Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 6915 - 8666


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
6915  TCATACGATTCTGAAAAAATAAGACATATATTGCAACAGAGATCCAATTTGTATCAAAAATATTGTCGGCTCAAAAATCT  chr1.fa
6915  TCATACGATTCTGAAAAAANAAGACATATATTGCAACAGAGATCCAATTTGTATCAAAAATATTGTCGGCTCAAAAATCT  bay-0.fa
6915  TCATACGATTCNGNNNNNNNNNNNNNNNNNTTGCAACAGAGATCNNNNNNNNNNNNNAAATATTGTCGGCTCAAAAATCT  bor-4.fa
6915  TCATACGATTCTGAAAANNNNNNNNNNNNNNTGCAACAGAGATCCANNNNNNNNNNAAAATATTGTCGGCTCAAAAATCT  br-0.fa
6915  TCATACGATTCTGAAAAAANAAGACATATATTGCAACAGAGATCCAATTTGTATCAAAAATATTGTCGGCTCAAAAATCT  bur-0.fa
6915  TCATACGATTCTGAAAAAANAAGACATATATTGCAACAGAGATCCAATTTGTATCAAAAATATTGTCGGCTCAAAAATCT  c24.fa
6915  TCATACGATTCNGAAAANNNNNNNNNNNNNNNGCAACAGAGATCCAATNNNNNNNNAAAATATTGTCGGCTCAAAAATCT  col-0.fa
6915  TCATACGATTCTGAAAANNNNNNACATATATTGCAACAGAGATCCAATTTGNATCAAAAATATTGTCGGCTCAAAAATCT  cvi-0.fa
6915  TCATACGATTCNGAAANNNNNNNNNNNNNNTTGCAACAGAGATCCANNNNNNNTCAAAAATATTGTCGGCTCAAAAATCT  est-1.fa
6915  TCATACGATTCTGAAAANNNNNNACATATATTGCAACAGAGATCCAATTTGTATCAAAAATATTGTCGGCTCAAAAATCT  fei-0.fa
6915  TCATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAGAGATCCANNNNNNNNNNNAAATATTGTCGGCTCAAAAATCT  got-7.fa
6915  TCATACGATTCTGAAAANNNNNNNCNTATATTGCAACAGAGATCCAATTTNNNNNNAAAATATTGTCGGCTCAAAAATCT  ler-1.fa
6915  TCATACGATTCTGAANNNNNNNNNNNNNNNNNNNAACAGAGATCCAATTTNNNNNNNAAATATTGTCGGCTCAAAAATCT  lov-5.fa
6915  TCATACGATTCTGAAAANNNNNNACATATATTGCAACAGAGATCCAATTTGTATCAAAAATATTGTCGGCTCAAAAATCT  nfa-8.fa
6915  TCATACGATTCTGAAAANNNNNNNNNNNNNNNGCAACAGAGATCCANNNNNNNNNAAAAATATTGTCGGCTCAAAAATCT  rrs-10.fa
6915  TCATACGATTCTGAAAAAANAANACNTATATTGCAACAGAGATCCAATTTGNATCAAAAATATTGTCGGCTCAAAAATCT  rrs-7.fa
6915  TCATACGATTCTGAAAAAANAAGACATATATTGCAACAGAGATCCAATTTGTATCAAAAATATTGTCGGCTCAAAAATCT  sha.fa
6915  TCATACGATTCNGAAAANNNNNNNNNTNNATTGCAACAGAGATCCAATTTNNNNNNNAAATATTGTCGGCTCAAAAATCT  tamm-2.fa
6915  TCATACGATTCTGAAAANNNNNNNNNNATATTGCAACAGAGATCCAATTTNNNNCAAAAATATTGTCGGCTCAAAAATCT  ts-1.fa
6915  TCATACGATTCNGNNNNNNNNNNNNNNNNNNNGCAACAGAGATCNNNNNNNNNNNNNNNATATTGTCGGCTCAAAAATCT  tsu-1.fa
6915  TCATACGATTCTGAAANNNNNNNNNNNNNNNTGCAACAGAGATCCAATTNNNNNNAAAAATATTGTCGGCTCAAAAATCT  van-0.fa
 
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  chr1.fa
6995  GNNNNNCCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTNNNNNATCACTGGT  bay-0.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  bor-4.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  br-0.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  bur-0.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  c24.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  col-0.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  cvi-0.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  est-1.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  fei-0.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  got-7.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  ler-1.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  lov-5.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  nfa-8.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  rrs-10.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  rrs-7.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  sha.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  tamm-2.fa
6995  GACCCACCAAGAANCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  ts-1.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  tsu-1.fa
6995  GACCCACCAAGAATCTAATCAAGTGCGCGATTAAGCATACGGCTATGCATCTGGTCATTGTTGATTCAGTCATCACTGGT  van-0.fa
 
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAAAATAACAACAACAAAAAACAATTTGCATTGAGAACATTTTGAAGGTCTG  chr1.fa
7075  TTNNNNNNAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNAATTTGCATTGAGAACATTTTGAAGGTCTG  bay-0.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNNNNTTGCATTGNGAACATTTTGAAGGTCTG  bor-4.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNNNNNNNCATTGAGANCATTTTGAAGGTCTG  br-0.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNACAATTTGCATTGAGAACATTTTGAAGGTCTG  bur-0.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNANAATTTGCATTGAGAACATTTTGAAGGTCTG  c24.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNAANTTGCATTGAGAACATTTTGAAGGTCTG  col-0.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNAATTTGCATTGAGAACATTTTGAAGGTCTG  cvi-0.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCANNNNNNNNNNNNNNNNRNNNNNNNNNCATTNAGAACATTTTGAAGGTCTG  est-1.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNAATTTGCATTGAGAACATTTTGAAGGTCTG  fei-0.fa
7075  TNNNNGACAAACTTGCATTGTGAGATTCCANNNNNNNNNNNNNNNNRNNNNNNTNNNNNNNAGAACATTTTGAAGNNNNN  got-7.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNAANTTGCATTGAGAACATTTTGAAGGTCTG  ler-1.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNAATTTGCANTGAGAACATTTTGAAGGTCTG  lov-5.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNAATTTGCATTGAGAACATTTTGAAGGTCTG  nfa-8.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNGAACATTTTGAANNNNNG  rrs-10.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNAATTTGCATTGAGAACATTTTGAAGGTCTG  rrs-7.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNNNNNNNNATTGAGAACATTTTGAAGGTCTG  sha.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAAAANNNNNNNNNNNNNRNNNNNNNNNNATTGAGAACATTTTGAAGGTCTG  tamm-2.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNNNNTNGCATTGAGAACATTTTGAAGGTCTG  ts-1.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNGAACATTTTGAAGGTCTG  tsu-1.fa
7075  TTAAAGACAAACTTGCATTGTGAGATTCCAANNNNNNNNNNNNNNNRNNNNANTTGCATTGAGAACATTTTGAAGGTCTG  van-0.fa
 
