNNNNNNRNNNANNNNNNNNNNACAATATCTC  bor-4.fa
63025  GNATCATNNNNNNNNNNNAAAANNNNNNNNNNNNNACGAAAACTAACGNNNNNNNRNNNANNNNNNNNNAACAATATCTC  br-0.fa
63025  GTATCATAAGTCANNNNNNNNAAAAANNNNNTNAAACGAAAACTAACGTCAATNNRNNTAACTGTATCCAACAATATCTC  bur-0.fa
63025  GTATCATAAGTCNNNNNNNNNNNNNNNNNNNNNNNNNGAAAACTAACGNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNC  c24.fa
63025  GTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAAACNAACGTCAATNGRTTTTACTGTATCCAACAATATCTC  col-0.fa
63025  GTATCATAAGNNNNNNNNNNNNNNNNNNNNNNNNNACGAAAACTAACGTCANNNNRNNNANNNNNNNCCAACAATATCTC  cvi-0.fa
63025  GNNNNNNNNNNNNNNNNNNANANNNNNNNNNNNNNNCGAAAACTAACGTCAANNGRTNNTACTGTATCCAACAATATCTC  est-1.fa
63025  GTATCATAAGNNNNNNNNNNNNANNNNNNNNNNNNACGAAAACTAACGTCNNNNNRNNNANNNNTATCCAACAATATCTC  fei-0.fa
63025  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGAAAACNAACGNNNNNNNRNNNNNNNNNNNNNNNNNNTANNNN  got-7.fa
63025  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAAACTAACGTCAANNNRNNNTACTGTATCCAACAATATCNC  ler-1.fa
63025  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAAACTAACGTNNNNNNRNNNANNNNNNNNNAACAATATCNN  lov-5.fa
63025  GTATCATAANNNNNNNNNNAAAAANNNNNNNNNNNNCGAAAACTAACGTCNNNNNRNNNANNNNNNNCCAACAATATCTC  nfa-8.fa
63025  NNNNNNNNNNNNNNNNNAAAAAAANNNNNNNNNNNACGAAAACTAACGTCAANNGRTTTTACTGTATCCAACAATANNNN  rrs-10.fa
63025  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAACTAACGTCAANNNRNNNTACTGTATCCAACAATATCTC  rrs-7.fa
63025  GTATCATAAGNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAAACTAACGTCNNNNNRNNNANNNNNNNCCAACAATATCTC  sha.fa
63025  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAACTAACGTNNNNNNRNNNANNNNNNNNNNNCAATATCTC  tamm-2.fa
63025  GNATNATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAAACTAACGTNNNNNNRNNNNNNNNNNNNCAACAATATCTC  ts-1.fa
63025  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAACNAACGNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
63025  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAAACTAACGTNNNNNNRNNNANNNNNNNNNAACAATATCTC  van-0.fa
 
63105  ACACTAAACCTACAAAATTCTTTTTTTTTTTTTCTCTCCGAAGAATCTTACTCAGAGATTTAAGCCGTGAGTTGGCCAAA  chr1.fa
63105  ACACNAAACCTACAAANNNNNNRNRNRNNNRNNNNNTCCGAAGAATCTTACTCAGAGATTTAAGCCGTGAGTTGGCCAAA  bay-0.fa
63105  ACACNAANNNNNNNNNNNNNNNRNRNRNNNRNNNNNNNNNNNGAATCTTNNNNNNAGATTTAAGCCGTGAGTTGGCCAAA  bor-4.fa
63105  ACACNAANNNNNNNNNNNNNNNRNRNRNNNRNNNNNNNNNAAGAATCTTACTCAGAGATTTAAGCCGTGAGTTGGCCAAA  br-0.fa
63105  ACACNAAACCTACAAANNNNNNRNRNRNNNRNNNNNTCCGAAGAATCTTACTCAGAGATTTAAGCCGTGAGTTGGCCAAA  bur-0.fa
