Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 64398 - 67512


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
64398  TTATTGCTTTTGTTCTTCAGCGGCTGCATCAGTATTCCAGACTACATCCTTTAATCCAGATGAGAAGTTTTTGTAGAACT  chr1.fa
64398  TTNTTGNTTTTGTTNRRRRRRRRRRRRRRRRRRRRRRRRRACTACATCCTTTAATCCAGATGAGAAGTTTTTGTRRRRRR  bay-0.fa
64398  NNNNNNNNNNTGNTCRRRRRRRRRRRRRRRRRRRRRRRRRACTACATCCTTNNNNNNNGATGAGAAGTTTTTNNRRRRRR  bor-4.fa
64398  NNNNNNNNNTTGTTCRRRRRRRRRRRRRRRRRRRRRRRRRACTACATCCTTTAATCCAGATGAGAAGNTTTNGNRRRRRR  br-0.fa
64398  NNNNNNNNNNNGTTCRRRRRRRRRRRRRRRRRRRRRRRRRACTACATCCTTTAATCCAGATGAGAAGTTTTTGTRRRRRR  bur-0.fa
64398  NNNNNNNNTTTGTTNRRRRRRRRRRRRRRRRRRRRRRRRRACTACATCCTTTAATCCAGATGAGAAGTTTTTGTRRRRRR  c24.fa
64398  NNNNNNNNNTTGTTCRRRRRRRRRRRRRRRRRRRRRRRRRACTACATCCTTTAATCCAGATGAGAAGTTTTTGNRRRRRR  col-0.fa
64398  NNNNNNNNTTTGTTCRRRRRRRRRRRRRRRRRRRRRRRRRACTACATCCTTTAATCCAGATGAGAAGTTTTTGTRRRRRR  cvi-0.fa
64398  NNNNNNNNNNTGTTCRRRRRRRRRRRRRRRRRRRRRRRRRACNACATCCTTTAATCCAGATGAGAAGTTTTTGTRRRRRR  est-1.fa
64398  NNNNNNNNTTTGTNCRRRRRRRRRRRRRRRRRRRRRRRRRACTACATCCTTTAATCCAGATGAGAAGTTTTTGTRRRRRR  fei-0.fa
64398  NNNNNNNNNNTGTTCRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRR  got-7.fa
64398  NNNNNNNNNNTGNTCRRRRRRRRRRRRRRRRRRRRRRRRRACNANATCCTTTAATCNAGATGAGAAGTTTTNGNRRRRRR  ler-1.fa
64398  NNNNNNNNNNTGNNNRRRRRRRRRRRRRRRRRRRRRRRRRACNANNNNNNNNNNNNNNNNNNNNNNNNNTTNGNRRRRRR  lov-5.fa
64398  NNNNNNNNNTTGNTCRRRRRRRRRRRRRRRRRRRRRRRRRACTACATCCTTTAATCCAGATGAGAAGTTTTTGTRRRRRR  nfa-8.fa
64398  NNNNNNNNNNTGNNCRRRRRRRRRRRRRRRRRRRRRRRRRACNACATCCTTTAATCCAGANNNNNAGTTTTNNNRRRRRR  rrs-10.fa
64398  NNNNNNNNNTTGNNCRRRRRRRRRRRRRRRRRRRRRRRRRACTACATCCTTTAATCCAGATGAGAAGTTTTTGTRRRRRR  rrs-7.fa
64398  NNNNNNNNNTTGTNNRRRRRRRRRRRRRRRRRRRRRRRRRACTACATCCTTTAATCCAGATGAGAAGTTTTTGTRRRRRR  sha.fa
64398  NNNNNNNNNTTGNNNRRRRRRRRRRRRRRRRRRRRRRRRRACNACATCCTNNNNTCCAGATGAGAAGTTTTTGTRRRRRR  tamm-2.fa
64398  NNNNNNNNNNTGNNNRRRRRRRRRRRRRRRRRRRRRRRRRACTACATCCTTTAATCCAGATGNGNNGNTTTNGNRRRRRR  ts-1.fa
64398  NNNNNNNNNNTGNTCRRRRRRRRRRRRRRRRRRRRRRRRRNNNANNNNNNNNNNNNNNNNNNNNNNNNNNTNNNRRRRRR  tsu-1.fa
64398  NNNNNNNNNNTGTTCRRRRRRRRRRRRRRRRRRRRRRRRRACTACATCCTTTAATCCAGATGAGAAGTTTTTGTRRRRRR  van-0.fa
 
64478  GCAAAAGAGATTCAAACATAAAACCAATTTAAACACTAAACTAGAGATGTTAACCGGATCAAAACCGAACCGGTTTTTGA  chr1.fa
64478  RRRRAANANATTCANNNNNNNAACCANNNNNAACACTAAANTAGAGATGTTAACCGNATCAAAACCNNNNNNNNNNNNNN  bay-0.fa
64478  RRRRAANANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATGTTAACCGGANCAAAANNNNNNNNNNNTTNNN  bor-4.fa
64478  RRRRAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGATGTTAACCGGATCAAAACCGNNNNNNNNTTTGN  br-0.fa
64478  RRRRAAGAGATTCAAACANAAAACCAATTTAAACACTAAACTAGAGATGTTAACCGGATCAAAACCNANNNNNNNNTTGA  bur-0.fa
64478  RRRRAAGAGATTCAAACANAAAACCANNNNNAACACNAAACTAGAGATGTTAACCGGANCAAAACCNNNNNNNNNNNTGN  c24.fa
64478  RRRRAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNCTAGAGATGTTAACCGGANCAAAACNNNNNNNNNNNNNNN  col-0.fa
64478  RRRRAAGAGANTCAANNNNNNNACCNNNNNNNNNNNTAAACTAGAGATGTTAACCGGANCAAAACCGAANNNNNNNNTGN  cvi-0.fa
64478  RRRRAANANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATGTTAACCGGANCAAAACCGANNNNGTTTTTGN  est-1.fa
64478  RRRRAAGAGATNCAAANNNNNNACCANNNNNNNCNCTAAACTAGAGATGTTAACCGGANCAAAACCNNNNNNNNNNTTGA  fei-0.fa
64478  RRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGTTAACCGGANCAAAACNNNNNNNNNNNNNNN  got-7.fa
64478  RRRRAANANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGTTAACCGGANCAAAANNNNNNNNNNNNNNNN  ler-1.fa
64478  RRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTTAACCGGANCAAAACNNNNNNNNNNNNNNN  lov-5.fa
64478  RRRRAAGAGATTCANNNNNNNAACCANNNNNAACACTAAACTAGAGATGTTAACCGGATCAAAACNNNNNNNNNNNNTGN  nfa-8.fa
64478  RRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGATGTTAACCGGATCAAAACCGNNNNNNNNNNNNN  rrs-10.fa
64478  RRRRAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATGTTAACCGGANCAAAANNNNNNNNNNNNNNNN  rrs-7.fa
64478  RRRRANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAACCGGATCAAAACNNNNNNNNNNNNNNN  sha.fa
64478  RRRRAANANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACCGGATCAAAACNNNNNNNNNNNNNNN  tamm-2.fa
64478  RRRRAANANNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNAGATGTTAACCGGANCAAAACNNNNNNNNNNNNNNN  ts-1.fa
64478  RRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTTAACCGGANCAAAANNNNNNNNNNNNNNNN  tsu-1.fa
64478  RRRRAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATGTTAACCGGATCAAAACCGANNNNNTTTTTGA  van-0.fa
 