7155  ACCTTTAAGAGCCATGGAGTTTGATGTTAAGAGAAGTATATCGACAAAAAAAATCACTGACATTGGGAATTCCCATACCT  chr1.fa
7155  ACCTTTAAGAGCCATGGAGTTTGANGRNAAGAGAAGTATATCGACAAAAAAAATCACTGACATTGGGAATTCCCATACCT  bay-0.fa
7155  ACCTTTAAGAGCCATGGAGTTTGNNNRNNNNNNNNNNNNNNNNNNAAAAAAAATCACTGACATTGGGAATTCCCATACNN  bor-4.fa
7155  ACCTTTAAGAGCCATGGAGTTTGANNRNNNNNNNNNNNNNNNNNNNAAAAAAANNNNNGACATTGGGAATTCCCATACNN  br-0.fa
7155  ACCTTTAAGAGCCATGGAGTTTGATGRTAAGAGAAGTATATCGACAAAAAAAATCACTGACATTGGGAATTCCCATACCT  bur-0.fa
7155  ACCTTTAAGAGCCATGGAGTTTGNNGRNNNGAGAAGTATATCGACAAAAAAAATCACTGACATTGGGAATTCCCATACCT  c24.fa
7155  ACCTTTAAGAGCCATGGAGTTTGANGRNNNGNNNNNNNNNNNNNNNNAAAAAATCACTGACATTGGGAATTCCCATACNN  col-0.fa
7155  ACCTTTAAGAGCCATGGAGTTTGATGRNNNGAGAAGTATATCGACAAAAAAAATCACTGACATTGGGAATTCCCATACCT  cvi-0.fa
7155  ACCTTTAAGAGCCATGGAGTTTGNNNRNNNNNNNNNNNNNNNNNNNAAAAAANNNNNTGACATTGGGAATTCCCATACNN  est-1.fa
7155  ACCTTTAAGAGCCATGGAGTTTGNNGRNANGAGAAGTATATCGACAAAAAAAATCACTGACATTGGGAATTCCCATACCT  fei-0.fa
7155  NCCTTTAAGAGCCATGGAGTTTGNNNRNNNNNNNNNNNNNNNNNNNAAAAAANNNNNNNNNATTGGGAATTCCNANNNNN  got-7.fa
7155  ACCTTTAAGAGCCATGGAGTTTGNNGRNNNNNNNAGTNNNNNGACAAAAAAAATCACTGACATTGGGAATTCCCATACNN  ler-1.fa
7155  ACCTTTAAGAGCCATGGAGTTTGNTGRNNNNNNNAGTNNNNNNNNAAAAAAAATCACTGACATTGGGAATTCCCATACCT  lov-5.fa
7155  ACCTTTAAGAGCCATGGAGTTTGNTGRNNNGNGAAGTANNNNNACAAAAAAAATCACTGACATTGGGAATTCCCATACCT  nfa-8.fa
7155  ACCTTTAAGAGCCATGGAGTTTGNNNRNNNNNNNNNNNNNNNNNNNAAAAAAANNNNNGACATTGGGAATTCCCATANNN  rrs-10.fa
7155  ACCTTTAAGAGCCATGGAGTTTGNTGRNNNNNNANNNNNNNNNNCAAAAAAAATCACTGACATTGGGAATTCCCATACNN  rrs-7.fa
7155  ACCTTTAAGAGCCATGGAGTTTGANGRNNNGAGAAGTANNNNNNNNNNNNNNNNNNNNNNNATTGGGAATTCCCATACCT  sha.fa
7155  ACCTTTAAGAGCCATGGAGTTTGNNGRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTGGGAATTCCCATACCT  tamm-2.fa
7155  ACCTTTAAGAGCCATGGAGTTTGNNGRNNNNNNNNNNNNNNNNNNAAAAAAAATCACTGACATTGGGAATTCCCATACCT  ts-1.fa
7155  ACCTTTAAGAGCCATGGAGTTTGNNNRNNNNNNNNNNNNNNNNNNNNAAANAANNNNNNNNNNTGGGAATTNCCATNNNN  tsu-1.fa
7155  ACCTTTAAGAGCCATGGAGTTTGANNRNNNNNNNNNNNNNNNNNNAAAAAAAATCACTGACATTGGGAATTCCCATANNN  van-0.fa
 
7235  GTAATAACAAAGATTCTCTATTTTTGAGCAAAGAGACATAACACCATGTTTAATCAATACAAGAAACTTTAGTGCATGAT  chr1.fa
7235  GTAATAACAAAGATTCTCTATTTTTGAGCAAAGAGACATAACACCATGTTTAATCAATACAAGAAACTTTAGTGCATGAT  bay-0.fa
7235  NNNNNNNNNNNNNNNNNNNATTTTTGAGCAAAGAGACATAACACCATGTTTANNNNNNNNNNNNNACTTTAGTGCATGAT  bor-4.fa
7235  NNNATAANNNNNNNNNNNTATTTTTGAGCAAAGAGACATAACACCATGTTTAATNNNNNNNNGAAACTTTAGTGCATGAT  br-0.fa
7235  GTAATAACAAAGATTCTCTATTTTTGAGCAAAGAGACATAACACCATGTTTAATCAATACAAGAAACTTTAGTGCATGAT  bur-0.fa
7235  GTAATAACAAAGATTCTCTATTTTTGAGCAAAGAGACATAACACCATGTTTAATCAATACAAGAAACTTTAGTGCATGAT  c24.fa
7235  NNNNTAACNNNNNNNNNNTATTTTTGAGCAAAGAGACATAACACCATGTTTAATNNNNNNNNNAAACTTTAGTGCATGAT  col-0.fa
7235  GTAATAACNNNNNNNNTCTATTTTTGAGCAAAGAGACATAACACCATGTTTAATCNNNNNNNGAAACTTTAGTGCATGAT  cvi-0.fa
7235  NNNNNNNNNNNNNNNNTCTATTTTTGAGCAAAGAGACATAACACCATGTTTAANNNNNNNNNGAAACTTTAGTGCANGAT  est-1.fa
7235  GTAATAACAANNNNNNTCTATTTTTGAGCAAAGAGACATAACACCATGTTTAATCAATACAAGAAACTTTAGTGCATGAT  fei-0.fa
7235  NNNNNNNNNNNNNNNNNNNNNNTTTGAGCAAAGAGACANAANANNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNT  got-7.fa
7235  NNNNNNNNNNNNNNNNNNTATTTTTGAGCAAAGAGACATAACACCATGTTTAANNNNNNNNNNAAACTTTAGTGCATGAT  ler-1.fa
7235  GNNNNNNNNNNNNNNNNNTATTTTTGAGCAAAGAGACATAACACCATGTTTNNNNNNNNNNNNNAACTTTAGTGCATGAT  lov-5.fa
7235  GTAATAACNNNNNNNNNCTATTTTTGAGCAAAGAGACATAACACCATGTTTAATCNNNNNNNGAAACTTTAGTGCATGAT  nfa-8.fa
7235  NNNNNNNNNNNNNNNNNNNNNTTTTGAGCAAAGAGACATANNNNNATGNNTANNNNNNNNNNNNNNCTTTAGTGCNTGAT  rrs-10.fa
7235  NNNNNNNNANNNNNNNNCTATTTTTGAGCAAAGAGACATAACACCATGTTTAATCANNNNNAGAAACTTTAGTGCATGAT  rrs-7.fa
7235  GTAATAACAAANATTCTCTATTTTTGAGCAAAGAGACATAACACCATGTTTAATCNNNNNNAGAAACTTTAGTGCATGAT  sha.fa
7235  GTAATAACNNNNNNNNTCTATTTTTGAGCAAAGAGACATAACACCATGTTTAATCNNNNNNNNAAACTTTAGTGCATGAT  tamm-2.fa
7235  GTNNTANNNNNNNNNNNNTATTTTTGAGCAAAGAGACATAACACCATGTTTAATNNNNNNNNNAAACTTTAGTGCATGAT  ts-1.fa
7235  NNNNNNNNNNNNNNNNNNNNNNNNTGAGCAAAGAGACATAACACCANNNNNNNNNNNNNNNNNNNACTTTAGTGCATGAT  tsu-1.fa
7235  NNNATAANNNNNNNNNNNNATNTTTGAGCAAAGAGACATAACACCATGTTTAATNNNNNNNNNNNNCTTTAGTGCNTGAT  van-0.fa
 
