Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 83045 - 84864


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCTCACACGAGAGCCTCAAAACCTCCGAGA  chr1.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCNCARRRNAGAGCCTCAAAACCTCCGAGA  bay-0.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCTCARRRGAGAGCCTCAAAACCTCCGAGA  bor-4.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCTCARRRGAGAGCCTCAAAACNNNNNNNA  br-0.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCTCARRRGNGAGCCTCAAAACCTCCGAGA  bur-0.fa
83045  NNNNNNTATCTTACGCCTTGAGCTTACGNNTNNNATGAGTGGACAAGCCATCNCARRRGAGAGCCTCAAAACCTCCGAGA  c24.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCTCARRRGAGAGCCTCAAAACCTCCGAGA  col-0.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCTCARRRGAGAGCCTCAAAACCTCCGAGA  cvi-0.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCTCARRRGAGAGCCTCAAAACCTCCGAGA  est-1.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCTCARRRGAGAGCCTCAAAACCTCCGAGA  fei-0.fa
83045  NNNNNNNNTCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCTCARRRGAGAGCCTCAAAACCTCCGNNN  got-7.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGNTAACGATGAGTGGACAAGCCATCNCARRRGAGAGCCTCAAAACCNCCGAGN  ler-1.fa
83045  NNNNNNNNNNTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCNCARRRGAGAGCCTCAAAACCTCCGNNN  lov-5.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCTCARRRGAGAGCCTCAAANNGNNNNNNN  nfa-8.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCTCARRRGAGAGCCTCAAAACCTCCGAGA  rrs-10.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCTCARRRGAGAGCCTCAAAACCTCCGAGA  rrs-7.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCNCARRRGAGAGCCTCAAAACCTCCGAGA  sha.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCNCARRRGAGAGCCTCAAAACCTCCGAGA  tamm-2.fa
83045  NNNNNNNNTCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCNNARRRGAGAGCCTCAAAACCTCCGAGA  ts-1.fa
83045  NNNNNNNNNNTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCTCARRRGAGAGCCNCAAAACCNCNNNNN  tsu-1.fa
83045  TTACATTATCTTACGCCTTGAGCTTACGTTAACGATGAGTGGACAAGCCATCTCARRRGAGAGCCTCAAANNGNNNNNNN  van-0.fa
 
83125  GATCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACACCGTTGTA  chr1.fa
83125  GATCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACACCGTTGTA  bay-0.fa
83125  GATCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACNCCGTTGTA  bor-4.fa
83125  NNNNNNNAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACACCGTTGTA  br-0.fa
83125  NATCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACACCGTTGTA  bur-0.fa
83125  GANCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACNCCGTTGTA  c24.fa
83125  GATCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACACCGTTGTA  col-0.fa
83125  GATCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACNCCGTTGTA  cvi-0.fa
83125  GATCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACACCGTTGTA  est-1.fa
83125  GATCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACACCGTTGTA  fei-0.fa
83125  NNNCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACNCCGTTGTA  got-7.fa
83125  NNNNTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCNAACTCATGCAAGAGCGTTGCAACCCAAAACGACACCGTTGTA  ler-1.fa
83125  NNNNNNGNGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACNCCGTTGTA  lov-5.fa
83125  NATCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGNNNNNNANNNNNAACCCAAAACGACACCGTTGTA  nfa-8.fa
83125  NATCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACNCCGTTGTA  rrs-10.fa
83125  NATCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACACCGTTGTA  rrs-7.fa
83125  GATCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACACCGTTGTA  sha.fa
83125  NATCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACACCGTTGTA  tamm-2.fa
83125  NATCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACNCCGTTGTA  ts-1.fa
83125  NNNNNGGNGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCATGCAAGAGCGTTGCAACCCAAAACGACNCCGTTGTA  tsu-1.fa
83125  NNTCTGGAGGGTTAGCTTCGACGCTAGGAAGCCACTCAAACTCANNNNNNNNANNNNNAACCCAAAACGACACCGTTGTA  van-0.fa
 
83205  AGTCCCAAATTCTTTCCAGGGCAAACCCTCTTACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACAGAGAA  chr1.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACNCTCTNACCCGACCCGAACGGTGCCAACCTCAGATCCGANCCGAAAACNNNNAA  bay-0.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACCCTCTTACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACAGAGAA  bor-4.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACCCTCTNACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACNGAGAA  br-0.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACCCTCTNACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACNGNGAA  bur-0.fa
83205  AGTCCCAAATTCTTTCCAGGGCANNNNNNNTNACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACAGAGAA  c24.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACCCTCTNACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACAGAGAA  col-0.fa
83205  AGTNCCAAATTCTTTCCAGGGCAAACCCTCTNACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACAGAGAA  cvi-0.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACCCTCTNACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACAGAGAA  est-1.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACCCTCTNACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACAGAGAA  fei-0.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACCCTCTNACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACAGANAA  got-7.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACCCTCTNACCCGACCCGAACGGTGCCAACCTCAGANCCGACCCGAAAANNNNNAA  ler-1.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACCNNNNNNNCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAANNNNNNNN  lov-5.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACCCTCTNACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACAGAGAA  nfa-8.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACCCTCTNACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACAGANAA  rrs-10.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACCCTCTNACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACAGAGAA  rrs-7.fa
83205  AGTCCCAAATTCTTCCCAGGGCAAACCCTCTNACCCGACCCGAACGGTGCCAANCTCAGANCCGACCCGAAAACAGAGAA  sha.fa
83205  AGTCCCAAANNNNNCNCANGGCAAACCCTCTNACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACAGAGAA  tamm-2.fa
83205  AGTCCCAAATTCTTTCCNNNNNNNNNNNNNNNACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACAGAGAA  ts-1.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACCCTCTTACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACNNNNNN  tsu-1.fa
83205  AGTCCCAAATTCTTTCCAGGGCAAACCCTCTNACCCGACCCGAACGGTGCCAACCTCAGATCCGACCCGAAAACAGAGAA  van-0.fa
 