64558  TGAAGATCAAACCGAATCACATACCTTGTGAAACTCGAGGGTATCACCACCGGTTTTCCTAAGCTCTACCACATGCAATG  chr1.fa
64558  NNNAGATCAAACCGAATCACATACCTTGTGRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRNANCACATGCAATG  bay-0.fa
64558  NNNAGATCAAACCGAATCACATACCTTGTGRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRTACCACATGCAATG  bor-4.fa
64558  TGAAGATCAAACCGAATCACATACCTTGTGRRRRRRGAGGGTATCARNRCCGGTTTTCCRRRRRRRTACCACATGCAATG  br-0.fa
64558  TGAAGATCAAACCGAATCACATACCTTGTGRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRNACCACATGCAATG  bur-0.fa
64558  TGAAGATCAAACCGAATCNCATACCTTGTGRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRNACCACATGCAANG  c24.fa
64558  NNNAGATCAAACCGAATCACATACCTTGTGRRRRRRGAGGGTATCARCRCCNGTTTTCCRRRRRRRTACCACATGCAATG  col-0.fa
64558  TGAAGATCAAACCGAATCNCATACCTTGTGRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRTACCACATGCAATG  cvi-0.fa
64558  TGAAGATCAAACCGAATCACATACCTTGTGRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRTACCACATGCAATG  est-1.fa
64558  TGAAGATCAAACCGAATCNCATACCTTGTGRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRTACCACATGCAATG  fei-0.fa
64558  NNNAGATCAAACCGAATCACATACCTTGTGRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRNACCACATGCAATG  got-7.fa
64558  NNNNNNTCAAACCGAATCNCATACCTTGTGRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRNACCACATGCAATG  ler-1.fa
64558  NNNNNNNNAAACCGANNNNNATACCTTGNGRRRRRRGAGGGTANCARCRCCGGTTTTCCRRRRRRRNACCACATGCAATG  lov-5.fa
64558  TGAAGATCAAACCGAATCNCATACCTTGTGRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRTACCACATGCAATG  nfa-8.fa
64558  NNAAGATCAAACCGAATCACATACCTTGTGRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRTACCACATGCAATG  rrs-10.fa
64558  NNNAGATCAAACCGAATCNCATACCTTGTGRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRTACCACATGCAATG  rrs-7.fa
64558  NNNNGATCAAACCGAATCNCATACCTTGTGRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRTACCACATGCAATG  sha.fa
64558  NNNAGATCAAACCGAATCACATACCTTGTGRRRRRRGAGGGTANCARCRCCGGTTTTCCRRRRRRRNACCACATGCAATG  tamm-2.fa
64558  NNNAGATCAAACCGAATCNCATACCTTGTNRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRNACCACATGCAATG  ts-1.fa
64558  NNNNNATCAAACCGAATCNCATACCTTGNGRRRRRRGAGGGTANCARCRCCGGTTTTCCRRRRRRRNACCACATGCAATG  tsu-1.fa
64558  TGAAGATCAAACCGAATCACATACCTTGTGRRRRRRGAGGGTATCARCRCCGGTTTTCCRRRRRRRTACCACATGCAATG  van-0.fa
 
64638  ATGGCGCCACTTCAAACACCTATTAAACCGATTACCAAACCATAACAATTAGATAACGATATTCATCAAAATCCAAAAAC  chr1.fa
64638  ANNNNNNCACTRRAAACACCTATTAAACCGATNACCAAACCANAACAATTAGATAACGATATTCATCAAAANNNNAAAAC  bay-0.fa
64638  ATGGCGCCNCTRRGNNNNNNNNNNAAACCGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAC  bor-4.fa
64638  ATGGNGCCNCTRRAAACACCTATTAAACCGATNACCAAACNNNNNNNNNNNNNNNNNNNNNNNNNNCANAANCCAAAAAC  br-0.fa
64638  ATGGCGCCACTRRAAACACCTATTAAACCGATNACCAAACCANAACAATTAGATAACGATATTCATCAAAANCCAAAAAC  bur-0.fa
64638  ATGGCGCCACTRRAAACACCTATTAAACCGATNACCAAACCANAACAATTAGANAANGANATTCATCAAAANNNNNNNNN  c24.fa
64638  ATGGCGCCACTRRAAACACNNNNNAAACCNNNNNNCAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAAAAC  col-0.fa
64638  ATGGCGCCNCTRRAAACACCTATTAAACCGATTACCNAACCATAACNNNNNNNNNNNNNNNNTCATCAAAANNNNNNNNC  cvi-0.fa
64638  ATGGCGCCACTRRAAACACCTANTAAACCGATNACCAAACNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNAAAAAC  est-1.fa
64638  ATGGCGCCNNTRRAAACACCTATTAAACCGATTACCAAACCANAANAANNNNNNNNNGANATTCATCAAAANCCAAAAAC  fei-0.fa
64638  ATGGCGCCACTRRAAACNNNNNNNNNNNNNNNNNCCAANCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAAAAC  got-7.fa
64638  ATGGCGCCACTRRAANCACCNATTAAACCGATNACCAAACNNNNNNNNNNNNNNNNNNNNNNNNNNCANAANCCAAAAAC  ler-1.fa
64638  ATGGCGCCNNNRRNANCACCNATTAAACCNNNNNNCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNCANAANNNNNNNNC  lov-5.fa
64638  ATGGCGCCACTRRAAACACCTATTAAACCGATNACCAAACCANAACAANNNNNNNNNNATATTCATCAAAANCCAAAAAC  nfa-8.fa
64638  ATGGCGCCACTRRAAACACCNATTAAACCNNNNNNCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNCANAANCCAAAAAC  rrs-10.fa
64638  ATGGCGCCNNNRRGNNNNNNNNNNNAACCGATNACCAAACNNNNNNNNNNNNNNNNNNNNNNNNANCANAANCCAAAAAC  rrs-7.fa
64638  ATGGCGCCNCTRRAAACACCNATTAAACCGATNACNAANNNNNNNNNNNNNNNNNNNNNNNNTCATCANNNNNNNAAAAC  sha.fa
64638  ATGGCGCCNCTRRAANCANNNNNNNAACCNNNNNNCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAANCCAAAAAC  tamm-2.fa
64638  ATGGCGCCNCTRRAAACACCTANTAAACCGATNACCAAACNNNNNNNNNNNNNNNNNNNNNNNCATCANNNNNNAAAANC  ts-1.fa
64638  ATGGCGCCNCTRRAAANNNNNNNNAAACCNNNNNNCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAC  tsu-1.fa
64638  ATGGCGCCACTRRAAACACNNNNNAAACCGATTACCAAACCANNNNNNNNNNNNNNNNNNNNNNNNCANAANCCAAAAAC  van-0.fa
 