7315  TTATGGAATGCTTAAGAAGTTTGGAACTTCAATATTAGGAATTAAGTGAGAGGTAAAGCTACAACATACCAACATCGCAA  chr1.fa
7315  TTATGGAATGCTTAAGAAGTTTGGAACTTCAATATTAGGAATTAAGTGAGAGGTAAAGCTACAACANACCAACATCGCAA  bay-0.fa
7315  TTATGNNNNNNTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTACAACATACCAACATCGCAA  bor-4.fa
7315  TTATGGAATGCTTAAGAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAGGTAAAGCTACAACATACCAACATCGCAA  br-0.fa
7315  TTATGGAATGCTTAAGAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGCTACAACATACCAACATCGCAA  bur-0.fa
7315  TTATGGAATGCTTAAGAAGTTTGGAACTTCAATATTAGGAATTAAGTGAGAGGTAAAGCTACAACATACCAACATCGCAA  c24.fa
7315  TTATGGAATGCTTAAGAAGTTTNNNNNNNNNNNNNNNNNNNTTAAGTGAGAGGTAAAGCTACAACATACCAACATCGCAA  col-0.fa
7315  TTATGGAATGCTTAAGAAGTTTGGAACTTCANNNNNNNNNNNNNNNNNNNNNNNAAAGCTACAACATACCAACATCGCAA  cvi-0.fa
7315  TTATGNNNNNNTTAAGAAGTNNNNNNNNNNNNNNNNNNNNNNNAAGTGAGAGGTAAAGCTACAACATACCAACATCGCAA  est-1.fa
7315  TTATGGAATGCTTAAGAAGTTTGGAACTTCAATATTAGGAATTAAGTGAGAGGTAAAGCTACAACATACCAACATCGCAA  fei-0.fa
7315  TTATGGANTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTACAACATACCAACATCGCAA  got-7.fa
7315  TTATGGANTGCTTAAGNNNNNNNNNNNNNNNNNNNNNNNNNTTAAGTGAGAGGTAAAGCTACAACANACCAACATCGCAA  ler-1.fa
7315  TTATGGAATGCTTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTACAACATACCAACATCGCAA  lov-5.fa
7315  TTATGGAATGCTTAAGAAGTTTNNNNNNNNANTATTAGGAATTAAGTGAGAGGTAAAGCTACAACATACCAACATCGCAA  nfa-8.fa
7315  TTATGGANNNNNTAAGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGAGGTAAAGCTACAACATACCAACATCGCAA  rrs-10.fa
7315  TTATGGAATGCTTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTACAACATACCAACATCGCAA  rrs-7.fa
7315  TTATGGAATGCTTAAGAAGTNNNNNNCTTCAATATTAGGAATTAAGTGAGAGGTAAAGCTACAACATACCAACATCGCAA  sha.fa
7315  TTATGNNNNNNTTAAGAAGTNNNNNNNNNNNNNNNNNNGAATTAAGTGAGAGGTAAAGCTACAACATACCAACATCGCAA  tamm-2.fa
7315  TTATGGAATGCTTAAGAAGNNNNNNNNNNNNNNNNNNNGAATTAAGTGAGAGGTAAAGCTACAACATACCAACATCGCAA  ts-1.fa
7315  TTATGNNNNNNNNNAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAGGTAAAGCTACAACATACCAACATCGCAA  tsu-1.fa
7315  TTATGGAANGCTTAAGAAGTTTGGANNNNNNNNNNNNNNNNNNANGTGAGAGGTAAAGCTACAACATACCAACATCGCAA  van-0.fa
 
7395  GCAGAAATATCTTGAAGTAACTAGAGATGAATATCCCCAACATAATCTCTCTTCTTCTGCAAAGTTTTTAAAAAAAATTA  chr1.fa
7395  GCAGAAATATCTTGAAGTAACTAGAGATGAATATCCCCAACATAATCTNTCTTCTTCTGCAAAGTTTTTAAANNNRNNNN  bay-0.fa
7395  GCAGAAATANNNNNNNNNNNNNNNNNNTGAATATCCCCANNNNNNNNNNTCTTCTTCNNNNNNNNNNNNNNNNNNRNNNN  bor-4.fa
7395  GCAGAAATATCTTGAAGTAACTAGAGATGAATATCCCCAANNNNNNNNNNNTTCTTCTGNNNNNNNNNNNNNNNNRNNNN  br-0.fa
7395  GCAGAAATATCTTGAAGTAACTAGAGATGAATATCCCCAACATAATCTCTCTTCTTCTGCAAAGTTTTTAANNNNRNNNN  bur-0.fa
7395  GCAGAAATATCTTGAAGTAACTAGAGATGAATATCCCCAACATAATCTCTCTTCTTCTGCAAAGTTTTTAAANNNRNNNN  c24.fa
7395  GCAGAAATATCTTGAAGNNNNNNNAGATGAATATCCCCAACANAANNNNNNNNCTTCTGNNNNNNNNNNNNNNNNRNNNN  col-0.fa
7395  GCAGAAATATCTTGAAGTAACTAGAGATGAATATCCCCAACATAATCTCNCTTCTTCTGCAAAGNTTNNNNNNNNRNNNN  cvi-0.fa
7395  GCAGAAATANNNNNAAGTANNNNGNGATGAATATCCCCAACATAANCNNNNNNNTTCTGNNNNNNNNNNNNNNNNRNNNN  est-1.fa
7395  GCAGAAATATCTTGAAGTAACTAGAGATGAATATCCCCAACATAATCTCTCTTCTTCTGCAAAGTTTTTANNNNNRNNNN  fei-0.fa
7395  GCAGAAATNNNNNNNNNNNNNNNNNNNNGAATATCCCCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNN  got-7.fa
7395  GCAGAAATATCTNNNNNNNNNNNNNGATGANTANNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNRNNNN  ler-1.fa
7395  GCAGAAATNNNNNNNNNNNNNNNNNNATGAATATCCCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNN  lov-5.fa
7395  GCAGAAATATCTTGAAGTAACTAGAGATGAATATCCCCAACATAATCNCTCTTCTTCTGCNNNNNNNNNNNNNNNRNNNN  nfa-8.fa
7395  GCAGAAATATNNNNNNNNAACTNGAGATGAATATCCCCAACATNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNRNNNN  rrs-10.fa
7395  GCAGAAATATNNNNNNNNNNNNNGAGATGAATATCCCCAACATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNN  rrs-7.fa
7395  GCAGAAATATCTTGAAGTAACTAGAGATGAATATCCCCAACATAATCTCTNTTCTTCTNNNNNNNNNNNNNNNNNRNNNN  sha.fa
7395  GCAGAAATATCTNNNAGTAACTAGAGATGAATATCCCCAACANNNNNNNNNNTCTTCNNNNNNNNNNNNNNNNNNRNNNN  tamm-2.fa
7395  GCAGAAATNNNNNNNNNNNNNNNNNGATGAATATCCCCAACANAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNN  ts-1.fa
7395  GCAGAAANNNNNNNNNNNNNNNNNNNATGAATATCCCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNN  tsu-1.fa
7395  GCAGAAATATCTNNNNNNNNNTAGAGATGAATATCCCCAACATAANCTCTCTTCTTCTGNNNNNNNNNNNNNNNNRNNNN  van-0.fa
 