63105  ACACTAAANNNNNNNNNNNNNNRNRNRNNNRNNNNNNCCGAAGAATCTTACTCAGAGATTTAAGCCGTGAGTTGGCCAAA  c24.fa
63105  ACNNNNNNNNNNNNNNNNNNNNRNRNRNNNRNNNNNNNNNNNGAATCTTACTCAGAGATTTAAGCCGTGAGTTGGCCAAA  col-0.fa
63105  ACACTAAACCTANNNNNNNNNNRNRNRNNNRNNNNNNNNNAAGAATCTTACTCAGAGATTTAAGCCGTGAGTTGGCCAAA  cvi-0.fa
63105  ACANNNNNNNNNNNNNNNNNNNRNRNRNNNRNNNNNNNNNAAGAATCTTACNNNNNNATTTAAGCCGTGAGTTGGCCAAA  est-1.fa
63105  ACACTAAACCTANNNNNNNNNNRNRNRNNNRNNNNNTCCGAAGAATCTTACTCAGAGATTTAAGCCGTGAGTTGGCCAAA  fei-0.fa
63105  NNNNNNNNNNNNNNNNNNNNNNRNRNRNNNRNNNNNNNNNNNNNNNNNNNNNNNGAGATTTAAGCCGTGAGTTGGCCAAA  got-7.fa
63105  ANNNNNNNNNNNNNNNNNNNNNRNRNRNNNRNNNNNNNNNNNNNNTCNNNNNNNGAGATTTAAGCCGTGAGTTGGCCAAA  ler-1.fa
63105  NNNNNNNNNNNNNNNNNNNNNNRNRNRNNNRNNNNNNNNNNNNNATCTTNNNNNGAGATTTAAGCCGTGAGTTGGCCAAA  lov-5.fa
63105  ACACNAANNNNNNNNNNNNNNNRNRNRNNNRNNNNNTCCGAAGAATCTTACTCAGAGATTTAAGCCGTGAGTTGGCCAAA  nfa-8.fa
63105  NNNNNNNNNNNNNNNNNNNNNNRNRNRNNNRNNNNNNNNNNNNNNNNTNNNNCAGAGATTTAAGCCGTGAGTTGGCCAAA  rrs-10.fa
63105  ACACNAANNNNNNNNNNNNNNNRNRNRNNNRNNNNNNNNNNNNAATCNNNNNNNGAGATTTAAGCCGTGAGTTGGCCAAA  rrs-7.fa
63105  ACACNAAACCTANNNNNNNNNNRNRNRNNNRNNNNNTCCGANGAATCTTACTCAGAGATTTAAGCCGTGAGTTGGCCAAA  sha.fa
63105  ACACNNNNNNNNNNNNNNNNNNRNRNRNNNRNNNNNNNNNNNNAATCNNNNNNNNAGATTTAAGCCGTGAGTTGGCCAAA  tamm-2.fa
63105  ACACNAANNNNNNNNNNNNNNNRNRNRNNNRNNNNNNNNNNNNNATCNNNNNNAGAGATTTAAGCCGTGAGTTGGNCAAA  ts-1.fa
63105  NNNNNNNNNNNNNNNNNNNNNNRNRNRNNNRNNNNNNNNNNNNNNNNNNNNNNNNNGATTTAAGCCGTGAGTTGGCCAAA  tsu-1.fa
63105  ACNNNNNNNNNNNNNNNNNNNNRNRNRNNNRNNNNNNNNNAAGAATCTTACTCAGAGATTTAAGCCGTGAGTTGGCCAAA  van-0.fa
 
63185  ACACTAGTGACATATATTCACGTTCAAAAGTTTATCTTGCAAATCTTGGATTTCTTAGTTTCATTATCAGATTAAAACAG  chr1.fa
63185  ACACTAGTGACATATATTCACGTTCAAAAGTTTATCTTGCAAATCTTGRRRRRRRRNGTTTCATTATCAGATTAAAACAG  bay-0.fa
63185  ACACTAGNNNNNNATATTCACGTTCAAAAGTTTNNNNNNNNNATCNNNRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
63185  ACACTAGTNNNNTATATTCACGTTCAAAAGTTTATCTNGCAAATCTNGRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
63185  ACACTAGTGACATATATTCACGTTCAAAAGTTTATCTTGCAAATCTTGRRRRRRRRNGTTTCATTATCAGATTAAAACAG  bur-0.fa
63185  ACACTAGTGACATATATTCACGTTCAAAAGTTTATCTTGCAAATCTTGRRRRRRRRNGTTTCNTTATCAGATTAAAACAG  c24.fa
63185  ACACTAGTGACATATATTCACGTTCAAAAGTTTATCTTGCAAATCTNNRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
63185  ACACTAGTGACATATATTCACGTTCAAAAGTTTATCTTGCAAATCTTGRRRRRRRRNNNNNNNNTATCNNNNNNNNANNN  cvi-0.fa
63185  ACACTAGNNNNNNNTATTCACGTTCAAAAGTTNNNNNNNNNAATCNTNRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