64718  CGAACTGAACCGGAGTATTTTTTTCTTTCTTACCTCTGTAGCTACGGAGAGCTGACCTTTACGACCACTTTTGTCTCCTT  chr1.fa
64718  CGNNNNNNNCCGGAGTATTTTTTTNNTRRTNNCCTCNGTNGCNNCRGAGRGCTGACCTTTACGACCACTTTTGTCTNCTT  bay-0.fa
64718  CGAACNGAACCGGAGTATTNNNNNNNNRRNNNNNNNTGTAGCNACRGAGRGCTGACCTTTACGACCACTTTTGNNNNNNN  bor-4.fa
64718  CGANNNNNNCCGGNNNNNNNNNNNNNNRRNNNNNTCTGTAGCNNCRGANRGCTGACCTTTACGACCACTTTTGNNNNNNN  br-0.fa
64718  CGAACNGAACCGGAGTATTTTTTTNNNRRNNNCCTCTGTAGCNACRGAGRGCTGACCTTTACGACCACTTTTGTCTCCTT  bur-0.fa
64718  CGAACNGAACCGGAGTATTTTTTTNNNRRNNNCCTCTGTAGCNACRGAGRGCTGACCTTTACGACCACTTTTGTCTCCTT  c24.fa
64718  CGAACNGAACCGGAGTNTTNTNNNNNNRRNNNNNNCTGTAGCNACRGAGRGCTGACCTTTACGACCACTTTTGTCTCNNN  col-0.fa
64718  CGAACNGAACCGGAGTATTTTNNNNNNRRNNNCCTCTGTAGCNACRGAGRGCTGACCTTTACGACCACTTTTGTCTCCTT  cvi-0.fa
64718  CGAACNGAACCGGAGTNTTTTTNNNNNRRNNNNNTCTGTAGCNACRGAGRGCTGACCTTTACGACCACTTTTGTNNNNNN  est-1.fa
64718  CGAACNGAACCGGAGTATTTTTTTNNNRRNNNCCTCTGTAGCNNCRGAGRGCTGACCTTTACGACCACTTTTGTCTCCTT  fei-0.fa
64718  CGAACNGAACCGGNNNNTTTTTNNNNNRRNNNNNNNNNTNNCNACRGAGRGCTGACCTTTACGACCACTTTTGTNNNNNN  got-7.fa
64718  CGANNNNNNCCGGAGTATTNTNNTNNNRRNNNNNNNNNNNNCNNNRNAGRGCTGACCTTTACGACCACTTTTGTCTCCTT  ler-1.fa
64718  CGAACNGAACCGGANTATTTTTTNNNNRRNNNNNNNNNNNNNNNNRNNGRGCTGACCTTTACGACCACTNNNNNNNNNNN  lov-5.fa
64718  CGAACNGAACCGGAGTATTTTTTTNNNRRNNNNNTCTGTAGCNACRGAGRGCTGACCTTTACGACCACTTTTGTCTCCTT  nfa-8.fa
64718  CGAACNGAACCGGAGTATTTTTTTNNNRRNNNNNNNTGTAGCNACRGAGRGCTGACCTTTACGACCACTTTTGTCTNNNN  rrs-10.fa
64718  CGAACNGAACCGGAGTATTTTTNNNNNRRNNNNNNCTGTAGCNACRGAGRGCTGACCTTTACGACCACTTTTGTCTNNNN  rrs-7.fa
64718  CGNNNNGAACCGGAGTATTTTNNNNNNRRNNNNNNCTGTAGCNNCRGNGRGCTGACCTTTACGACCACTTTTGTCTCCTT  sha.fa
64718  CGANNNNNNCCGGAGTNNNNNNNNNNNRRNNNNNNNNGNNNNNNNRGAGRNNTGACCTTTACGACCACTTTTGTNNNNNN  tamm-2.fa
64718  CGANNNNNNCCGGNNNNNNNTNNNNNNRRNNNNNNNTGNAGCNNNRGAGRGCTGACCTTTACGACCACTTTTGTCTCNNN  ts-1.fa
64718  CGAACNGANCCNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNCNANRGAGRGCTGACCTTTACGACCACTTTTGTCNNNNN  tsu-1.fa
64718  CGAACNGAACCGGAGTATTTNNNNNNNRRNNNNNNNTGTAGCNACRGAGRGCTGACCTTTACGACCACTTTTGTCNNNNN  van-0.fa
 
64798  TCATTTTTATCTGCGAAGTTTACTTAAACAATGTTTAACGAAGCTACAAAGACATTAGTTGACACAAACAAAATCAAGAA  chr1.fa
64798  TCATTTTTATCTGCGNARTTTRRRRRRNRNRNGNTTAACGAAGCTACAAAGACATTAGTTGACANNNNCAAAATCNNNRR  bay-0.fa
64798  NNNTTTTTATCTGNNNNRNNNRRRRRRNRNRNNNNTAACGAAGCTACAAAGACATTAGTTGACACAAACAANNNNNNNRR  bor-4.fa
64798  NNNNNTTTATCTGCNNNRNNNRRRRRRNRNRNNNTTAACGAAGCTACAAAGACATTAGTTGACACAANCANNNNNNNNRR  br-0.fa
64798  TCATTTTTATCTGCNNNRNANRRRRRRNRNRTGNTTAACGAAGCTACAAAGACATTAGTTGACACAANCANANNNNNNRR  bur-0.fa
64798  TCATTTTTATCTGCGAARTTTRRRRRRNRNRNGNTTAACGAAGCTACAAAGACATTAGTTGACACAANCANANNNNNNRR  c24.fa
64798  NNNNNTTTATCTGCNNARNNNRRRRRRNRNRNNNTTAACGAAGCTACAAAGACATTAGTTGACACAAACAAANNNNNNRR  col-0.fa
64798  NCATTTTTATCTNNNNNRNANRRRRRRNRNRNNNTTAACGAAGCTACAAAGACATTAGTTGACACAANCANNNNNNNNRR  cvi-0.fa
64798  NNNNNTTTATCTGCNNNRNNNRRRRRRNRNRNNNNNAACGAAGCTACAAAGACATTAGNTGACACAAACAAANNNNNNRR  est-1.fa
64798  TCATTTTTATCTGCGAARTTTRRRRRRNRNRNNNTTAACGAAGCTACAAAGACATTAGTTGACACAAACAANNNNNNNRR  fei-0.fa
64798  NNNNNNNNNNNNNNNNNRNNNRRRRRRNRNRNNNNNNNNNNNGCTACAAAGACATNNNNNNNNNNNAANAAAANNNNNRR  got-7.fa
64798  TCNTTTTTATCTGCNNNRNNNRRRRRRNRNRNNNNNAACGAAGCTACAAAGACATTAGTTGACACAANCANANNNNNNRR  ler-1.fa
64798  NNNNNNNNNNNNNNNNNRNNNRRRRRRNRNRNNNNNAACGAAGCTACAAAGACATTAGNNGNCANNNNNNNNNNNNNNRR  lov-5.fa
64798  TCNTTTTTATCTGCGNNRNNNRRRRRRNRNRNNNTTAACGAAGCTACAAAGACATTAGTTGACACAANCANANNNNNNRR  nfa-8.fa
64798  NNNNNTTTATCTGNNNNRNNNRRRRRRNRNRNNNNNAACGAAGCTACAAAGACATTAGTTGACACAANCANANNNNNNRR  rrs-10.fa
64798  NNNNNTTTATCTGCNNNRNNNRRRRRRNRNRNNNNNNACGAAGCTACAAAGACATTAGTTGACACAAACAAANNNNNNRR  rrs-7.fa
64798  TCATTTTTATCTNNNNNRNANRRRRRRNRNRNNNNTAACGAAGCTACAAAGACATTAGTTGACACAANCANNNNNNNNRR  sha.fa
64798  NNNNNTTTNNNNNNNNNRNNNRRRRRRNRNRNNNNTAACGAAGCTACAAAGACATTAGTTGACACAAACAANNNNNNNRR  tamm-2.fa
64798  NNNNNTTTATCTGCNNNRNNNRRRRRRNRNRNNNNNAACGAAGCTACAAAGACATTAGTTGACACAAACANNNNNNNNRR  ts-1.fa
64798  NNNNNNNNNNNNNNNNNRNNNRRRRRRNRNRNNNNNNACGAAGCTACAAAGACNTTNNNNNNNNNNNNNANNNNNNNNRR  tsu-1.fa
64798  NNNTTTTTATCTGCNNNRNNTRRRRRRNRNRNNNNTAACGAAGCTACAAAGACATTAGTTGACACAANCANAANNNNNRR  van-0.fa
 