7475  TACATAAACAATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAAAAACTCATAATAAGAACTAAGAAGAAGAAGAATC  chr1.fa
7475  NNNNNAAACAATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAAAAACTCANAATAAGAACNAAGAAGAAGNNRAATC  bay-0.fa
7475  NNNNNNNNNAATCTTCAGGTGACAGAAGTCTGAGATCNTTGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNC  bor-4.fa
7475  NNNNNNNNCAATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAAAAANNNNNNNNNNNNNNNNNNNAGAANNNRNNNC  br-0.fa
7475  NNNNNANACAATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAAAAACTCATAATAAGNNNNNNNNNNNNNNNRNATC  bur-0.fa
7475  NNNNNAAACAATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAAAAACTCATAANNNNNNNNNNNNAGAANNNRNANC  c24.fa
7475  NNNNNNNNNNATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAAAAANNNNNNNNNNNNNNNNNNAAGAANNNRNNNC  col-0.fa
7475  NNNNNNNACAATCTTCAGGTGACAGAAGNCTGAGATCTTTGATGAAAAANTCATANNNNNNNNNNNNNAGAANNNRNNNC  cvi-0.fa
7475  NNNNNNNNCAATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAANNNNNNNNNNNNNNNNNNNNNAAGAANNNRNNNN  est-1.fa
7475  NNNNNAAACAATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAAAAACTCATAATANNNNNNNNNNAGAANNNRNNNC  fei-0.fa
7475  NNNNNNNNNNNTCTTCAGGTGACAGAAGTCTGAGANCTTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNGAANNNRNNNN  got-7.fa
7475  NNNNNNNNNNNTCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNRNNNN  ler-1.fa
7475  NNNNNNNNNNNTCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNN  lov-5.fa
7475  NNNNNNNNCAATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAAAAANNNNNNNNNNNNNNNNNNNAGNANNNRNNNC  nfa-8.fa
7475  NNNNNNNNNAATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAAAAANNNNNNNNNNNNNNNNNNNAGAANNNRNNNC  rrs-10.fa
7475  NNNNNNNNNNATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAANNNNNNNNNNNNNNNNNNNNNNANAANNNRNNNC  rrs-7.fa
7475  NNNNNNNNCAATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAAAAACTCATAANNNNNNNNNNNAAGAANNNRNNNC  sha.fa
7475  NNNNNNNNNAATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGANNNNNNNNNNNNNNNNNNNNNNNNNAANNNRNNNC  tamm-2.fa
7475  NNNNNNNNCAATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNN  ts-1.fa
7475  NNNNNNNNNNNNCTTCAGGTGACAGAAGTCTGAGATCNTTGATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNN  tsu-1.fa
7475  NNNNNNNNNNATCTTCAGGTGACAGAAGTCTGAGATCTTTGATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNN  van-0.fa
 
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  chr1.fa
7555  AGTAATCACCTGGAAACTTCATTTNGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  bay-0.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  bor-4.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  br-0.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  bur-0.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  c24.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  col-0.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  cvi-0.fa
7555  NNNAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  est-1.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  fei-0.fa
7555  NNNNNNCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGANGATAAATGCAGCGTTTGCAGATAA  got-7.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  ler-1.fa
7555  NNNAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  lov-5.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATNATAAATGCAGCGTTTGCAGATAA  nfa-8.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  rrs-10.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  rrs-7.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGTNNNNNNNNTGATAAATGCAGCGTTTGCAGATAA  sha.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAANNNTNNNNNNNNNNNTAAATGCAGCGTTTGCAGATAA  tamm-2.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  ts-1.fa
7555  NNNAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  tsu-1.fa
7555  AGTAATCACCTGGAAACTTCATTTAGCAAACCCTTAGTCGCAATGGCAAAAGAGATGATAAATGCAGCGTTTGCAGATAA  van-0.fa
 
7635  GACACCAATCAGAACCTGTTTCAAATGCGAAATTATTACCCTTTCTAAACAATCTCAATGACTTAAATCATTTAAACCTT  chr1.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTATTACCCTTTCTAAACAATCTCAATGACTTAAATCATTTAAACCTN  bay-0.fa
7635  GACACCAATCNGAACCTGNTTCAAATGCGNAATTATTACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
7635  GACACCAATCNGAACCTGTNTCAAATGCGAAATTATTNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTATTACCCTTTCTAAACAATCTCAATGACTTAAATCATTTNNNNNNN  bur-0.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTATTACCCTTTCTAAACAATCTCAATGANNNNNNNNNNNNNNNNNNN  c24.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTATTANNNNNNNNNAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTATTACCCTNTCTAAACAANCTCAATGNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTATTACCCTTTCTAAACAATCTCAATGANNNNNNNNNNNNNNNNNNN  fei-0.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTATNNNNNNNNNNAANCANTCNCNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTATTNNNNNNNNTAAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTATTNNNNNNTCTAAACAATCTCAATGNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
7635  GACACCANNNNNAACCTGTTTCAAATGCGAAATTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTATTNNNNNNNCTAAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTATTACCCTTTCTAAACAATCTCAATGNNNNNNNNNNNNNNNNNNNN  sha.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTATTANNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
7635  GACACCAATCAGAACCTGTTTCAAATGCGAAATTATTANNNNNNNNNAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
7635  GACACCAATCNGAACCTGTNTCAAATGCGAAATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
7635  GACACCAATCNGAACCTGTTTCAAATGCGAAATTATTANNNNNNNNNNACANNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
7715  AAAGGAAAAAAAATCTAATTAAGTCCATTAAAAAGAAACGATCTAACCTTTATAGATAGAAGAACAGGGCTATCAGAAAA  chr1.fa
7715  ANNGNAAAAAAAATCNAATTAAGTCCATTAAAAAGAAACGATCTAACCTTTATAGATAGAAGAACAGGGCTATCAGAAAA  bay-0.fa
7715  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNAGAAGAACAGGGCTATCAGAAAA  bor-4.fa
7715  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGAAACGATCNNNNNNNNNNNNNNAGAAGAACAGGGCTATCAGAAAA  br-0.fa
7715  NNNNNAAAAAAAANCTNNNNNNNNNNNTTAAAAAGAAACGATCTAACCTTTATAGATAGAAGAACAGGGCTATCAGAAAA  bur-0.fa
7715  NNNNNNNAAAAAANCNNNNNNNNNNNNNNAAAAAGAAACGATCTAACCTTTATAGATAGAAGAACAGGGCTATCAGAAAA  c24.fa
7715  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAANANNNNNNNNNNNNNNNNNNNNNNGAAGAACAGGGCTATCAGAAAA  col-0.fa
7715  NNNNNNNNNANNNNNNNNNNNNNNNNNNNAAAAAGAAACGATCTAACCNNNNNNNNTAGAAGAACAGGGCTATCAGAAAA  cvi-0.fa
7715  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGAACAGGGCTATCAGAAAA  est-1.fa
7715  NNNNNNNAAAAAANNNNNNNNNNNNNATTAAAAAGAAACGATCTAACCTTTNTAGATAGAAGAACAGGGCTATCAGAAAA  fei-0.fa
7715  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACAGGGCTATCAGAAAA  got-7.fa
7715  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANAAACGATCTNNNNNNNNNNNNNAGAAGAACAGGGCTATCAGAAAA  ler-1.fa
7715  NNNNNNNAAANNNNNNNNNNNNNNNNNNNNNNNANAAACGANNNNNNNNNNNNNNNNNNAAGAACAGGGCTATCAGAAAA  lov-5.fa
7715  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAGAAACGATCTAACCNNNNNNGATAGAAGAACAGGGCTATCAGAAAA  nfa-8.fa
7715  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAACAGGGCTATCAGAAAA  rrs-10.fa
7715  NNNNNNNNNANNNNNNNNNNNNNNNNNNNNNAAAGAAACNNNNNAANNNNNNNNNNNAGAAGAACAGGGCTATCAGAAAA  rrs-7.fa
7715  NNNNNNNNNAAANNNNNNNNNNNNNNNTTAAAAAGAAACGATCTAACCTNNNNNGATAGAAGAACAGGGCTATCAGAAAA  sha.fa
7715  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGAAACGATCTAACNNNNNNNNATAGAAGAACAGGGCTATCAGAAAA  tamm-2.fa
7715  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAANAAACGATCNNNNNNNNNNNNNNAGAAGAACAGGGCTATCAGAAAA  ts-1.fa
7715  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACAGGGCTATCAGAAAA  tsu-1.fa
7715  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANAAACGNNNNNNNNNNNNNNNNNNGAAGAACAGGGCTATCAGAAAA  van-0.fa
 