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCTCTCAGGCTTAAACTCTAAAGGATCCTCCCACACGTGTGGGTCACGTGCTA  chr1.fa
83285  CTCAGCTTCACCNTCTTTAGCCACGAACCTCRRNGGRTTAAACTCTAAAGGATCCTCNNNNNNNNNNNNGTCACGTGCTA  bay-0.fa
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCTCRRNGGRNTAAACTCTAAAGGATCCTCCCANNNNNNNNNGTCACGTGCTA  bor-4.fa
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCTCRRNGGRTTAAACTCTAAAGGATCCTCCCACANNTGTGGGTCACGTGCTA  br-0.fa
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCNCRRNNNRTTAAACTCTAAAGGATCCTCCCANNNNNNNNNGTCACGTGCTA  bur-0.fa
83285  CTCAGCTTCACCCTCNNNNNNGACNAANNNNRRNGNRNNNAACTCTAAAGGATCCTCCCANNNNNNNNNNTCACGTGCTA  c24.fa
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCTCRRNGGRTNAAACTCTAAAGGATCCTCNNNNNNNNNNNNNTCACGTGCTA  col-0.fa
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCTCRRNGGRTTAAACTCTAAAGGATCCTCCCANNNNNNNNNGTCACGTGCTA  cvi-0.fa
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCTCRRNGGRNTNAACTCTAAAGGATCCTCCNNNNNNNNNNNNTCACGTGCTA  est-1.fa
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCTCRRNGGRTTAAACTCTAAAGGATCCTNNNNNNNNNNNNGGTCACGTGCTA  fei-0.fa
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCTCRRNNNRNNNAACTNNNNNNGATCCTCNNNNNNNNNNNNNNCACGTGCTA  got-7.fa
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCTCRRNGNRNNNAACTCTAAAGGATCCNNNNNNNNNNNNNNNNNACGTGCTA  ler-1.fa
83285  NNNNNNNNCACCCNCNNTNGCCACGAACCTCRRNNNRNNNNNCTCTANAGGATCNNNNNNNNNNNNNNNNNNNCGTGCTA  lov-5.fa
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCTCRRNGGRTTAAACTCTAAAGGATCCTCNNNNNNNNNNNNNTCACGTGCTA  nfa-8.fa
83285  CTCAGCTTNACCCTCTTTAGCCACGAACCTCRRNNNRNNNNNNNNNNNNGGATCCTNNNNNNNNNNNNNNNNACGTGCTA  rrs-10.fa
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCTNRRNGGRNNAAACTCTAAAGGATCCTCNNNNNNNNNNNNNTCACGTGCTA  rrs-7.fa
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCTCRRNGGRTNAAACTCTAAAGGATCCTCCNNNNNNNNNNNNTCACGTGCTA  sha.fa
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCTCRRNGGRTTNAACTCTAAAGGATCCTCCCNNNNNNNNNNNTCACGTGCTA  tamm-2.fa
83285  CTCAGCTTCACCNNNNNNNNNNNNNNNNNNNRRNNNRNNNNNNNCTAAAGGATCCTNNNNNNNNNNNNNNNCACGTGCTA  ts-1.fa
83285  NNCNNCNTCACCCTCTTTAGCCACGAACCNCRRNNNRNNNNNNNNNNAAGGATCCNNNNNNNNNNNNNNNNCACGTGCTA  tsu-1.fa
83285  CTCAGCTTCACCCTCTTTAGCCACGAACCTCRRNGGRTTAAACTCTAAAGGATCCTCCCANACGTGTGGGTCACGTGCTA  van-0.fa
 
83365  TAGCCCACATGTTGACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGTCTGTTATAGACAGTCGT  chr1.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGTCTGTTATAGACAGTCGT  bay-0.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGTCTGTTATAGACAGTCGT  bor-4.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGTCTGTTATAGACAGTCGT  br-0.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGTCTGTTATAGACAGTCGT  bur-0.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCNNNNNNNNNCNNNNNNNNNNNAGACAGTCGT  c24.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGTCTGTTATAGACAGTCGT  col-0.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGTCTGTTATAGACAGTCGT  cvi-0.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGTCTGTTATAGACAGTCGT  est-1.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGTCTGTTATAGACAGTCGT  fei-0.fa
83365  TAGCCCNCRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGNCNNNNNNNGACAGTCGT  got-7.fa
83365  TAGCCNNCRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGNNNNNNNNNNAGACAGTCGT  ler-1.fa
83365  NAGCCNNCRRRRRRNCCATCGCGGTGGTCCCAGCCGGCACGTGATATCCANCTACGGAAGNNNNNNNNNNNNACAGTCGT  lov-5.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGTCTGTTATAGACAGTCGT  nfa-8.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGTCTGTTNTAGACAGTCGT  rrs-10.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTNNNNNNNATAGACAGTCGT  rrs-7.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGTCTGTTATAGACAGTCGT  sha.fa
83365  TAGCCCANRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGTCTGTTATAGACAGTCGT  tamm-2.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCNNNNNNNNNCNNNNNNNNNNNNNACAGTCGT  ts-1.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCANNNNNGGAAGNNNNNNNNNTAGACAGTCGT  tsu-1.fa
83365  TAGCCCACRRRRRRACCATCGCGGTGGTCCCAGCCGGCACGTGATATCCATCTACGGAAGTGTCTGTTATAGACAGTCGT  van-0.fa
 