63185  ACACTAGTGACATATATTCACGTTCAAAAGTTTATCTTGCAAATCTTGRRRRRRRRNNNTTCNTTATCAGNTTAAAACAN  fei-0.fa
63185  ACACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
63185  ACACTAGNNNNNNNNNNNCACGTTCAAAAGTTTATCNNNNNNNNCNTGRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
63185  ACACTANNNNNNNNNNNTCACGTTCAAAAGTNNNNNNNNNNNNNNNNNRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
63185  ACACTAGTGACATATATTCACGTTCAAAAGTTTATCTTGCAAATCTTGRRRRRRRRNNNNNNNNNNNNNNNNNAAAACAN  nfa-8.fa
63185  ACACTNNNNNNNTNNNNNNNNNNNCAAANNNNNNNNNNNNNNNNNNNNRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
63185  ACACTAGNNNNNNNNATTCACGTTCAAAAGTTTANNNNNNNNNNNNTGRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
63185  ACACTAGTGACATATATTCACGTTCAAAAGTTTATCTTGCAAATCTTGRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
63185  ACACTAGNNNNNNNTATTCACGTTCAAAAGTTNNNNNNNNNNNNNNNNRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
63185  ACACTAGTGNNNNNNATTCACGTTCAAAAGTTTNNNNNGNNNNNNNTNRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
63185  ACACTNNNNNNNNNNNNNNNCGTTCAAANGNNNNNNNNNNNNNNNNNNRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
63185  ACACTAGTGACATATATTCACGTTCAAAAGTTTATCTTGCAAATCTTGRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
63265  AATTTCAATAATGAGGAAAAAGCATACCTACTACTAGTCTACTACTTTCTGCAACAACAAAACAAAAAAACTAAAACCAA  chr1.fa
63265  AATTTCAATAATGAGGAAAAAGCATACCTACTACTAGTCTACTACTTTCNGCAANNNRRRRNNNRNRNNNNRNNAACCAA  bay-0.fa
63265  NNNNNNNNNNNNNNNNNNNNNNCATACCTACTNNNNNNNNACTACTTTCNGCNANNNRRRRNNNRNRNNNNRNNNNNNNA  bor-4.fa
63265  NNNNNNNNNNNNNNNNNNNAAGCATACCTACTACTNGTCTACTACTTTCNGCAANNNRRRRNNNRNRNNNNRNNNNCNNN  br-0.fa
63265  NNNNNNNNNNNNNNNNNNNAAGCATACCTACTACTAGTCTACTACTTTCTGCAANNNRRRRNNNRNRNNNNRNNNNCCAA  bur-0.fa
63265  AATTTCAATAATGAGGAAAAAGCATACCTACTACTAGTCTACTACTTTCNGCAANNNRRRRNNNRNRNNNNRNNNNNCAN  c24.fa
63265  NNNNNNNNNNNNGAGGAAAAAGCATACCTACTACNNNNNNACTACTTTCTGCAANNNRRRRNNNRNRNNNNRNNNNNNNN  col-0.fa
63265  NNNNNNNNNNNNNNNNNNNAAGCATACCTACTACTAGTCTACTACTTTCTGCAANNNRRRRNNNRNRNNNNRNNNNCCNA  cvi-0.fa
63265  NNNNNNNNNNNTGAGGAAAAAGCATACCTACNNNNNNNCTACTACTTTCTGCAANNNRRRRNNNRNRNNNNRNNNNNNNA  est-1.fa
63265  NNNNNNNNNNNNNNNNNNAAAGCATACCTACTACTAGTCTACTACTTTCTGCAANNNRRRRNNNRNRNNNNRNNNNNNNN  fei-0.fa
63265  NNNNNNNNNNNNNNNNNNNAAGCATACCTACTNNNNNNNNNCTACTTTCNGCAANNNRRRRNNNRNRNNNNRNNNNNNNN  got-7.fa
63265  NNNNNNNNNNNNNAGGAAAAAGCATACCTACTNNNNNNCTACTACTTTCNNNNANNNRRRRNNNRNRNNNNRNNNACCAA  ler-1.fa