7795  GCTCGATTCTTCATCACTTTTTCTCAGTAGCAAGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  chr1.fa
7795  GCTCGATTCNTCATCACTTTTTCTCAGTARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  bay-0.fa
7795  GCTCGATTCTTCATCACNTTTTCTCAGTARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  bor-4.fa
7795  GCTCGATTCNTCATCACTTTTTCTCAGNARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  br-0.fa
7795  GCTCGATTCNTCATCACTTTTTCTCAGTARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  bur-0.fa
7795  GCTCGATTCNTCATCACTTTTTCTCAGTARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  c24.fa
7795  GCTCGATTCNTCATCACTTTTTCTCAGNARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  col-0.fa
7795  GCTCGATTCNTCATCACTTTTTCTCAGTARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  cvi-0.fa
7795  GCTCGATTCTTCATCACTTTTTCTCAGTARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  est-1.fa
7795  GCTCGATTCTTCATCACTTTTTCTCAGTARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  fei-0.fa
7795  GCTCGATTCTTCANNNNNNNTTCTCANTARRRRGCTTCTATCNNNNNNNNNTTCAGGGCTTTTCAAATAAGTTTGCCGAT  got-7.fa
7795  GCTCGATTCTTCATCACTTTTTCTCAGTARRRRGNNTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  ler-1.fa
7795  GCTCGATTCTTCATCACTTTTTCTCAGTARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  lov-5.fa
7795  GCTCGATTCNTCATCACTTTTTCTCAGTARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  nfa-8.fa
7795  GCTCGATTCTNNNNNNNNNNTTCTCAGNARRRRGCNTCTANNNNTGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  rrs-10.fa
7795  GCTCGATTCTTCATCACTTTTTCTCAGTARRRRGCNTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  rrs-7.fa
7795  GCTCGATTCTTCATCACTTTTTCTCAGTARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  sha.fa
7795  GCTCGATTCTNCATCACTTTTTCTCAGTARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  tamm-2.fa
7795  GCTCGATTCTTCATCACTTTTTCTCAGTARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  ts-1.fa
7795  GCTCGATTCTTCATCNCTTTTTCTCAGNNRRRRGCNTCTATCTANGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  tsu-1.fa
7795  GCTCGATTCTTCATCACTTTTTCTCAGTARRRRGCTTCTATCTATGATGAGTTCAGGGCTTTTCAAATAAGTTTGCCGAT  van-0.fa
 
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGATAGTAAAAGATTATAAAACAAAAGGATACAACAGTCTAGAAG  chr1.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGATAGTAAAAGATTANAAAACAAAAGGATACAACAGTCTAGAAG  bay-0.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAANNNNNNNGAAG  bor-4.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGNNNNNNNNNNNNNNNNNNNNANNANNNNACAACAGTCNAGAAG  br-0.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGATAGTNNNNNNNNNNNNAACAAAAGGATACAACAGTCTAGAAG  bur-0.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGATAGTANNNNNNNNNNNNANAAAAGGATACAACAGTCTAGAAG  c24.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGANNNNNNNNNNNNNNNNNANANNANGATACAACAGTCTAGAAG  col-0.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGATANNNNNNNNNNNNNNNNNAAAAGGATACAACAGTCTAGAAG  cvi-0.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNANANNCNAGAAG  est-1.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGATAGTANNNNNNNNNNNNANAAAAGGATACAACAGTCTAGAAG  fei-0.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANANNCNAGAAG  got-7.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGANNNNNNNNNNNNNNNNNNNNNNAGGATACAACAGTCTAGAAG  ler-1.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGATNNNNNNNNNNNNNNNNNNNNNAGGATACAACAGTCTAGAAG  lov-5.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGATANNNNNNNNNNNNNNNNNAAAAGGATACAACAGTCTAGAAG  nfa-8.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTNNNNNNNNNNNNNNNNNNNNNNNNNNGATACAACANNNNNGAAG  rrs-10.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGATNNNNNNNNNNNNNNNNANAAAAGGATACAACAGTCTAGAAG  rrs-7.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGATNNNNNNNNNNNNNNNNANAAAAGGATACAACAGTCTAGAAG  sha.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGATANNNNNNNNNNNNNNNNNNNAAGGATACAACAGTCTAGAAG  tamm-2.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTGANNNNNNNNNNNNNNNNNNNAAAAGGANACAACAGTCTAGAAG  ts-1.fa
7875  GAATCTCACCAACTACACATCTGCTAGCTACACTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAACNNNNNNNNAG  tsu-1.fa
7875  GAATCTCNCCAACTACACATCTGCTAGCTACACTTTGANNNNNNNNNNNNNNNNNNNNNNAGGATACAACAGTCTAGAAG  van-0.fa
 
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGCTGCACACACACACACAAAAAAAAAAAAAGAACCCAACAATTCTTAT  chr1.fa
7955  AAGATNGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNANNNRNNNNNNNCAATTCTTAT  bay-0.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGCTNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNNNNNNCTTAT  bor-4.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNNNNNNCTTAT  br-0.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGCNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNCCAACAATTCTTAT  bur-0.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNCAATTCTTAT  c24.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNNNNNNNTTAT  col-0.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNACAATTCTTAT  cvi-0.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNNNNTTCTTAT  est-1.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNNAATTCTTAT  fei-0.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNNNNNNNNNNN  got-7.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNNNNNNNNTAT  ler-1.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNNNNNNNNTAT  lov-5.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNNNANTCTTAT  nfa-8.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNNNNNNNNTAT  rrs-10.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNCAATTCTTAT  rrs-7.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNACAATTCTTAT  sha.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNNNNTTCTTAT  tamm-2.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNNNNNTCTTAT  ts-1.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNNNNNNNNNNN  tsu-1.fa
7955  AAGATAGGCGAAGACCAACTTCCACAACAGATGNNNRNNNNNNNRRRRRRRRRRRNNNNNNNRNNNNNNNNNNTTCTTAT  van-0.fa
 