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  chr1.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCNTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  bay-0.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  bor-4.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  br-0.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  bur-0.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  c24.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  col-0.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  cvi-0.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  est-1.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  fei-0.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCNTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  got-7.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  ler-1.fa
83445  GCCCAAGAAAGCAGNGGACCTGGTGGATGCAGCCTCAACACTTCTNTGATCATAGCCGTTAGATNCGTGAGTGATGGAAG  lov-5.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  nfa-8.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  rrs-10.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  rrs-7.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  sha.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  tamm-2.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  ts-1.fa
83445  GCCCAAGAAAGCAGTNGACCTGGTGGATGCAGCCTCAACNNNNCTNTGATCATAGCCGTTAGATNCNNGNGTGATGGAAG  tsu-1.fa
83445  GCCCAAGAAAGCAGTGGACCTGGTGGATGCAGCCTCAACACTTCTTTGATCATAGCCGTTAGATACGTGAGTGATGGAAG  van-0.fa
 
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  chr1.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  bay-0.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  bor-4.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  br-0.fa
83525  GTCTGACTCANCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  bur-0.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  c24.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  col-0.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  cvi-0.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  est-1.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  fei-0.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  got-7.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGNA  ler-1.fa
83525  NNNNNACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGNNNNNNN  lov-5.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  nfa-8.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  rrs-10.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  rrs-7.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  sha.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  tamm-2.fa
83525  GTCTGACTCATCCACGNNNNNNAATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  ts-1.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGNTGCA  tsu-1.fa
83525  GTCTGACTCATCCACGGTTCTTGATCTGCCAACGACTCGGTCAAGCTCATCGTGGACCGTTAATTGAACTTTGGGATGCA  van-0.fa
 
83605  TCACAATCCTCGCTAGCACCCACTCGACCAAAACCGCAACAGTGTCCGTTCCCCTAAATATCATTTCCTAAACGGACCAA  chr1.fa
83605  TCACAATCCTCGCTAGCANNCACTCGACCAAAACCGCAACAGTGTCCGTTCCCCTNNARNTCATTTCCTAAACGGACCAA  bay-0.fa
83605  TCACAATCCTCGCTAGCANCCACTCGACCAAAACCGCAACAGTGTCCGTTCCCCTNNNRNNNNNNNCCTAAACGGACCAA  bor-4.fa
83605  TCACAATCCTCGCTAGCANCCACTCGACCAAAACCGCAACAGNGTCCGTTCCCCTNNNRNNNNNNNCCTAAACGGACCAA  br-0.fa
83605  TCACAATCCTCGCTAGCANCCACTNNNNNAAAACCGCAACAGTGTCCGTTCCCCTNANRNNCATTTCCTAAACGGACCAA  bur-0.fa
83605  TCACAATCCTCGCTAGCANCCACTCGACCAAAACCGCAACAGTGTCCGTTCCCCTNNARNNNATTTCCTAAACGGACCAA  c24.fa
83605  TCACAATCCTCGCTAGCANCCACTCGACCAAAACCGCAACAGTGTCCGTTCCCCTNNNRNNNATTTCCTAAACGGACCAA  col-0.fa
83605  TCACAATCCTCGCTAGCANCCACTCGANNNNAACCGCAACAGTGTCCGTTCCCCTANNRNNNATTTCCTAAACGGACCAA  cvi-0.fa
83605  TCACAATCCTCGCTAGCANCCACTCGACCAAAACCGCAACAGTGTCCGTTCCCCTNNNRNNNNNTTCCTAAACGGACCAA  est-1.fa
83605  TCACAATCCTCGCTAGCANCCACTCGACCAAAACCGCAACAGTGTCCGTTCCCCTANARNNNATTTCCTAAACGGACCAA  fei-0.fa
83605  TCACAATCCTCGCTAGCANCCACTCGANNNNAACCGCAACAGTGTCCGTTCCCNNNNNRNNNNNNNNNNNNACGGACCAA  got-7.fa
83605  TCACAATCCTCGCTAGCANCCACTCGACCAAAACCGCAACAGTGTCCGTTCCCCTNNNRNNNNNNNCCTAAACGGACCAA  ler-1.fa
83605  NCACAATCCTCGCTAGCNNNNNNNNNANCAAAACCGCAACAGTGTCCGTTCCCCNNNNRNNNNNNNNNNAAACGGACCAA  lov-5.fa
83605  TCACAATCCTCGCTAGCANCCACTCGANCAAAACCGCAACAGTGTCCGTTCCCCTNNNRNNNATTTCCTAAACGGACCAA  nfa-8.fa
83605  TCACAATCCTCGCTAGCANCCACTCGACCAAAACCGCAACAGTGTCCGTNNNNNNNNNRNNNNNNNNNTAAACGGACCAA  rrs-10.fa
83605  TCACAATCCTCGCTAGCANCCACTCGACCAAAACCGCAACAGTGTCCGTTCCCCNANNRNNNNNNTCCTAAACGGACCAA  rrs-7.fa
83605  TCACAATCCTCGCTAGCANCCACTCGANCAAAACCGCAACAGTGTCCGTTCCCCTNNNRNNNATTTCCTAAACGGACCAA  sha.fa
83605  TCACAATCCTCGCTAGCANCCACTCGANNNNAACCGCAACAGTGTCCGTTCCCCTNNNRNNNNNNNNCTAAACGGACCAA  tamm-2.fa
83605  NCACAATCCTCGCTAGCANCCACTCGANNNNAACCGCAACAGTGTCCGTTCCCCTNNNRNNNNNTNNCNAAACGGACCAA  ts-1.fa
83605  TCACAATCCTCGCTAGCANCCACTCGACCAAAACCGCAACAGTGTCCGTTCCNNNNNNRNNNNNNNNNNAAACGGACCAA  tsu-1.fa
83605  TCACAATCCTCGCTANCANCCACTCGANNNNAACCGCAACAGTGTCCGTTCCCCTNNNRNNNNNNNCCTAAACGGACCAA  van-0.fa
 