63265  NNNNNNNNNNNNNNNNNNNNNGCATACCTACNNNNNNNNNNCTACTTTCNGCNNNNNRRRRNNNRNRNNNNRNNNNNNNN  lov-5.fa
63265  NNNTTCAATAATGAGGAAAAAGCATACCTACTACTAGTCTACTACTTTCNGCAANNNRRRRNNNRNRNNNNRNNNNCCAA  nfa-8.fa
63265  NNNNNNNNNNNNNAGGAAAAAGCANACNTNNNNNNNNNCNNNNNCTNTCNGCNANNNRRRRNNNRNRNNNNRNNNNNNAA  rrs-10.fa
63265  NNNNNNNNNNNTGAGGAAAAAGCATACCTACTANNNNNNTACTACTTTCTGCAANNNRRRRNNNRNRNNNNRNNNNNNNN  rrs-7.fa
63265  NNTTTCAANAATGAGGAAAAAGCATACCTACTACTAGTCTACTACTTTCTGCAANNNRRRRNNNRNRNNNNRNNNNNNNN  sha.fa
63265  NNNNNNNNNNNNNAGGAAAAAGCATACCTACTNNNNNNCTACTACTTTCNGCAANNNRRRRNNNRNRNNNNRNNNNNNNN  tamm-2.fa
63265  NNNNNNNNNNNTGAGGAAAAAGCATACCTACTNNNNNNNTACTACTTTCTGCAANNNRRRRNNNRNRNNNNRNNNNNNNN  ts-1.fa
63265  NNNNNNNNNNNNNNNNNAAAAGCATACCNNNNNNNNNNNNNNTACTTTCNGCAANNNRRRRNNNRNRNNNNRNNNNNNNN  tsu-1.fa
63265  NNNNNNNNNNNNNAGGAAAAAGCATACCTACTACNNNNNTACTACTTTCTGCAANNNRRRRNNNRNRNNNNRNNNACCAA  van-0.fa
 
63345  GAAAAGCCCCAAAAGATTACCACAAATTAAGGAAACTTAAAGCCCATTGATTTCAACATCTCAACAGAGCTCTGACTTTG  chr1.fa
63345  NAANNNNNNNNNAAGATTACCACAAATTAAGGAAACTTRRRRRRCATTGARTTCAACATCTCAACNRNGCTCTGACTTTG  bay-0.fa
63345  GNNNNNNNCCAAAAGANNNNNNNNNNNNNNNGAAANNNRRRRRRCATTGARTTCAACATCTCAACNRNNNTCTGACTTTG  bor-4.fa
63345  NNNNNNNNNNNNNANNNNNNNNNNNNNNNNNGAAANTTRRRRRRCATTGARNTCAACATCTCAACNRNGCTCTGACTTTG  br-0.fa
63345  GAAAAGCCCCAAAAGATTACCACAAATTAAGGAAACTTRRRRRRCATTGARTTCAACATCTCAACARNGCTCTGACTTTG  bur-0.fa
63345  NAAAAGCNCCAAAAGATTACCACAAATTAAGGAAACTTRRRRRRCATTGARTTCAACATCTCAACNRNGCTCTGACTTTG  c24.fa
63345  NNNNNNNNNCAAAAGATTANNNNNNNNNNNNNNNANTTRRRRRRCATTGARTTCAACATCTCAACNRNGCTCTGACTTTG  col-0.fa
63345  GAAAAGCCCCAAAAGATTACCACAAATTAAGGAAACTTRRRRRRCATTGARTTCAACATCTCAACNRNGCTCTGACTTTG  cvi-0.fa
63345  GAAAAGCNCCAAAAGATNNNNNNNNNNNNNNGAAACNNRRRRRRCANTGARTTCANCATCTCAACNRNGCTCTGACTTTG  est-1.fa
63345  NNNNNNNNNNAAAAGATTACCACAAATTAAGGAAACTTRRRRRRCATTGNRTTCAACANCTCAACNRNGCTCTGACTTTG  fei-0.fa
63345  GAAANNNNNNAAAAGNNNNNNNNNNNNNNNNNNAANNNRRRRRRCANTGARTTCANNNNCTCANNNRNNNTCTGACTTTG  got-7.fa
63345  NAAAAGCCCCAAAAGATTACCACAAATNNNNNAAACNNRRRRRRNATTGARNTCAACATCTCANNNRNNNNCNGACTTTG  ler-1.fa
63345  NNNNANCCCCAAAAGATTNNNNNNNNNNNNNNAAANNNRRRRRRCNNNGARTNCAACATCNNNNNNRNNNNNNNNCTTTG  lov-5.fa
63345  NAAAAGCCCCAAAAGATTACCACAAATTAAGGAAACTTRRRRRRCATTGARTTCAACATCTCAACNRNGCTCTGACTTTG  nfa-8.fa
63345  GAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNRRRRRRCATTNARTTCAACANNNNNACNRAGCTCTGACTTTG  rrs-10.fa
63345  NNAAAGCNCCAAAAGATTNNNNNNNNNNNNNNAAANNNRRRRRRCATTGARTTCAACATCTCAACNRNGCTCTGACTTTG  rrs-7.fa
63345  NNNAAGCNNCAAAAGATTACCACAAATTNAGGAAACNNRRRRRRCATTGARNTCAACATCTCANCNRNNCTCTGACTTTG  sha.fa