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGAAATTAGTTTGTTGCTTGAGGTCTAAGATACTTCTATATATGGAAA  chr1.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGAAATTNGTTTGTTGCTTGAGGTCTAAGATACTTCTATATATGGARA  bay-0.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGNANNTNGTTTGTTGCTTGAGGTCTAAGNNNNNNNNNNNNNNNNNRN  bor-4.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGNANNNNNNNTTGTTGCTTGAGGTCTAAGANNNNNNNNNNNNNNNNRN  br-0.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGAAATTAGTTTGTTGCTTGAGGTCTAAGATACNNNNNNATATNNNRN  bur-0.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGAAATTAGTTTGTTGCTTGAGGTCTAAGATACNNNNNNNNNNNNNRN  c24.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGAAATTNGTTTGTTGCTTGAGGTCTAAGATANNNNNNNNNNNNNNRN  col-0.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGAAATTNGTTTGTTGCTTGAGGTCTAAGATANNNNNNNNNNNNNNRN  cvi-0.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGNNNNNNNTTTGTTGCTTGAGGTCTAAGNNNNNNNNNNNNNNNNNRN  est-1.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGAAATTAGTTTGTTGCTTGAGGTCTAAGATACNNNNNNNNNNNNNRN  fei-0.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACNNNNNNNNNNNNNTGTTGCTTGAGGTCTAAGNNNNNNNNNNNNNNNNNRN  got-7.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGAAATTNGTTTGTTGCTTGAGGTCTAAGANNNNNNNNNNNNNNNNRN  ler-1.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTNNNNNNNAGTTTGTTGCTTGAGGTCTAAGNNNNNNNNNNNNNNNNNRN  lov-5.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGAAATTAGTTTGTTGCTTGAGGTCTAAGATANNNNNNNNNNNNNNRN  nfa-8.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAANNNNNNNNNNNNNTTGTTGCTTGAGGTCTAAGATANNNNNNNNNNNNNNRN  rrs-10.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGAAATTNGTTTGTTGCTTGAGGTCTAAGATNNNNNNNNNNNNNNNRN  rrs-7.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGAAATTAGTTTGTTGCTTGAGGTCTAAGATNNNNNNNNNNNNNNNRN  sha.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGAAATTNGTTTGTTGCTTGAGGTCTAAGATNNNNNNNNNNNNNNNRN  tamm-2.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGNNNNNNNNNTTGTTGCTTGAGGTCTAAGATNNNNNNNNNNNNNNNRN  ts-1.fa
8035  NNGATCAGAGACTACTCAATATCCCCAAACTNNNNNNNNNNNNTGTTGCTTGAGGTCTANNNNNNNNNNNNNNNNNNNRN  tsu-1.fa
8035  TGGATCAGAGACTACTCAATATCCCCAAACTTGGAAATTAGTTTGTTGCTTGAGGTCTAAGANNNNNNNNNNNNNNNNRN  van-0.fa
 
8115  AAGATTTTCAAAGCCAGATATTTCCACAAGTTTGTAATATCAATTCAAGATAAGAGAGCTAGAATCAGACAGGAACTAGC  chr1.fa
8115  AAGATTTTCAAAGCCAGANATTTCCACAAGTTTGTAATATCAATTCAAGATAAGAGAGCTAGAATCAGACAGGAACTAGC  bay-0.fa
8115  NNNATTTTCAAAGCCAGANATTTCCACAAGTTTGTNNNNNNNNNNNAAGATAAGAGAGCTAGAATCAGACAGGAACTAGC  bor-4.fa
8115  NNGATTTTCAAAGCCAGANATTTCCACAANTTTGTANNNNNNNNNNNAGATAAGAGAGCTAGAATCAGACAGGAACTAGC  br-0.fa
8115  AAGATTTTCAAAGCCAGANATTTCCACAAGTTTGTAATATCAATTCAAGATAAGAGAGCTAGAATCAGACAGGAANNNAN  bur-0.fa
8115  NAGATTTTCAAAGCCAGANATTTCCACAAGTTTGTAATATCAATTCAAGATAAGAGAGCTAGAATCAGACAGGAACTAGC  c24.fa
8115  NNGATTTTCAAAGCCAGATATTTCCACAAGTTTGTNNNNNNNNNNNNAGATAAGNGAGCTAGAATCAGACAGGAACTAGC  col-0.fa
8115  NNGATTTTCAAAGCCAGANATTTCCACAAGTTTGTAATATNNNTTCAAGATAAGAGAGCTAGAATCAGACAGGANNANNN  cvi-0.fa
8115  NNGATTTTCAAAGCCAGANATTTCCACAAGNTNNNNNNNNNNNNNNNNGATAAGAGAGCTAGAATCAGACAGGAACTAGC  est-1.fa
8115  NNGATTTTCAAAGCCAGANATTTCCACAAGTTTGTAATATCAATTCAAGATAAGAGAGCTAGAATCAGACAGGAACTAGC  fei-0.fa
8115  NNNNTTTTCAANGCCAGANATTTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGCTAGAATCAGNNNNNNNNNNAN  got-7.fa
8115  NNNATTTTCAAAGCCAGANATTTCCACAAGTTTGTAATNNNNNNNNNAGATAAGAGAGCTAGAATCAGACAGGAACTAGC  ler-1.fa
8115  NNNATTTTCAAAGCCAGANATTTCCACAANTTTGTNNNNNNNNNNNNAGATAAGAGAGCTAGAATCAGNNNNNNNNNNAN  lov-5.fa
8115  NNGATTTTCAAAGCCAGANATTTCCACAAGTTTGTAATATNNNNNNAAGATAAGAGAGCTAGAATCAGACAGGAACTAGC  nfa-8.fa
8115  NNNNNTTNNNNNGCCAGANATTTCNNNNNGTTTGTAANNNNNNNNNNNNNNNNNAGAGCTAGAATCAGACAGGAACTAGC  rrs-10.fa
8115  NNNNTTTTCAAAGCCAGANATTTCCACAAGTTTGTAANNNNNNNNNNNGATAAGAGAGCTAGAATCAGACAGGAACTAGC  rrs-7.fa
8115  NNGATTTTCAAAGCCAGANATTTCCACAAGTTTGTAATATCANTTCAAGATAAGAGAGCTAGAATCAGACAGGAACTAGC  sha.fa
8115  NNGATTTTCAAAGCCAGANATTTCCACAAGTTTGTAATNNNNNNNNNAGATAAGAGAGCTAGAATCAGACAGGAACTAGC  tamm-2.fa
8115  NNGATTTTCAAAGCCAGANATTTCCACAAGTTTGNNNNNNNNNNNNAAGATAAGAGAGCTAGAATCAGACAGGAACTAGC  ts-1.fa
8115  NNNNTTTTCAAAGCCAGANATTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACAGGAACTAGC  tsu-1.fa
8115  NNNATTTTCAAAGCCAGANATTTCCACAAGTTTGTAANNNNNNNNNNAGATAAGAGAGCTAGAATCAGACAGGAACTAGC  van-0.fa
 