64878  GAAGAAGAAGAAGAAGAACAGACCTTGTAGTTGTCTTTACGGACATTAAAGCCTAATGGCTTTGCGGTTTCTTCCATTTT  chr1.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRTGTAGTTGTCTTTACGGACATTAAAGCNNNNNNNNNNTGCGGTTTCTTCCATTTT  bay-0.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRNNTAGTTGTCTTTACGGACATTAAANNNNNNNNGCTTTGCGGTTTCTNCCATTTT  bor-4.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRNGTAGTTGTCTTTACGGACATTAAAGCCNAANGGNTTTGCGGTTTCTNCCATTTT  br-0.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRTGTAGTTGTCTTTACGGACATTAAAGCCNAATGGCTTTGCGGTTTCTTCCATTTT  bur-0.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRTGTAGTTGTCTTTACGGACATTAAAGCCNAANGGNTTTGCGGTTTCTNCCATTTT  c24.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRNGTAGTTGTCTTTACGGACATTAAANNNNNNNNNCTTTGCGGTTTCTTCCATTTT  col-0.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRTGTAGTTGTCTTTACGGACATTAAAGCCTAATGGCTTTGCGGTTTCTNCCATTTT  cvi-0.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRTNTAGTTGTCTTTACGGACATTAANNNNNNNNGGCTTTGCGGTTTCTTCCATTTT  est-1.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRTGTAGTTGTCTTTACGGACATTAAANNNNNNTGGCTTTGCGGTTTCTTCCATTTT  fei-0.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRTGTAGTTGTCTTTACGGACANNNNNNNNNNNNNGCTTTGCGGTTTCTNCCNTNNN  got-7.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRNNNAGTTGTCTTTACGGACATNNNNNNNNNNNNNNTTTGCGGTTTCTTCCATTTT  ler-1.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRNNNAGTTGTCTTTACNNNNNNNNNNNNNNNNNNNNNNTGCGGTTTCTNCCATTTT  lov-5.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRTGTAGTTGTCTTTACGGACATTAAAGNNNNNNGGCTTTGCGGTTTCTTCCATTTT  nfa-8.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRTGTAGTTGTCTTTACGGACATTAAANNNNNNNGGCTTTGCGGTTTCTTCCATTTT  rrs-10.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRNNNAGTTGTCTTTACGGACATTANNNNNNNNNNGCTTTGCGGTTTCTTCCATTTT  rrs-7.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRTGTAGTTGTCTTTACGGACATTAAANNNNNNNNGCTTTGCGGTTTCTTCCATTTT  sha.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRNNNAGTTGTCTTTACGGACATTNNNNNNNNNNNNNNTTGCGGTTTCTTCCATTTT  tamm-2.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRNNNAGTTGTCTTTACGGACATTNNNNNNNNNNNNNNNNGCGGTTTCTNCCATTTN  ts-1.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRNNNAGTTGTCTTNANGGNCANNNNNNNNNNNNNNCTTTGCGGTTTCTTCCATTTN  tsu-1.fa
64878  RRRRRRRRRRRRRRRRRRRRRRRRRTGTAGTTGTCTTTACGGACATTAAAGCCTNATGGCTTTGCGGTTTCTTCCATTTN  van-0.fa
 
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCGTTTCTTTCTTCACAAGTTGCTGCAAACAACAACAAATCA  chr1.fa
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCGTTTCTTTCTTCACAAGTTGCTGCAAACAANAACAAATCA  bay-0.fa
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCGTTTCTTTCTTCACAAGTTGCTGCAAACAACAACANNNNN  bor-4.fa
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCGTTTCTTTCTTCACAAGTTGCTGCAAACAACAACAAANNN  br-0.fa
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCGTTTCTTTCTTCACAAGTTGCTGCAAACAACAACNNNNNN  bur-0.fa
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCGTTTCTTTCTTCACAAGTTGCTGCAAACAACAACANATCA  c24.fa
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCGTTTCTTTCTTCACAAGTTGCTGCAAACAACAACAAANNN  col-0.fa
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCGTTTCTTTCTTCACAAGTTGCTGCAAACAACAANNNNNNN  cvi-0.fa
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCGTTTCTTTCTTCACAAGTTGCTGCAAACAACAACNNNNNN  est-1.fa
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCGTTTCTTTCTTCACAAGTTGCTGCAAACAACAACAAATCA  fei-0.fa
64958  NNACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCNTTTCTTTCTTCACAAGTTGCTGCAAACAACANNNNNNNN  got-7.fa
64958  CGANATTATTTCACTCGCAGATCGTTGAGAAGTNNNNNNCGTTTCTTTCTTCACAAGTTGCTGCAAACAANNNNNNNNNN  ler-1.fa
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGNNNNNNNNNNTTCTTTCTTCACAAGTTGCTGCAAACANNNNNNNNNNN  lov-5.fa
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCGTTTCTTTCTTCACAAGTTGCTGCAAACAACAACAAATCN  nfa-8.fa
64958  CGACATTATTTCACTCGCAGATCGTTGANAAGTAAACCGCGTTTCTTTCTTCACAAGTTGCTGCAAACAANNNNNNNNNN  rrs-10.fa
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCNTTTCTTTCTTCACAAGTTGCTGCAAACAACANNNNNNNN  rrs-7.fa
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCGTTTCTTTCTTCACAAGTTGCTGCAAACAACAACAAANNN  sha.fa
64958  CGNCATTATTTCACTCGCAGATCGTTGAGAAGTAAACCNCGTTTCTTTCTTCACAAGTTGCTGCAAACAACAACANNNNN  tamm-2.fa
64958  NNNCATTATTTCACTCGCAGATCGTTGANAANNNNNNNNCNTTTCTTTCTTCACAAGTTGCTGCAAACAACAANNNNNNN  ts-1.fa
64958  NNNNATTATTTCACTCGCAGATCGTTGAGAAGNANNCNGCGTTTCTTTCTTCACAAGTTGCTGCAAACANNNNNNNNNNN  tsu-1.fa
64958  CGACATTATTTCACTCGCAGATCGTTGAGAAGTAAACCGCGTTTCTTTCTTCACAAGTTGCTGCAAACAACAANNNNNNN  van-0.fa
 
65038  GATTTAGTTAGATAAAACCTATGCATGATTTTAGAAAATCAAGACAAACTGTAAGTAGAAAAAAGTTCTTACCGCTTGCT  chr1.fa
65038  GATTTAGTTAGATAAAACCTATGCATGATTNNNGAANNNRAANACAAACTGTAAGTAGAAAAAAGTTCTTACCGCTTGCT  bay-0.fa
65038  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNAAAGTTCTTACCGCTTGCT  bor-4.fa
65038  NNNNNNGTTAGANNNNNNNTATGCANNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNAAAAAGTTCTTACCGCTTGCT  br-0.fa
65038  NNNNNNNNNNNNTAAAACCTATGCATGATTTTAGAAANNRAAGACAAACTGTAAGTAGAAAAAAGTTCTTACCGCTTGCT  bur-0.fa
65038  GATTNAGTTAGATAAAACCTATGCATGATTTNNNNNNNNRAAGACAAACTGNAAGTAGAAAAAAGTTCTTACCGCTTGCT  c24.fa
65038  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNCNNNNNNNNNNNNNNNNNAAGTTCTTACCGCTTGCT  col-0.fa
65038  NNNNNNNNNNNNNAAAACCTATGCATGATNNNNNNNNNNRNNGACAAACTGNAAGTAGAAAAAAGTTCTTACCGCTTGCT  cvi-0.fa
65038  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNACAANNNNNNNNNNNNNAAAAGTTCTTACCGCTTGCT  est-1.fa
65038  NNNNNNNTTAGATAAAACCTATGCATGATNNNNNNNNNNRNNNNNNNNCNGTAAGTAGAAAAAAGTTCTTACCGCTTGCT  fei-0.fa
65038  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNAAGTTCTTACCGCTTGCT  got-7.fa
65038  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNAAAGTTCTTACCGCTTGCT  ler-1.fa
65038  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNAAGTTCTTACCGCTTGCT  lov-5.fa
65038  NNNNNNNNTNGATAAAACCNATGCATNNNNNNNNNNNNNRNANACAAANNNNNAGTAGAAAAAAGTTCTTACCGCTTGCT  nfa-8.fa
65038  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNACAANNNNNNNGTAGANAAAAGTTCTTACCGCTTGCT  rrs-10.fa
65038  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNAGTTCTTACCGCTTGCT  rrs-7.fa
65038  NNNNNNNNTAGANAAAACCTATGCATNNNNNNNNNNNNNRNNNACNAANNGTAAGTAGAAAAAAGTTCTTACCGCTTGCT  sha.fa
65038  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNAAAAAGTTCTTACCGCTTGCT  tamm-2.fa
65038  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNAAAAGTTCTTACCGCTTGCT  ts-1.fa
65038  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNAGTTCTTACCGCTTGCT  tsu-1.fa
65038  NNNNNNNNNNNNNNNNNNNTATGNNNNNNNNNNNNNNNNRNNNACANNNNNNNNNNNNNAAAAAGTTCTTACCGCTTGCT  van-0.fa
 