83685  AAAAGTTAATATCGTAAGAGAAATTTTTCTTAATCATTTCCATGATTTGATATAAAACCAAACAATTGTTAATCTATTGT  chr1.fa
83685  AAAAGTTAATATCGTAAGAGAAATTTTNNNNNNNNNNNNNNNNNNNTTGATATAAAACCAAANAATTNNNNNNNTATTGN  bay-0.fa
83685  AAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
83685  AAAAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCANNNNNNNNNNNNNNNNNNNN  br-0.fa
83685  AAAAGTTNNNNNNNNAAGAGAAATTNTNNNNNNNNNNNNNNNNGATTTGATATAAAACCAAACAATTNNNNNNNNNNNNN  bur-0.fa
83685  AAAAGTTAANNNNGTAAGAGAAANNNNNNNNNNNNNNNNNNNNNNNNTGATATAAAACCNNNNNNNNNNNNNNNNNNNNN  c24.fa
83685  AAAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAACCNNNNNNNNNNNNNNNNNNNNN  col-0.fa
83685  AAAAGTTNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATATAAAACCAAANNNNNNNNNNNNNNNNNN  cvi-0.fa
83685  AAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
83685  AAAAGTTANNNNNNNNAGAGAANNNNNNNNNNNNNNNNNNNNNNNTTTGATATAAAACCAAACAANNNNNNNNNNNNNNN  fei-0.fa
83685  AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
83685  AAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
83685  AAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
83685  AAAAGTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATATAAAACCAANNNNNNNNNNNNNNNNNNN  nfa-8.fa
83685  AAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
83685  AAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
83685  AAAAGTTAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATATNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
83685  AAAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
83685  AAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
83685  AAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
83685  AAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
83765  ATACTTAATACACTTACTTAATTAGTAAATTTTATGGATTCTTCTTAGATGTTATCTAGTTGACTAATGTTGATATTCAT  chr1.fa
83765  ATACTTAATACACTTANNNNNTTAGTAAATTTTATGGATTCTTCTTNGATGTTATCTAGTTGACTAATGTTGATATTCAT  bay-0.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGANNNNNGNNNNNNNNNNN  br-0.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNTGGATTCTTCTTNNNNGTTATCTAGTTGACTAATGTTGATATTCAT  bur-0.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATGGNTTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTNNNNNNNNNN  col-0.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGATTNTTCTTNNNNNNNNTCTAGTTGACTAATGTTGATNTTCAT  cvi-0.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATGGNTTCTTCTTAGANGTTATCTAGTTGACTAATGTTGATATTCAT  fei-0.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTAGTTGACTAATGTTGANNNNNAT  nfa-8.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGNTTCTTCTTANNNNNNNNNNNNTTGACTAATGTTGATATTCAT  sha.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNN  tamm-2.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
83765  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNN  van-0.fa
 