8195  AATGCTTGAAATCAAGAACTTGAATTGAAATAGTTTTTTACCTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  chr1.fa
8195  AATGCTTGAAATCAAGAACTNGAATTGAAATAGTTTTTTACCTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  bay-0.fa
8195  AATGCTTGAAATCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  bor-4.fa
8195  AATGCTTGAAATCAANNNNNNNNNNNNNNNNNNNNNNNNNCCTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  br-0.fa
8195  NATGCTTGAAATCAAGAACTTGAATTGAAATAGTTTTTTACCTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  bur-0.fa
8195  AATGCTTGAAATCAAGAACTNGAATTGNAATAGTTTTTTACCTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  c24.fa
8195  AATGCTTGAAATCAAGANNNNNNNNNNNNNNNNNNNNNNNNCTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  col-0.fa
8195  AATGCTTGAAATCAAGAACTNNNNNNNNNNTAGTTNTTTACCTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  cvi-0.fa
8195  AATGCTTGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  est-1.fa
8195  AATGCTTGAAATCAAGAACTNGAATTGAAATAGTTTTTTACCTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  fei-0.fa
8195  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGACAGTTGCTGGATTAATTGCATTGTAGAG  got-7.fa
8195  AATGCTTGAAATCAAGAANNNNNNNNNNNNNNNNNNNNNNCCTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  ler-1.fa
8195  NNNNNNNGAAATCAANNNNNNNNNNNNNNNNNNNNNNNNNNCTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  lov-5.fa
8195  AATGCTTGAAATCAAGAACNNNNNNNNNNNNAGTTTTTTACCTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  nfa-8.fa
8195  AATGCTTGAAATCAANNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNTATTGACAGTTGCTGGATTAATTGCATTGTAGAG  rrs-10.fa
8195  AATGCTTGAAATCAAGANNNNNNNNNNNNNNNNNNNNNNNNNTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  rrs-7.fa
8195  AATGCTTGAAATCAAGAACTNNNNNNNNNATAGTTTTTTACCTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  sha.fa
8195  AATGCTTGAAATCAAGANNNNNNNNNNNNNNNNNNNNNNNNNTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  tamm-2.fa
8195  AATGCTTGAAATCAAGANNNNNNNNNNNNNNNNNNNNNNNNNTGAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  ts-1.fa
8195  AATGCTTGAAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACAGTTGCTGGATTAATTGCATTGTAGAG  tsu-1.fa
8195  AATGCTTGAAATCNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATATTGACAGTTGCTGGATTAATTGCATTGTAGAG  van-0.fa
 
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAATCGATGAAAATAATCTGCCAAAGAAAACAATTAAAGAACCAAA  chr1.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAATCGATGAAAATAATCTGCCAAANAAAACNNNNNNNNNNNCAAA  bay-0.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAANNNNNNGAAAATAATCTNCNNNNNNNNNNNNNNNNNNNNNNNAA  bor-4.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAANNNNNNNAAAATNATCNGCNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAATCGATGAAAATAATCTGCCAAANAAAACNNNNNNNNNNNNAAA  bur-0.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAATCGNTGAAAATAATCTGCCAAANAANANNNNNNNNNNNNNNNN  c24.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAATCGNTGAAAATAATCTGCCAAANNNNNNNNNNNNNNNNNCAAA  col-0.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAATCGATGAAAATAATCTGCCAAANNNNNNNNNNNNNNNNNCAAA  cvi-0.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAANNNNNNNAAATAATCNGCNNNNNNNNNNNNNNNNNNNNNNNAA  est-1.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAATCGNTGAAAATAATCTGCCNNNNNNNNNNNNNNNNNNNCNAAA  fei-0.fa
8275  GACGTGTCTATATACNTTTGGTCTGTGAAGGATNNNNNNNNNGAAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA  got-7.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAATCGATGAAAATAATCTGCCAAAGAANNNNNNNNNNNNNNCAAA  ler-1.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAATCGNTGAAAATAATCTGCCAAANANNNNNNNNNNNNNNNNAAA  lov-5.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAATCGATGAAAATAATCTGCCAAANANNNNNNNNNNNNNNNNNNN  nfa-8.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA  rrs-10.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAATCGANGAAAATAATCTGCCAANNNNNNNNNNNNNNNNNNNNNA  rrs-7.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAATCGATGAAAATAATCNGCCAAANNNNNNNNNNNNNNNNNNNAA  sha.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAANNNNNGAAAATAATCNGCCAAANNNNNNNNNNNNNNNNNNAAA  tamm-2.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAATCGNTGAAAATAATCTGCCAAANAAAANNNNNNNNNNNNNNNN  ts-1.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAA  tsu-1.fa
8275  GACGTGTCTATATACCTTTGGTCTGTGAAGGATTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA  van-0.fa
 
8355  AACCAAAATTGGAAAGAAATAGGGAAACACCCAAAAAGGGAAAGAAAGTGATTAAAACAGACCATGCGTTCACACTCGAT  chr1.fa
8355  AACCAAAARNGNAAAGAAANNNNGAAACACCCAAAARRRNAAAGAAANTNNTNAAAACAGACCATGCGTTCACACTCGAT  bay-0.fa
8355  AACCANNNRNNNNNNNNNNNAGGGAAACACCCAAAARRRNNANNNNNNNNNNNNNANCAGACCATGCGTTCACACTCGAT  bor-4.fa
8355  NNNNNNNNRNNNNNNNNNNNNNNGAAACACCCAAAARRRNNNNNNNNNNNNNTAAAACAGACCATGCGTTCACACTCGAT  br-0.fa
8355  AACCAAAARNGGAAAGAAATAGGGAAACACCCAAAARRRGAAAGAAAGTGATTAAAACAGACCATGCGTTCACACTCGAT  bur-0.fa
8355  ANNCNAAARNNNAAANNNNNNNNGAAACACCCAAAARRRGAAAGAAAGTGATTAAAACAGACCATGCGTTCACACTCGAT  c24.fa
8355  ANCCANNNRNNNNNNNNNNNNNNGAAACACCCAAAARRRNNNNNNNNNNNNNNNNAACAGACCATGCGTTCACACTCGAT  col-0.fa
8355  AACCAAANRNNNAAAGNNNNNNNGAAACACCCAAAARRRGNANNNNNNNNNNNAAAACAGACCATGCGTTCACACTCGAT  cvi-0.fa
8355  AACCANNNRNNNNNNNNNNNNNNGAAACACCCAAAARRRNNNNNNNNNNNNNNNNAACAGACCATGCGTTCACACTCGAT  est-1.fa
8355  AACCANAARNGNNAANNNNNNNNGAAACACCCAAAARRRNAAAGNAAGTGATTAAAACAGACCATGCGTTCACACTCGAT  fei-0.fa
8355  AACCANNNRNNNNNNNNNNNNNNNAANNNNNNNNAARRRNNNNNNNNNNNNNNNNNNCAGACCATGCGTTCACACTCGAT  got-7.fa
8355  AACCANANRNNNNAANANNNNNNNNAACACCCANANRRRGANNNNNNNNNNNNNAAACAGACCATGCGTTCACACTCGAT  ler-1.fa
8355  AACCAAAARNNNNNNNNNNNNNNGAAACACCCAANARRRNNNNNNNNNNNNNNAAAACAGACCATGCGTTCACACTCGAT  lov-5.fa
8355  AACCANANRNNNNNNNNNNNNNNGAAACACCCAAAARRRNNNNNNNNNNNNNNAAAACAGACCATGCGTTCACACTCGAT  nfa-8.fa
8355  AACCANNNRNNNNNNNNNNNAGGGAAACACCCANNNRRRNNNNNNNNNNNNTTAAAACAGACCATGCGTTCACACTCGAT  rrs-10.fa
8355  AACCANANRNNNAAANNNNNNNNGAAACACCCAAAARRRNAAANNNNNNNNTTAAAACAGACCATGCGTTCACACTCGAT  rrs-7.fa
8355  AACCAANARNNNNNNNNNNNNNNNAAACACCCAAAARRRNNNAGANNGTNATNAAAACAGACCATGCGTTCACACTCGAT  sha.fa
8355  AACCANNNRNNNNNNNNNNNNNNNNAACACCCANANRRRNNNNNNNNNNNNNNNNAACAGACCATGCGTTCACACTCGAT  tamm-2.fa
8355  NNNNNNNNRNNNNNNNNNNNNNNNAAACNNNNNNNNRRRNNNNNNNNNNNNNNNNAACAGACCATGCGTTCACACTCGAT  ts-1.fa
8355  AACCANNNRNNNNNNNNNNNNNNNAAANNNNNNANNRRRNNNNNNNNNNNNNNNNNACAGACCATGCGTTCACACTCGAT  tsu-1.fa
8355  AACCANNNRNNNNNNNNNNNAGGGAAACACCCAAAARRRNNNNNNNNNNNNNNNNAACAGACCATGCGTTCACACTCGAT  van-0.fa
 