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTCCTTC  chr1.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTNCTTC  bay-0.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTNCTTC  bor-4.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTNCTTC  br-0.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTCCTTC  bur-0.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTCCTTC  c24.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTNNNNN  col-0.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTCCTTC  cvi-0.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATNCAGGTTTCTNCTTC  est-1.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTCCTTC  fei-0.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATNAGTTCGAAAGCGTTCATGGATACAGGTTNNNNNNNN  got-7.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCNNNNNN  ler-1.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGNNNNNNTCGAAAGCGTTCATGGATACAGGTTNNNNNNNN  lov-5.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTCCTTC  nfa-8.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACANNNNNNNNNNNN  rrs-10.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTNCTTC  rrs-7.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTCCTTC  sha.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGNGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCNNNNNN  tamm-2.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTNCTTC  ts-1.fa
65118  TCTCGAACAAGTTTTCNAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTNNTNN  tsu-1.fa
65118  TCTCGAACAAGTTTTCAAGACTGAACTCGCTTGAGCTAGAGATAAGTTCGAAAGCGTTCATGGATACAGGTTTCTNCTTC  van-0.fa
 
65198  TTCTCAGTTACAAGACATTCCTAGAGTAGCAGCACAAAAAGAGTGATATTAGTTGGTAACAATACATTGGTTTACTTAAA  chr1.fa
65198  TTCTCAGTTACAAGACATTCCNNNNNTAGCAGCACAAAAAGAGTGATATTAGTTGGTAACAATACATTGGTTTACTTAAA  bay-0.fa
65198  TTNNNNNTTACAAGACATTCCTAGAGTAGCAGCACAAAAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTAAA  bor-4.fa
65198  TTCTCAGTTACAAGACATTCCTAGAGTAGCAGCACAAAAAGAGTGATATTAGNNNNNAACAATACNNNNNNNTACTTAAA  br-0.fa
65198  TTCTCAGTTACAAGACATTCCTAGAGTAGCAGCACAAAAAGAGTGATATTAGTTGGTAACAATACATTGGTTTACTTAAA  bur-0.fa
65198  TTCTCAGTTACAAGACATTCCTAGAGTAGCAGCACAAAAAGAGTGATATTAGTTGGTAACAATACATTGGTTTACTTAAA  c24.fa
65198  TTCTCAGTTACAAGACATTCCTAGAGTAGCAGCACAAAAAGAGNNNNNNNNGNNNNNNNCAATANNNNNNNNNNCTTAAA  col-0.fa
65198  TTCTCAGTTACAAGACATTCCTAGAGTAGCAGCACAAAAAGAGTGATATTAGTTGGTAACAATACATTGNTTTACTTAAA  cvi-0.fa
65198  TTCTCAGTTACAAGACATTCCTAGAGTAGCAGCACAAAAAGAGTNANANNNNNNNNNNNNNNNNNNNNNNNNNNNTTAAA  est-1.fa
65198  TTCTCAGTTACAAGACATTCCTAGAGTAGCAGCACAAAAAGAGTGATATTAGTTGGTAACAATACATTGNTTTACTTAAA  fei-0.fa
65198  TTCTNNNNNACAAGANATTCCTAGAGTAGCAGCACAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
65198  NTNNNNNNNNCAAGACATTCCTAGAGTAGCAGCACAAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAA  ler-1.fa
65198  NNNNNNNNNNCANGANATTCCTAGAGTAGCAGCACAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
65198  TTCTCAGTTACAAGACATTCCTAGAGTAGCAGCACAAAAAGAGTGATATTAGTTGGTAACAATACANNNNNTTACTTAAA  nfa-8.fa
65198  NNNNNNNNNNNNNNNNNNNNCTAGAGTAGCAGCACAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
65198  TTCTCNGTTACAAGACATTCCTAGAGTAGCAGCACAAAAAGAGTGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNANA  rrs-7.fa
65198  TTCTCAGTTACAAGACATTCCTAGAGTAGCAGCACAAAAAGAGTGANATTAGTTGGTAACAATACNNNNNNNNACTTAAA  sha.fa
65198  NTNTCAGTTACAAGACATTCCTAGAGTAGCAGCACAAAAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAAA  tamm-2.fa
65198  TTCTNNNNNACAAGACATTCCTAGAGTAGCAGNACAAAAAGAGNNNNNNNNNNNNNNNNNAANNNNNNNNNNNNNNNNAA  ts-1.fa
65198  NNNNNNNNNNNNNGACATTCCTAGAGTAGCAGCACAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
65198  TTCNCAGTTACAAGACATTCCTAGAGTAGCAGCACAAAAAGAGNNNNNTTANNNNNNNNCAATNNNNNNNTTTACTTAAA  van-0.fa
 
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCAGCATCAAC  chr1.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCNNNNNCAAC  bay-0.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCNNNNNCAAC  bor-4.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCNNNNNCAAC  br-0.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCNNNNNCAAC  bur-0.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCAGCANCAAC  c24.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCAGCANCAAC  col-0.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCAGCANCAAC  cvi-0.fa
65278  CCGANNNNNNATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCNNNNNCAAC  est-1.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCNGCANCAAC  fei-0.fa
65278  NNNNNNNNNGATATANACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAANNNNNNNCAAC  got-7.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCNNNNNCAAC  ler-1.fa
65278  NNNNACTATGNTATACNCAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGNGTTACTAAAANNNNNNNCANC  lov-5.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCAGCANCAAC  nfa-8.fa
65278  NNNNNNNATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCAGCATCNNN  rrs-10.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCAGCANCAAC  rrs-7.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCNGCANCAAC  sha.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCAGCANCAAC  tamm-2.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAANTGGCGGTGTTTACCTTGGAGTTACTAAAAGCAGCANCAAC  ts-1.fa
65278  NNNANNNNNNNTATACACAANCAGATGGAGANTTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCAGCANCAAC  tsu-1.fa
65278  CCGAACTATGATATACACAACCAGATGGAGAATTTGGAAATGGCGGTGTTTACCTTGGAGTTACTAAAAGCAGCANCAAC  van-0.fa
 
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGAACCATTCATCTTCGAGCA  chr1.fa
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACNCTTTCTTGAARRRRTCATCNTCRAGRA  bay-0.fa
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGNNRRRRNNNTCTTCRAGRA  bor-4.fa
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGAARRRRTCATCTTCRAGRA  br-0.fa
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGAARRRRTCNTCNTCRAGRA  bur-0.fa
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACNNNNNNNTNNNRRRRTCATCTTNRAGRA  c24.fa
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGNARRRRTCATCTTCRAGRA  col-0.fa
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGAARRRRTCATCTTCRAGRA  cvi-0.fa
65358  ATCATCTNTGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGNARRRRTCATCTTCRAGRA  est-1.fa
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGAARRRRTCNTCTTCRAGRA  fei-0.fa
65358  ATCATNTATGGTTNTGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTNNNRRRRTCATCTTCRAGRA  got-7.fa
65358  ATCATCNATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGNARRRRTCATCNTCRAGRA  ler-1.fa
65358  NNNNNNNNNNNTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCNNNNNRRRRTCATCNNCRAGRA  lov-5.fa
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGAARRRRTCATCNTCRAGRA  nfa-8.fa
65358  NNCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTNNARRRRTCATCTTCRAGRA  rrs-10.fa
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGNARRRRTCATCTTCRAGRA  rrs-7.fa
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGNARRRRTCATCNTCRAGRA  sha.fa
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGNNRRRRTCATCTTCRAGRA  tamm-2.fa
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGNNRRRRTCATCTTCRAGRA  ts-1.fa
65358  ATCNNNNNNNNNTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCNNNNNRRRRNCATCNNCRAGRA  tsu-1.fa
65358  ATCATCTATGGTTATGTCCTCGTCATCTTGGTCAAATGATGGCGGCTTGTACCCTTTCTTGNARRRRTCATCTTCRAGRA  van-0.fa
 