63345  NNNNNNNNNNNAAAGNNNNNNNNNNNNNNNNNAAANNNRRRRRRCATTGARTTCAACATCTCANNNRNNNTCTGACTTTG  tamm-2.fa
63345  NNNNNNNNNNNAAAGATTNCCACAAATTAANGAAANNNRRRRRRCATTGARTTCAACATCTCANNNRNNNTCTGACTTTG  ts-1.fa
63345  NNNNNNNNNCAAAAGNNNNNNNNNNNNNNNNNNAANNNRRRRRRNNTNGARNNCNNNNNCTCANNNRNNNNNNNACTTTG  tsu-1.fa
63345  GAAAAGCCCCAAAAGANNNNNNNNNNNNNNNGAAACTTRRRRRRCATTGARTTCAACATCTCAACARAGCTCTGACTTTG  van-0.fa
 
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTTCCAAGGAGAGCTTCAATTATTTCTTTAAAAGGAATAATCT  chr1.fa
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCTTCAATRRRTTNNNNNNNNRRRRRRRRRR  bay-0.fa
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCTNNNNNRRRNNNNNNNNNNRRRRRRRRRR  bor-4.fa
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGNTTCRAAGGAGAGCTTCNNNRRRNNNNNNNNNNRRRRRRRRRR  br-0.fa
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTNNRANGGAGAGCTTCAANRRRNNNNNNNNNNRRRRRRRRRR  bur-0.fa
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCTTCANNRRRNNNNNNNNNNRRRRRRRRRR  c24.fa
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCTTNNNNRRRNNNNNNNNNNRRRRRRRRRR  col-0.fa
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCTTCNNNRRRNNNNNNNNNNRRRRRRRRRR  cvi-0.fa
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCTTNNNNRRRNNNNNNNNNNRRRRRRRRRR  est-1.fa
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTTCRNAGGAGAGCTTCNNNRRRNNNNNNNNNNRRRRRRRRRR  fei-0.fa
63425  ATNNNNNNNNNTGTCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGANNNNNNNNRRRNNNNNNNNNNRRRRRRRRRR  got-7.fa
63425  ATTAACCTTGTTGNCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCNNNNNNRRRNNNNNNNNNNRRRRRRRRRR  ler-1.fa
63425  ATTAACCTTGTTGTCNTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCNNNNNNRRRNNNNNNNNNNRRRRRRRRRR  lov-5.fa
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCTTCNNNRRRNNNNNNNNNNRRRRRRRRRR  nfa-8.fa
63425  ATTAACCTTNTTGTCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCTNNNNNRRRNNNNNNNNNNRRRRRRRRRR  rrs-10.fa
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCTTNNNNRRRNNNNNNNNNNRRRRRRRRRR  rrs-7.fa
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCTTCNNNRRRNNNNNNNNNNRRRRRRRRRR  sha.fa
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCNNNNNNRRRNNNNNNNNNNRRRRRRRRRR  tamm-2.fa
63425  ATTANCCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCTTCNNNRRRNNNNNNNNNNRRRRRRRRRR  ts-1.fa
63425  ATTNNNNTTGTTGNCTTGTTGAACCTTGTCACCGGNGTNNNRNNNGANNNNNNNNNNRRRNNNNNNNNNNRRRRRRRRRR  tsu-1.fa