8435  GTACTCATCTGCTACTTCCTTGCAATTTCCCTAAATATAACAATATGATCAAAGATGGAAACTTTGAAGAAATTTAATAG  chr1.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCCCTAAATATAACAANATGATCAAANATGGAAACTTTGAAGAAATTTAATAG  bay-0.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCCCNNNNNNNNNNNNNNNNNNNNNAGATGGNNNNNNNGNNNNNNNNNNNNNN  br-0.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCCCTANNNNNNNNNNNATGATCAAAGATGGAAACTTTGAAGAANTTTAANNN  bur-0.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCCCTANNNNNNNNNNNATGATCAAAGATGGAAACTTTGAANNNNNNTNANNN  c24.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCCCTANNNNNNNNNNNNNNNNNNNANATNGANNNNNTNNANNNNNNNNNNNN  col-0.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCCCTANNNNNNNNNNNNNNNNNNAAGATGGAAACTTTGAAGNNNNNNNNNNN  cvi-0.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAANNNNNNNNNNNNNNNNNNNN  est-1.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCCCTANNNNNNNNNNNNNNATCAAAGATGGAAACTTTGAAGAANTNNNNNNN  fei-0.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCCCTNNNNNNNNNNNNNNNNNNNAAGNNNNNANNTTTGAANNNNNNNNNNNN  ler-1.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCNNNNNNNNNNNNNNNNNNNNNNNNNANNGNNACTTTGANNNNNNNNNNNNN  lov-5.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCCCNNNNNNNNNNNNNNNNNNCAAAGANGGAAACTTTGAANNNNNNNNNNNN  nfa-8.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCCCTNNNNNNNNNNNNNNNNNNNNNGATGGNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTNNNNNNNNNNNNNNNNNNNNNNNNAGATGGAAACTTTGNNNNNNNNNNNNNN  rrs-7.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCCCTANNNNNNNNNNNNNNNTCAAAGANGGAAACTTTGANNNNNNNNNNNNN  sha.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCCCTNNNNNNNNNNNNNNNNNNNNNGATNNNNNNNNTGNNNNNNNNNNNNNN  tamm-2.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGANNNNNNNNNNNNN  ts-1.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
8435  GTACTCATCTGCTACTTCCTTGCAATTTCNNNNNNNNNNNNNNNNNNNNNNNNGATGGAAACTTTGNNNNNNNNNNNNNN  van-0.fa
 
8515  AGAATCTTATAAACCCTAATTGGGTCAAAGAAGATCCATTAATACAAAAATCTTACGCATTTCATGAGACGAATGTTACC  chr1.fa
8515  AGAATCTNATAAACCCTAATTGGGTCAAAGAAGATCCATTAATACAAAAATCTTACGCRRRRRATGAGACGAATGTTACC  bay-0.fa
8515  NNNNNNNNNNNNNNNNNNATTGGGTCAAAGAAGNNNNNNNNNNNNNNAAATCTTACGCRRRRRATGAGACGAATGTTACC  bor-4.fa
8515  NNNNNNNNNNNNACCCTAATTGGGTCAAAGAAGATNNNNNNNNNNNAAAATCTTACGCRRRRRATGAGACGAATGTTACC  br-0.fa
8515  NNNNTCTTATAAACCCTAATTGGGTCAAAGAAGATCCATTAATACAAAAATCTTACGCRRRRRATGAGACGAATGTTACC  bur-0.fa
8515  NNNNTCTTATAAACCCTAATTGGGTCAAAGAAGATCCANTAATACAAAAATCTTACGCRRRRRATGAGACGAATGTTACC  c24.fa
8515  NNNNNNNNNNNAACCCTAATTGGGTCAAAGAAGNTNNNNNNNNNNNAAAATCTTACGCRRRRRATGAGACGAATGTTACC  col-0.fa
8515  NNNNNNNNNNNNACCCTAATTGGGTCAAAGAAGATNNNNNNNNACAAAAATCTTACGCRRRRRATGAGACGAATGTTACC  cvi-0.fa
8515  NNNNNNNNNNNNACNCTAATTGGGTCAAAGAANNNNNNNNNNNNNAAAAATCTTACGCRRRRRATGAGACGAATGTTACC  est-1.fa
8515  NNNNNNTTATAAACCCTAATTGGGTCAAAGAAGATCCATTAATACAAAAATCTTACGCRRRRRATGAGACGAATGTTACC  fei-0.fa
8515  NNNNNNNNNNNNNNNNNNNNTGNGTCAAAGANNNNNNNNNNNNNNNNNNNNNNTANNCRRRRRATGAGACGAATGTTACC  got-7.fa
8515  NNNNNNNNNNNNNNNNTAATTGGGTCAAAGAANNNNNNNNNNNNCAAAAATCTTACGCRRRRRATGAGACGAATGTTACC  ler-1.fa
8515  NNNNNNNNNNNNNNNNNNNTTGGGTCAAAGAANNNNNNNNNNNNNAAAAATCTTACGCRRRRRATGAGACGAATGTTACC  lov-5.fa
8515  NNNNNNNNATAAACCCTAATTGGGTCAAAGAAGATNNNNNNNTACAAAAATCTTACGCRRRRRATGAGACGAATGTTACC  nfa-8.fa
8515  NNNNNNNNNNNNNNNCTAATTGNGTCAAAGAANNNNNNNNNNNNNAAAAATCTTACGCRRRRRATGAGACGAATGTTACC  rrs-10.fa
8515  NNNNNNNNNNNNNNCCNAATTGGGTCAAAGAAGATCNNNNNNNNNNNAAATCTTACGCRRRRRATGAGACGAATGTTACC  rrs-7.fa
8515  NNNNNCTTATAAACCCTAATTGGGTCAAAGAAGATCCANTAATACAAAAATCTTACGCRRRRRATGAGACGAATGTTACC  sha.fa
8515  NNNNNNNNNNNNNCCCTAATTGGGTCAAAGAAGANNNNNNNNNNNNAAAATCTTACGCRRRRRATGAGACGAATGTTACC  tamm-2.fa
8515  NNNNNNNNNNNNACCCNAATTGGGTCAAAGAAGNNNNNNNNNNACAAAAATCTTACGCRRRRRATGAGACGAATGTTACC  ts-1.fa
8515  NNNNNNNNNNNNNNNNNNATTGGGTCAAAGAANNNNNNNNNNNNNNNNAATCTTACGCRRRRRATGAGACGAATGTTACC  tsu-1.fa
8515  NNNNNNNNNNAAACCCTAATTGGGTCAAAGAANNNNNNNNNNNNNNAAAATCTTACGCRRRRRATGAGACGAATGTTACC  van-0.fa
 
8595  CGGAGAGTATTGAATGAACAATGACTTTACCCTAAAACCACATCCCACGCATCTGTGTTCACTCGCCGCCAT   chr1.fa
8595  CGGAGAGTATTGAATGAACAATGACTTTACCCNAAAACCACATCCCACGCATCTGTNTTCACTCGCCGCCNN   bay-0.fa
8595  CGGAGAGTATTGAATGAANAATGACTTTACCCTNAAACCACATCCCACGCATCTGTGTTCACTCGCCGCCAT   bor-4.fa
8595  CGGAGAGTATTGAATGNA