65438  ACTCTGCAATACTTATTCTCTGCATTTCAGAAATAAGTACATACTTAAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  chr1.fa
65438  ACTCTGCANNNRRRRRRRRRRRRATTTCAGAAATNNNNNNATACTTAAGCTCTTGCACAATCTATGGTTGGCAGCNTGTC  bay-0.fa
65438  ACTCTGCNNNNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNAAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  bor-4.fa
65438  ACTCTGCANNNRRRRRRRRRRRRNNNNCANNNNNNNNNNNNTACTTAAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  br-0.fa
65438  ACTCTGCAATARRRRRRRRRRRRATTTCAGAAATNNNNNNATACTTAAGCTCTTGCACAATCTATGGTTGGCAGCNTGTC  bur-0.fa
65438  ACTCTGCAATARRRRRRRRRRRRATTTCAGAAATAANTACATACTTAAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  c24.fa
65438  ACTCTGCANNNRRRRRRRRRRRRNNNTCAGNNNNNNNNNNNNNNNNAAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  col-0.fa
65438  ACTCTGCAANARRRRRRRRRRRRNTTTCAGAANNNNNNNNNNNNNTAAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  cvi-0.fa
65438  ACTCTGCANNNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNTAAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  est-1.fa
65438  ACTCTGCAATARRRRRRRRRRRRATTTCAGAAANNNNNNNNTACTTAAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  fei-0.fa
65438  ACTCTGNNNNNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNTAAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  got-7.fa
65438  ACTCTGNNNNNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNAGCTCTTGCACAATCTATGGTTGGCAGCNTGNC  ler-1.fa
65438  ACTCTGNNNNNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNAGCTCTTGCACAATCTATGGTTGGCAGCATGNN  lov-5.fa
65438  ACTCTGCAANNRRRRRRRRRRRRNNNTCAGANNNNNNNNNNNNNNTAAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  nfa-8.fa
65438  ACTCTGCANNNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNCTTAAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  rrs-10.fa
65438  ACTCTGCANNNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNAAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  rrs-7.fa
65438  ACTCTGCANNNRRRRRRRRRRRRNNNTCAGAANNNNNNNNNNNNNTAAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  sha.fa
65438  ACTCTGNNNNNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNAAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  tamm-2.fa
65438  ACTCTGCANNNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  ts-1.fa
65438  ACTCTNNNNNNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNGCTCTTGCACAATCTATGGTTGGCAGCATGTC  tsu-1.fa
65438  ACTCTGCAANNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNAGCTCTTGCACAATCTATGGTTGGCAGCATGTC  van-0.fa
 
65518  ATGTTCACATTTTCACAACTATTACTTCATGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  chr1.fa
65518  ATGTTCACATTTTCACAACTATTACTTCATGTAAGAGGCACTTANGGTAATAGGGTTNGGTTCGAGAATACGCTTGATGA  bay-0.fa
65518  ATGTTCACATTTTNNNNNNNNNNNNNNNATGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  bor-4.fa
65518  ATGTTCACATTTTCACNANNANTACTTCATGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  br-0.fa
65518  ATGTTCACATTTTCACAACTATTACTTCATGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  bur-0.fa
65518  ATGTTCACATTTTCACAACTATTACTTCATGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  c24.fa
65518  ATGTTCACATTTTCACAANNNNNNNNNNATGTAAGAGGCACTTACGGTAATAGGNTTGGGTTCGAGAATACGCTTGATGA  col-0.fa
65518  ATGTTCACATTTTCACAACTATTNCTTCATGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  cvi-0.fa
65518  ATGTTCACATTTTCANANNNNNNNNNNCATGTAAGAGGCACTTACGGTAATAGGGTTNGGTTCGAGAATACGCTTGATGA  est-1.fa
65518  ATGTTCACATTTTCACAACTATTACTTCATGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  fei-0.fa
65518  ATGTTCACANNNNNNNNNNNNNNNNNNNNTGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  got-7.fa
65518  ANGTTCACATTTTCACANNNNNNNNNNNNNNTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  ler-1.fa
65518  NNNTTCACATNNNNNNNNNNNNNNNNNNNNNNNNNNGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  lov-5.fa
65518  ATGTTCACATTTTCACAACTATNNNNNNATGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  nfa-8.fa
65518  ATGTTCACATTTTCACANNNNNNNNNNNNTGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  rrs-10.fa
65518  ATGTTCACATTTTCACANNNNNNNNNNCATGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  rrs-7.fa
65518  ATGTTCACATTTTCACAACTATNNCTTCATGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  sha.fa
65518  ATGTTCACATTTTCACANNNNNNNNNNNNTGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  tamm-2.fa
65518  ATGTTCACATTTTCACANNNNNNNNNNNATGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  ts-1.fa
65518  ATGTNCANANNNNNNNNNNNNNNNNNNNNNNNAAGAGGCACTTACGGTNNNNNNNTTGGGTTCGAGAATACGCTTGATGA  tsu-1.fa
65518  ATGTTCACATTTTCACAANNNNNNNNNCATGTAAGAGGCACTTACGGTAATAGGGTTGGGTTCGAGAATACGCTTGATGA  van-0.fa
 
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATATCTAAAGTATATATTAAACACCAAAG  chr1.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATATCTAAAGTATATATTAAACACCAAAG  bay-0.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATANNNNNNNNNNNNNNNNNNCACCAAAG  br-0.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCNNNNNNNNNNNNNNNNNNNNNNACCAAAG  bur-0.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATATCTNNNNNNNNNNNNNNNCACCAAAG  c24.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATNNNNNNNNNNNNNNNNNNNCACCAAAG  col-0.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATATCNNNNNNNNNNNNNNNNCACCAAAG  cvi-0.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATANNNNNNNNNNNNNNNNNNNACCAAAG  est-1.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATATCNNNNNNNNNNNTTAAACACCAAAG  fei-0.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATANNNNNNNNNNNNNNNNNNNNCCAAAG  ler-1.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCNAAACTCAGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAG  lov-5.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATATNNNNNNNNNNNNNNNNNCACCAAAG  nfa-8.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATNNNNNNNNNNNNNNNNNNNNNCNNNNN  rrs-10.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATANNNNNNNNNNNNNNNNNNNNNCAAAG  rrs-7.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATATNNNNNNNNNNNNNNNNNCACCAAAG  sha.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATANNNNNNNNNNNNNNNNNNNACCAAAG  tamm-2.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATNNNNNNNNNNNNNNNNNNNNACCAAAG  ts-1.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCANNNNNNNNNNNNNNNNNNNNNNNNAAAG  tsu-1.fa
65598  CTCTCTTGGCACCTTGCGAGAACCATGGTGGGCAGCTAAACTCAGCCTTGCATANNNNNNNNNNNNNNNNNNNNCCAAAG  van-0.fa
 