83845  GATATACGGATTGAATAGTGATTAAAAGACAAAACTTACCCAAAGAACAGCAACCATGTCGGATTCTGATAATTTTTCTG  chr1.fa
83845  GATATACGGATTGAATAGTGATNANNANACAAAACTTNNNNNANNARRAGCAACCATGTCGGATTCTGATAATTTTTCTG  bay-0.fa
83845  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAAGARRNGCAACCATGTCGGATTCTGNNNNNNTTTNNN  bor-4.fa
83845  NNTATACGGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAANNARRANCAACCATGTCGGATTCTGATAATTTTTCTG  br-0.fa
83845  GATATACGGATTGAATAGTGATTAAAAGNCAAAACTNACCCAANGARRAGCAACCATGTCGGATTCTGATAATTTTTCTG  bur-0.fa
83845  NNTATACGGATTGAATAGNNNNNNNNNNNNNNNNNNNNNCCAANGARRAGCAACCATGTCGGATTCTGATAATTTTTCTG  c24.fa
83845  NNNANACGGATTGNNNNNNNNNNNNNNNACAAANNNNNNCCAANNARRAGCAACCATGTCGGATTCTGATNNNNTTTCTG  col-0.fa
83845  GATATACGGATTGAATAGTNNNNNNNNNACAAAACTTACCCAANGARRAGCAACCATGTCGGATTCTGATAATTTTTCTG  cvi-0.fa
83845  NNNNNNNGNNTNNNNNNNNNNNNNNNNNNNAAANNNNNNNNNNNNNRRNNCAACCATGTCGGATTCTGATNATTTTTCTG  est-1.fa
83845  GATATACGGATTGAATAGTGATTAAAAGACAAAACTNACCCAANNARRNGCAACCATGTCGGATTCTGATAATTTTTCTG  fei-0.fa
83845  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAANNNNNNNNCAANNNRRANCAACCATGTCGGATTCTGNNNNNNNNNNNN  got-7.fa
83845  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAANNNNNNCCAANNNRRNNNAACCATGNCGGATTCTGNNNNNNTTTCTG  ler-1.fa
83845  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNCCAANNNRRNNNAACCATGTCGGATTNNNNNNNNNNNNNNN  lov-5.fa
83845  GATATACGGATTGAATAGTNNNNNNNNNNCAAAACTTACCCAANGARRAGCAACCATGTCGGATTCTGATAATTTTTCTG  nfa-8.fa
83845  NNNNNACGGATTGNANNNNNNNNNNNNNNNNNAACTTACCCAAANARRAGCAACCATGTCGGATTCTGATAATTNTTCTG  rrs-10.fa
83845  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAANNARRNNNAACCATGTCGGATTCTGNNNNNNTTTNNN  rrs-7.fa
83845  GATATACGGATTGAATAGNNNNNNNNAGACAAAACTNANCCAANNARRNGCAACCATGTCGGATTCTGATAATTTTTCTG  sha.fa
83845  NNNNNNCGGATTGAATNNNNNNNNNNNNACAAANNNNNNCCAANNARRNNNAACCATGTCGGATTCTGNNNNNNTTTCTG  tamm-2.fa
83845  NNNNNNNNNATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAANNARRNNCAACCATGTCGGATTNGNNNNNNNNNNNTG  ts-1.fa
83845  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAANNNRRNNNAACCNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
83845  GATATACGGATTGNNNNNNNNNNNNNNNNNAAANNNNNNCCAAANARRAGCAACCATGTCGGATTCTGATNNTTTTTCTG  van-0.fa
 
83925  AACCTTGAAGAGAAAGTAACATGTCAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTCAATAACAGA  chr1.fa
83925  AACCTTGAAGAGAAAGTAACATGTCAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTCAANAACAGA  bay-0.fa
83925  NNNNNNNNAGAGAANNNNNNNNNNNAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTNNNNNACAGA  bor-4.fa
83925  AACCTTGAAGAGAAAGTNNNNNNTCAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTCNATAACAGA  br-0.fa
83925  AACCTTGAAGAGAAAGTAACATGTCAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTNNNNNACAGA  bur-0.fa
83925  AACCTTGAAGAGAAAGTAACATGTCAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTCNATAACAGA  c24.fa
83925  AACCTTGAAGAGAAAGNANNNNNNNAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTNNNNNACAGA  col-0.fa
83925  AACCTTGAAGAGAAAGTAACATGTCAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTCNATAACAGA  cvi-0.fa
83925  AACCTTGAAGAGAAAGNANNNNNNNAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTCNATAACAGA  est-1.fa
83925  AACCTTGAAGAGAAAGTAACATGTCAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTNNNNNACAGA  fei-0.fa
83925  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTNNNNNNNNNN  got-7.fa
83925  ANNNNTGAAGAGANNNNNNNNNNNNNNNAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTNNNNNNNANA  ler-1.fa
83925  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTACCCGTGGCAGCACGTTGTNNNNNNNNNATACGGCTNNNNNNNNNN  lov-5.fa
83925  AACCTTGAAGAGAAAGTAACATGTCAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTCNATAACAGA  nfa-8.fa
83925  AACCNTGAAGAGAAANNNNNNNGTCAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCNNNNNNNCAGA  rrs-10.fa
83925  NNNNNNNNAGAGANNNNNNNNNNNNNNGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTNNNNNANNNN  rrs-7.fa
83925  AACCTTGAAGAGAAAGTAACATGTCAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTCNATAACAGA  sha.fa
83925  AACCTTGAAGAGAAANNNNNNNNNNAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTNNNNNACAGA  tamm-2.fa
83925  AACCTTGAAGAGAAANNNNNNNNNNNNGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTNNNNNACAGA  ts-1.fa
83925  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTACCCGTGGCAGCACGTTGTTCNTGTATGATACGGCTCAANNNNNNN  tsu-1.fa
83925  AACCNTGAAGAGAAAGTANNNNNTCAAGAAAGTTACCCGTGGCAGCACGTTGTTCATGTATGATACGGCTNNNNNACAGA  van-0.fa
 