63425  ATTAACCTTGTTGTCTTGTTGAACCTTGTCACCGGAGTTTCRAAGGAGAGCTNNNNNRRRNNNNNNNNNNRRRRRRRRRR  van-0.fa
 
63505  CTTCTTTCTCTTTCTCTTTCTCTTTCTTGTTCTTGTTCTTTCTTCCGTCTACTTTCCATTTGCCACCACCCCATTCATAC  chr1.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNTTNTTTCTTCCGTCTACTTTCCATTNRNRACNNNNNCANNCRNNC  bay-0.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNNTCTTCCGTCTACTTTCCATTTRCRANCACCCCATTCRTAC  bor-4.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNTTCTTCCGTCTACTTTCCATTTRNRACNACCNCATTCRNAC  br-0.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNNTCTTCCGTCTACTTTCCATTTRCRNCCACCCCATTCRTAC  bur-0.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNTTCTTCCGTCTACTTTCCATTTRNRNCCACCNCANTCRNAC  c24.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNTTCTTCCGTCTACTTTCCATTTRCRNCNACCNCANTCRTAC  col-0.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNTCTTTCTTCCGTCTACTTTCCATTTRCRACCACCCCANTCRNAC  cvi-0.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNTTCTTCCGTCTACTTTCCATTTRCRACCACCCCANNCRTAC  est-1.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNTTTCTTCCGTCTACTTTCCATTTRCRNCNACCCCANNCRNNC  fei-0.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNNNNTTNCGNCTACTTTCCATTTRCRANCACCCCATTCRNNC  got-7.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNNTCTTCCGTCTACTTTCCATTTRCRNNCACCCCANTCRNAC  ler-1.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNNNCTTCCGTCTACTTTCCATTNRNRNNNACCNCANTNRNNN  lov-5.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNTTCTTCCGTCTACTTTCCATTTRNRACCACCCCANTCRNNC  nfa-8.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNTTCTTCCGTCTACTTTCCATTTRCRNNNACCCCATNCRTAC  rrs-10.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNTTTCTTCCGTCTACTTTCCATTTRCRANCACNCCATTCRNAC  rrs-7.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNTTTCTTCCGTCTACTTTCCATTTRCRNNCACCCCANTCRNNC  sha.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNNTCTNNNNNCTACTTTCCATNNRNRNNNNNNNNNNNNRNNN  tamm-2.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNTTCTTCCGTCNACTTTCCANNNRNRNNCACNCCANNNRNNC  ts-1.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNNNNTNNNNNNNACTTTCCANTNRCRNNNANNNNNNTNRNNC  tsu-1.fa
63505  RRRRRRRRRRRRRRRRRRRRRRRNNNNRNNNNNNNNNNNNTCTTCCGTCTACTTTCCATTTRCRACCACCCCATTCRTAC  van-0.fa
 
63585  GACGGATCCATCCACGGCGGCAACACCCTCCTCGCAGCCACTTCTCCGGATGCCGACGCTGTTTCCTTGTCTGAAACCCT  chr1.fa
63585  GACGGRTCNRRRRRCGNCRRRRRNNNCCTCCTCGCAGCCACTTCTCCGGATGCCGACGCTGTTTCCTTGTCTGAAACCCT  bay-0.fa
63585  GACGGRTCCRRRRRCGGNRRRRRCANCCT