65678  ATGAGACTAGAAAAGTACTGCAGAAGATCAAGAAGCAGAGGGAGAGATAATTTACACGTACACGTTTGTATAATGTCATG  chr1.fa
65678  ATGAGACTAGAAAAGTACNGCAGAAGANRNAGAAGCAGANGGAGAGATAATTTACACGTACACGTTTGTATAATGTCATG  bay-0.fa
65678  NNNNNNNNNNAAAANNNNNGNAGNNNNNRANNAAGCANNNNNNNAGATAATTTACACGTACNCGTTTGTATAANGTCATG  bor-4.fa
65678  ATGAGACTAGAAAAGTACTGCAGAAGNNRNANAAGCNNNNNGAGAGATAATTTACACGTACACGTTTGTATAATGTCATG  br-0.fa
65678  ATGAGACTAGAAAAGTACTGCAGAAGNTRAAGAAGCAGAGGGAGAGATAATTTACACGTACACGTTTGTATAATGTCATG  bur-0.fa
65678  ATGAGACTAGAAAAGTACTGCAGAAGATRNAGAAGCAGAGGGAGAGATAATTTACACGTACACGTTTGTATAATGTCATG  c24.fa
65678  ATGAGACTAGAAAAGTACTGCAGAAGANRAANAAGCAGANGNAGAGATAATTTACACGTACACGTTTGTATAATGTCATG  col-0.fa
65678  ATGAGACTAGAAAAGTACTGCAGAAGNTRAAGAAGCAGAGGGAGAGATAATTTACACGTACACGTTTGTATAATGTCATG  cvi-0.fa
65678  ATGAGACTAGAAAAGTACTGCAGAAGANRNAGAAGCAGNNNNAGAGATAATTTACACGTACACGTTTGTATAATGTCATG  est-1.fa
65678  ATGAGACTAGAAAAGTACNGCAGAAGNTRAAGAAGCAGAGGGAGAGATAATTTACACGTACACGTTTGTATAATGTCATG  fei-0.fa
65678  NNNNNNNTAGAAAAGTACNGCAGAAGNNRNNNAANNNNNNNNNNNNNNNNNNNNNNCGTACACGTTTNNNNNNNNNCATG  got-7.fa
65678  ATGAGNCTAGAAAAGTACTGCAGAAGNNRNNNNNNNNNNNNNNNNGATAATTTACACGTACACNTTTGTATAATGTCATG  ler-1.fa
65678  ANGANNNNNNNAAAGNNNNGCAGAANNNRNNNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATG  lov-5.fa
65678  ATGAGACTAGAAAAGTACTGCAGAAGANRAAGAAGCAGAGGGAGAGATAATTTACACGTACACGTTTGTATAATGTCATG  nfa-8.fa
65678  NNNNNNNNNGAAAAGNACTGCAGAANNNRNNNAANCANNNNNAGAGATAATTTACACGTACACGTTTGTNNNNNNNCATG  rrs-10.fa
65678  ATGAGACTAGAAAAGTACTGCAGAAGANRNANAAGNNNNNNNNNNGATAATTTACACGTACACGTTTGTATAATGTCATG  rrs-7.fa
65678  ATGAGACTAGAAAAGTACNGCAGAAGNNRAANAAGCAGNGGGAGAGATAATTTACACGTACACGTTTGTATAATGTCATG  sha.fa
65678  ATGAGACTAGAAAAGTACNGCAGAAGANRNANANNNNNNNNNNNNGATAATTTACACGTACACGTTTGTATAATGTCATG  tamm-2.fa
65678  ANGANACNAGAAAAGTACNGCAGAAGNNRNANAAGNNNNNNNNNNGATAATTTACACGTACACGTTTGTATAATGTCATG  ts-1.fa
65678  ANNNNNNNNGAAAAGNNNNGCAGAANANRNNNNNNNNNNNNNNNNNANNNNNNNNANGTNNNNNTTTGTANNNNNNNATG  tsu-1.fa
65678  ATGAGACTAGAAAAGTACTGCAGAAGNNRAAGAAGCAGAGGGAGAGATAATTTACACGTACACGTTTGTATAATGTCATG  van-0.fa
 
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATGACACCACAAGACCAGACATCTGCTGCTGC  chr1.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATNACACCACAANANNANACATCTGCTGCTGC  bay-0.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATGACACCACAAGACCAGACATCTGCTGCTGC  bor-4.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATGACACCACAAGACCAGACATCTGCTGCTGC  br-0.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACNAAGAGAATGACACCACAANANNANACATCTGCTGCTGC  bur-0.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATGACACCACAANANNANACATCTGCTGCTGC  c24.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATGACACCACAAGACCAGACATCTGCTGCTGC  col-0.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGNGAATGACACCACAAGACCAGACATCTGCTGCTGC  cvi-0.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATGACACCACAAGACCAGACATCTGCTGCTGC  est-1.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATGACACCACAAGACCANACATCTGCTGCTGC  fei-0.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAANNAGAATGACACCACAAGACCAGACATCTGCTGCTGC  got-7.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACNAAGAGAATGACNCCACAANACCAGACATCTGCTGCTGC  ler-1.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAANNNNNNCACAANANNANACATCTGCTGCTGC  lov-5.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATGACACCACAAGACCAGACATCTGCTGCTGC  nfa-8.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATGACACCACAAGACCAGACATCTGCTGCTGC  rrs-10.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATGACACCACAAGACCAGACATCTGCTGCTGC  rrs-7.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACNAANAGNATGACACCACAANACCAGACATCTGCTGCTGC  sha.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATGACACCACAANACCAGACATCTGCTGCTGC  tamm-2.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATGACACCACNAGACCANACATCTGCTGCTGC  ts-1.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATGNCACCACAANANNANACATCTGCTGCTGC  tsu-1.fa
65758  AGATTCGGCTCATCAAAAGGCAAGTAACCAGCCATAAGCACAAAGAGAATGACACCACAAGACCAGACATCTGCTGCTGC  van-0.fa
 
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCAGCAAATCCAACACAATGCAGTAGACAACATTAAAGGCATATCTCTTA  chr1.fa
65838  ACCGTCATAGCCTTTNTNNNNNNNAACCTGCCAGCAAATCCAACACAATGCAGTAGACAACATTAAAGGCATATCTCTTA  bay-0.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATNANNNNNNNNNNNNNNN  bor-4.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCANCAAATCCAACACAATGCAGTAGACAACATTAAAGGNNNNNNNNNNN  br-0.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCAGCAAATCCAACACAATGCAGTAGACAACATTAAAGGCATATCTCTTA  bur-0.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCNGCCAGCAAATCCAACACAATGCAGTAGACAACATTAAAGGCATATCTCTTN  c24.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCAGCAAATCCAACACAATGCAGTAGACAACATTAAAGNNNNNNNNNNNN  col-0.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCAGCAAATCCAACACAATGCAGTAGACAACATTAAAGGCATANCTCTNN  cvi-0.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCAGCAAATCCAACACAATGCAGTAGACAACATTAAANNNNNNNNNNNNN  est-1.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCNGCCAGCAAATCCAACACAATGCAGTAGACAACATTAAAGGCATANCTCTNN  fei-0.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCAGCAAATCCAACACAATGCAGTAGACAANNNNNNNNNNNNNNNNNNNN  got-7.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCAGCAAATCCAACACAATGCAGTAGACAACANNNNNNNNNNNNNNNNNN  ler-1.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCAGCAAATCCAACANNNNNNNNNNNNNNACANNNNNNNNNNNNNNNNNN  lov-5.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCAGCAAATCCAACACAATGCAGTAGACAACATTAAAGGCATATNNNNNN  nfa-8.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCAGCAAATCCAACACAATGCAGTAGACAACATNAANGNNNNNNNNNNNN  rrs-10.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNAANNNNNNNNNNNNN  rrs-7.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCAGCAAATCCAACACAATGCAGTAGACAACATTAAAGGCATANCTNTNN  sha.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCAGCAAATCCAACACAATGCAGTAGACAACATTAAANNNNNNNNNNNNN  tamm-2.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCNGNNANCAAATCCAACACAATGCAGNAGACAACATTAAAGNNNNNNNNNNNN  ts-1.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCAGCAAATCCAACACAATGCAGNAGACAACATNNNNNNNNNNNNNNNNN  tsu-1.fa
65838  ACCGTCATAGCCTTTGTCCGACAAAACCTGCCAGCAAATCCAACACAATGCAGTAGACAACATTAAAGNNNNNNNNNNNN  van-0.fa
 