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  chr1.fa
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCNAAACCGGCTAACCAAGGAAGATGGTCGGT  bay-0.fa
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  bor-4.fa
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  br-0.fa
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  bur-0.fa
84005  TTTACTTTCGGTACGAGNNNGNAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  c24.fa
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  col-0.fa
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  cvi-0.fa
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  est-1.fa
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  fei-0.fa
84005  NNNNNTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  got-7.fa
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  ler-1.fa
84005  NNNNNTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  lov-5.fa
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  nfa-8.fa
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  rrs-10.fa
84005  NNNACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  rrs-7.fa
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  sha.fa
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGNAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  tamm-2.fa
84005  TTTACTTTCGGTACGANNNNGNNNNNNNNNNNANNNNNNNNNNGGAAATCTAAACCGGCTAACCAAGGAAGANGNNCNGT  ts-1.fa
84005  NNNNNTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  tsu-1.fa
84005  TTTACTTTCGGTACGAGCTGCGAGCACCTAAACCGGATTTGTTGGAAATCTAAACCGGCTAACCAAGGAAGATGGTCGGT  van-0.fa
 
84085  CCAATTTAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAACCCTTTAAGCATTCAGATTCCAAGTTGTTATTTGACT  chr1.fa
84085  CCAATTTAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAACCCTTTNAGCATTCAGATTCCAAGTTGTTATTTGACT  bay-0.fa
84085  CCAATTTAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAACCCNNNNANNNNNNNGATTCCNAGTTGTTNNNNNNNN  bor-4.fa
84085  CCAATTTAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAACCCTTTNAGCATTCAGATTCCAAGTTGTTATTTGACT  br-0.fa
84085  CCAATTTAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAACCCTTTAAGCATTCAGATTCCAAGTTGTTATTTGACT  bur-0.fa
84085  CCAATTTAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAACCCTTTNNNNNNNNNNGNTCCAAGTTGTTATTTGACT  c24.fa
84085  CCAATTTAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAACCCTTTAANCATTCAGATTCCAAGTTGTTNTTTNNNN  col-0.fa
84085  CCAATTTAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAACCCTTTNAGCATTCAGATTCCAAGTTGTTATTTGACT  cvi-0.fa
84085  CCAATTTAACGTACCTAGAAGATCGTACCCNTCTTCAACCAAACCCTTTAANCATTCAGATTCCAAGTTGTTNNNNNNNT  est-1.fa
84085  CCAATTTAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAACCCTTTAAGCATTCAGATTCCAAGTTGTTATTTGACT  fei-0.fa
84085  CCAATTTANNNNNCCTAGAAGATCGTACCCTTCTTCAACCAAANNNNNNNNNNNNNNAGATNNNNNNNNNNNNNNNNNNN  got-7.fa
84085  CCAATTTAACGNACCTAGAAGATCGTACCCTTCTTCANCCAAACCNNNNNNNNNNNNNGATTCCAANNNNNNNNNTGACT  ler-1.fa
84085  CCAATTTAACGTNNNNAGAAGATCGTACCCTTCTTCANCNNANNNNNNNNNNNNNNNNGATTNNNNNNNNNNNNNNNNNN  lov-5.fa
84085  CCAATTTAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAACCCTTTAAGCATTCAGATTCCAAGTTGTTATTTGACT  nfa-8.fa
84085  CCAATTTAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAACCCTNNNNNNNNTCAGATTCNNNNNTNTNNNNNNNNN  rrs-10.fa
84085  CCAATTTAACGNACCTAGAAGATCGTACCCTTCTTCAACCAAACCCTTNAANNNNNNNGATTCCAAGNTGTTATTTGACT  rrs-7.fa
84085  CCAATTTAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAACCCTTTAAGCATTCAGATTCCAAGTTGTTATTTGACT  sha.fa
84085  CCAATTTAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAANCNNNNNNNNATTCAGATTCCNNNNNNNTNTTTGACT  tamm-2.fa
84085  CCAATTNAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAACCCTNNNNNNNNNNNNGNNNNNNNNNNTTATTTGACT  ts-1.fa
84085  CCAATTTANNNNNNNNAGAAGATCGTACCCTTCTTCAACCAANNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNN  tsu-1.fa
84085  CCAATTTAACGTACCTAGAAGATCGTACCCTTCTTCAACCAAACCCTTTAAGCATTCAGATTCCAAGTTGTTATTNNNNN  van-0.fa
 
84165  CCAATTCATACTCTCTCCCGAAAACCAAACCCATCATGTTACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  chr1.fa
84165  CCAATTCANACTCTCTNCCGAAAACCAANNNNNTCATGTTACACAACGACGCNGTTTTGAGCAAATCACGCACTGCACAC  bay-0.fa
84165  NNAATTCATACTCTCTNCCGAAAACCAAACCCATCATGTTACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  bor-4.fa
84165  CCAATTCATACTCNNNNNNGAAAACCAAACCCATCATNTTACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  br-0.fa
84165  CCAATTCATACTCTCTNCCGAAAACCAAACCCATCATGTTACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  bur-0.fa
84165  CCAATTCATACTCTCTCCCGAAAACCAAACCCATCATGTTACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  c24.fa
84165  NCAATTCATACTCTCNCNNGNAAACCAAACCCATCATGTTACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  col-0.fa
84165  CCAATTCATACTCTCTCCCGAAAACCAAACCCATCATGTTACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  cvi-0.fa
84165  CCAATTCATACTCTCNCCCGAAAACCAAACCCATCATGTTACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  est-1.fa
84165  CCAATTCATACTCTCTNCCGAAAACCAAACCCATCATGTTACACAACGACGCNGTTTTGAGCAAATCACGCACTGCACAC  fei-0.fa
84165  NNNNNNNNTACTCTCTCCCGAAAACCAAACCCATNNNNNNACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  got-7.fa
84165  CCAANNNATNCTNNNNNNNGAAAACCAAACNNNNNNNNTTACACAACGACGCTGTTTTGAGCAAATCNCGCACTGCACAC  ler-1.fa
84165  NNNNNNNNTNCNNNNNNNNNNAANCCNAACCCATNNNNNNNCACAACGACGCNGTTTTGAGCAAATCACGCACNGCACAC  lov-5.fa
84165  CCAATTCATACTCTCTNCCGAAAACCAAACCCATCATGTTACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  nfa-8.fa
84165  NNNNNNNNTNCTCTCTCCCGAAAACCAANCCCATCATGTTACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  rrs-10.fa
84165  CCAATTCATACTCTCNCCCGAAAACCAAACCCATCATGTTACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  rrs-7.fa
84165  CCAATTCATACTCTCTNCCGAAAACCAAACCCATCATGTTACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  sha.fa
84165  CCAATTCATACTCTCTNCCGAAAACCAAACCCATCATGTTACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAN  tamm-2.fa
84165  CCAATTCANACTCTCTCCCGAAAACCAAACCCATCATGTTACACAACGACGCTGTTTTGAGCAAATCACGCACNNNNANN  ts-1.fa
84165  NNNNNNNNNNNNNNNNNNNGNAAACCAANNNNNNNNNNNNNCACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  tsu-1.fa
84165  CCAATTCATACTCNNNNNNGAAAACCNAACCCATCATGTTACACAACGACGCTGTTTTGAGCAAATCACGCACTGCACAC  van-0.fa
 