65918  TATACATCATAAATAAAGAAGATTCTGCAAATGAAGTCTATATATACGTATAGCATTTGTTAGATTTCCTTCCTTTTTAA  chr1.fa
65918  TATACATCANNNNNAAAGAAGANTCTGCAAATGAAGTCTATANATACGTATAGCATTTGTTNGATTTCCTTCCTTTTTAA  bay-0.fa
65918  NNNNNNNNNNNNNNNNNNNNNNNNNNGCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
65918  NNNNNNNNNNNNNNNNAGAAGATNCTGCAAATGAAGNNNNNNNNNNNNNNNNNNATTTGTNNNNNNNNNNNNNNNNNNNN  br-0.fa
65918  NNNNNNNNNNNNNNNAAGAAGATTCTGCAAATGAAGTCTATATATACGTATAGCATTTGTTAGATTTCCTTCCTTTTTAA  bur-0.fa
65918  NNNNNNNNNNNNNNAAAGAAGATTCTGCAAATGAAGTCTANANNNNNGTATAGCATTTGTTAGATTTNCTTCCTTTTTAA  c24.fa
65918  NNNNNNNNNNNNNNNNNNNNNNTTCTGCAAATGNNNNNNNNNNNNNNNNNNNNNATTTGTTAGANNNNNNNNNNNNNNNN  col-0.fa
65918  NNNNNNNNNNNNNNNAAGAAGATTCTGCAAATGAAGTNNNNNNNNNNNNNNAGCATTTGTTAGATNNNNNNNNTTNTTNA  cvi-0.fa
65918  NNNNNNNNNNNNNNNNNNNNNNNNNNGCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNN  est-1.fa
65918  NNNNNNNNNNNNNNNNAGAAGATTCTGCAAATGAAGTCTANNNNNNNNNNNNGCATTTGTTAGATTTNCTTCCTTTTTAA  fei-0.fa
65918  NNNNNNNNNNNNNNNNNNNNNNNNNNGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
65918  NNNNNNNNNNNNNNNNNNNNNNNNNNGCAAANNNNNNNNNNNNNNNNNNNNNNNNNNTGTTAGANNNNNNNNNNNNNNNN  ler-1.fa
65918  NNNNNNNNNNNNNNNNNNNNNNNNNNGNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNN  lov-5.fa
65918  NNNNNNNNNNNNNNNAAGAAGATTCTGCAAATGAAGTNNNNNNNNNNNNNNNGCATTTGTTAGATTTNCTTCCTTNNNNA  nfa-8.fa
65918  NNNNNNNNNNNNNNNNNNNNNNNTCTGCAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
65918  NNNNNNNNNNNNNNNNNNNNNNNNNNGCAAATNNNNNNNNNNNNNNNNNNNNNNNNTTGTTNGNNNNNNNNNNNNNNNNN  rrs-7.fa
65918  NNNNNNNNNNNNNNNNAGAAGANTCTGCAAATGAAGNNNNNNNNNNNNNNNAGCATTTGTTAGATTTNCTTCCTTTTTAA  sha.fa
65918  NNNNNNNNNNNNNNNNNNNNNNNNNNGCAAANNNNNNNNNNNNNNNNNNNNNNNNNNTNTTANNNNNNNNNNNNNNNNNN  tamm-2.fa
65918  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
65918  NNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
65918  NNNNNNNNNNNNNNNNNNNNNNNNCTGCAAATGANNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNNNNNN  van-0.fa
 
65998  AAACGTATTAGCAGTTCTTGAATTCCTTAAAATCTTATTTTCCAAAGAGGATCTACAGAACATTTCATATTCTTTGCCTT  chr1.fa
65998  AAACGTATTAGCAGTTCTNNNNNTCCTTAAAATCTTATTTTCCAAAGAGGATCTACAGAACATTTCATNTTCTTTGCCTT  bay-0.fa
65998  NNNNNNNNNNGCAGTTCTNNNNNNNNNNNNNNNNNNNNNNNNCAAAGAGGATCNACNNNNNNNNNNNNNNNNNNNNNNNT  bor-4.fa
65998  NNNCGTATTAGCAGTTCNTGAANNNNNNNNNNNNNNNNNNNCCAAAGAGGATCTACAGANNNNNNNNNNNNNNNNNNNNT  br-0.fa
65998  AAACGTATTAGCAGTTCTTGAATTCCTTAAAATCTTATTTTCCAAAGAGGATCTACAGAACATTTCATATTCTTTGCCTT  bur-0.fa
65998  AAACGTATTAGCAGTTCTTGAATTCCTTAAAATNTTATTTTCCAAAGAGGATCTACAGAACANTTNATNNNNNNNGCCTT  c24.fa
65998  NNNNNNNTTAGCAGTTCTTGAATNNNNNNNNNNNNNNNNNNCCAAAGAGGANCTACAGANNNNNNNNNNNNNNNNNNNTT  col-0.fa
65998  AAACGTATTAGCAGTTCTTGAATTNNNNNNNNNNNNNNNTTCCAAAGAGGATCTACAGAACATTTCATNTTCTTTGCCTT  cvi-0.fa
65998  NNNNNNNNTAGCAGTTCTTGANNNNNNNNNNNNNNNNNNNNCCAAAGAGGATCTACAGNNNNNNNNNNNNNNNNNNNNNT  est-1.fa
65998  AAACGTATTAGCAGTTCTTGAATTNCNNNNNNNNNTATTTTCCAAAGAGGATCTACAGAACATTTCATATTCTTTGCCTT  fei-0.fa
65998  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
65998  NNNNNNNNNNGCAGTTCTTGANNNNNNNNNNNNNNNNNNNNNNAAAGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT  ler-1.fa
65998  NNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
65998  AAACGTATTAGCAGTTCTTGAATTCNNNNNNNNNNNNNTTTCCAAAGAGGATCTACAGANNNNNNNATNNNNNTTNCCTT  nfa-8.fa
65998  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAGAGGNTCTACAGNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
65998  NNNNNNNNNNNNNGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT  rrs-7.fa
65998  AAACGTATTAGCAGTTCTTGAATTCCTTANNNNNNNNNNNTCCAAAGAGGATCTACAGANNNNNNCATANNNNNNGCCTT  sha.fa
65998  NNNNNNNNNNGCAGTTCTTGANNNNNNNNNNNNNNNNNNNNNCAAAGAGNNNNNACNNNNNNNNNNNNNNNNNNNNNNTT  tamm-2.fa
65998  NNNNNNNNNAGCAGTTCTTGANNNNNNNNNNNNNNNNNNNNNNAAAGAGGNNNNNCNNNNNNNNNNNNNNNNNNNNCCTT  ts-1.fa
65998  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
65998  NNNNNNNTTAGCAGTTCTTGANNNNNNNNNNNNNNNNNNNNNNAAAGAGGATCTACAGNNNNNNNNNNNNNNNNNNNNTT  van-0.fa
 
66078  TTTAAGTGCTGAAAGTTAGTACATAATACCTCAGGGGCAACGTAGTTTGGCGTTCCACAAGCTGTATGAAGCAAACCATC  chr1.fa
66078  TTTAAGTGCTGAAAGTTAGTACATAATACCTCAGGNGCAACGTAGTTTGGCGTTCCACA