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTTTGATTTG  chr1.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCANCATCTGAGTCGCTATCACCCGTCTNTGATCCTCCGATTGTTTGATTTG  bay-0.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTTTGNTNNG  bor-4.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTTTGNTNNG  br-0.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTTTGNTTTG  bur-0.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTTNGATTTG  c24.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATNACCCGTCTCTGATCCTCCGATTGTNNNNNNNG  col-0.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCGATCACCCGTCTCTGATCCTCCGATTGTTTGATTTG  cvi-0.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTTTGATTTG  est-1.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTTNGATTTG  fei-0.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTNNNNTNNG  got-7.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTNNNNNNNG  ler-1.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTNNNNNNNN  lov-5.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTTTGATTTG  nfa-8.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGNTTGTTTGNTNNG  rrs-10.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTNNNNNNNG  rrs-7.fa
84245  GCNGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTTTGATTTG  sha.fa
84245  NNANATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTTTGATTNN  tamm-2.fa
84245  NNNNNNNNNNNGTTACGTGCAAACGCATTCACCATNTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTTTGNNNNN  ts-1.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGNNNNNNNNNNNNN  tsu-1.fa
84245  GCGGATTTAGGGTTACGTGCAAACGCATTCACCATCTGAGTCGCTATCACCCGTCTCTGATCCTCCGATTGTTNGATTTG  van-0.fa
 
84325  CTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  chr1.fa
84325  NTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  bay-0.fa
84325  NTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  bor-4.fa
84325  NTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  br-0.fa
84325  CTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  bur-0.fa
84325  CTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  c24.fa
84325  NTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  col-0.fa
84325  CTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  cvi-0.fa
84325  CTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  est-1.fa
84325  CTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  fei-0.fa
84325  NNNNNGGTTAAAAAGATGGTTCGAGNCTAACCGACGCAGCGTACGCCAATAAGTNCCATTGGGAGCAAATCCCATGGCTC  got-7.fa
84325  NTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGNAGCAAATCCCATGGCTC  ler-1.fa
84325  NNNNNNGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACNANNNNNAGCAAANCNNANGGCTC  lov-5.fa
84325  CTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  nfa-8.fa
84325  NTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  rrs-10.fa
84325  NTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  rrs-7.fa
84325  NTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATANNNTNNNNNNNNNGCAAATCCCATGGCTC  sha.fa
84325  NNNNGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCANNNNNNTNNNNNNNNNNCAAATCCCATGGCTC  tamm-2.fa
84325  NNTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  ts-1.fa
84325  NNNNGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGNANNNNNNNGAGCAAANCCCATGGCTC  tsu-1.fa
84325  NTTCGGGTTAAAAAGATGGTTCGAGCCTAACCGACGCAGCGTACGCCAATAAGTACCATTGGGAGCAAATCCCATGGCTC  van-0.fa
 
84405  GGTTAAACATCAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACTGTTTAGTATCTCCTTTGCCACG  chr1.fa
84405  GGTTAAACATCAAACCGTAAGCGNTTTCGTCANCCGGTCGNTCAGCAAAAACCGAACTGTTTAGTATCTCCTTTGCCACG  bay-0.fa
84405  GGTTAAACATCAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACTGTTTAGTNTCTCCTTTGCCACG  bor-4.fa
84405  GGTTAAACATCAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACTGTTTAGTATCTCCTTTGCCACG  br-0.fa
84405  GGTTAAACATCAAACCGTAAGCGGTTTCGTCAACCGGTCGNTCAGCAAAAACCGAACTGTTTAGTATCTCCTTTGCCACG  bur-0.fa
84405  GGTTAAACATCAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACTGTTTAGTATCTCCTTTGCCACG  c24.fa
84405  GGTTAAACATCAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACTGTNTNNTNTCTCCTTTGCCACG  col-0.fa
84405  GGTTAAACATCAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACTGTTTAGTATCTCCTTTGCCACG  cvi-0.fa
84405  GGTTAAACATCAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACTGTTTAGTNTCTCCTTTGCCACG  est-1.fa
84405  GGTTAAACATCAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACTGTTTAGTATCTCCTTTGCCACG  fei-0.fa
84405  GGTTAAACATNAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAANNNNNNNNNNNNTCCTTTGCCACG  got-7.fa
84405  GGTTAAACATCAAANNNNNNNNGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGANNNNNNNNNNNTCTCCTTTGCCACG  ler-1.fa
84405  GGTTAAACATCAANNNNNNNNNNNNTTCGTCAACCGGTCGGTCAGCAAAAACCGNNNNNNNNNNNNTCTCCTTTGCCACG  lov-5.fa
84405  GGTTAAACATCAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACTGTTTAGTATCTCCTTTGCCACG  nfa-8.fa
84405  GGTTAAACATNAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACNNNNNNNNNNCTCCTTTGCCACG  rrs-10.fa
84405  GGTTAAACATNAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACTGNNNNNNNTCTCCTTTGCCACG  rrs-7.fa
84405  GGTTAAACATCAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACTGTTTAGTATCTCCTTTGCCACG  sha.fa
84405  GGTTAAACATCAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACTGTNNNNNNNNTCCTTTGCCACG  tamm-2.fa
84405  GGTTAAACATNAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACTGNNNNNTATCTCCTTTGCCACG  ts-1.fa
84405  GGTTAAACATCAAACCGNAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAANNNNNNNNNNNNTCCTTTGCCACG  tsu-1.fa
84405  GGTTAAACATCAAACCGTAAGCGGTTTCGTCAACCGGTCGGTCAGCAAAAACCGAACTGTTTAGTATCTCCTTTGCCACG  van-0.fa
 
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGGCGTTACTCATCTCAGCCAC  chr1.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGNCGTTACTCATCTCAGCCAC  bay-0.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGGCGTTACTCATCTCAGCCAC  bor-4.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGGCGTTACTCATCTCAGCCAC  br-0.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGNCGTTACTCATCTCAGCCAC  bur-0.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGNCGTTACTCATCTCAGCCAC  c24.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGGCGTTACTCATCTCAGCCAC  col-0.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGNCGTTACTCATCTCAGCCAC  cvi-0.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGGCGTTACTCATCTCAGCCAC  est-1.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGGCGTTACTCATCTCAGCCAC  fei-0.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGGCGTTACTCATCTCAGCCAC  got-7.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGNCGTTACTCATCTCAGCCAC  ler-1.fa
84485  GCAGGATGACACGNCACCACCACCTTAGTATCACCGAGGCTAAACNCCATNNNNNNNNNNNCGTTACTCATCNCAGCCAC  lov-5.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGNCGTTACTCATCTCAGCCAC  nfa-8.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGGCGTTACTCATCTCAGCCAC  rrs-10.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGGCGTTACTCATCTCAGCCAC  rrs-7.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGGCGTTACTCANNNGNNNNNC  sha.fa
84485  GCAGGNTGNCANGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGGCGTTACNNNNNNGNNNNNN  tamm-2.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGGCGTTNNNNNNNNGNNNNNN  ts-1.fa
84485  GCAGGATGACACGNCACCACCACCTTAGTATCACCGAGGCNAAACGCCATGAGCCGCTTGGCGTTACTCATCTCAGCCAC  tsu-1.fa
84485  GCAGGATGACACGTCACCACCACCTTAGTATCACCGAGGCTAAACGCCATGAGCCGCTTGGCGTTACTCATCTCAGCCAC  van-0.fa
 
84565  AGACGCTATGCGCTGATGAGCCACGTGGCTTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  chr1.fa
84565  AGACGCTATGCGCTGATGNNNNNNNNNNNNTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  bay-0.fa
84565  AGACGCTATGCGCTGATGANNNNNGTGGCTTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  bor-4.fa
84565  AGACGCTATGCGCTGATGANNNNNNNGGCTTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  br-0.fa
84565  AGACGCTATGCGCTGATGNNNNNNNNNNNNTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  bur-0.fa
84565  AGACGCTATGCGCTGATGNNNNNNNNNNNNTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  c24.fa
84565  AGACGCTATGCGCTGATGNNNNNNGTGGCTTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  col-0.fa
84565  AGACGCTATGCGCTGATGNNNNNNNNNNNTTGACCTAAGGCTCATGCTTCCCACAANNNNNAACCCTCTAGGACCGGGAA  cvi-0.fa
84565  AGACGCTATGCGCTGATGAGNCACGTGGCTTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  est-1.fa
84565  AGACGCTATGCGCTGATGNNNNNNNNNNCTTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  fei-0.fa
84565  AGACGCTATGCGCTGATGNNNNNNGTGGCTTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  got-7.fa
84565  AGACGCTANGCGCTGATGNNNNNNNNNNNNNGACCTANGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  ler-1.fa
84565  AGANNNNNNNCGCTGATGNNNNNNNNNNNNTGACNNNNNNCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  lov-5.fa
84565  AGACGCTATGCGCTGATNNNNNNNNNGGCTTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  nfa-8.fa
84565  AGACGCTATGCGCTGATGAGCCACGTGGCTTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  rrs-10.fa
84565  AGACGCTATGCGCTGATGNNNNNNNNNNNTTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  rrs-7.fa
84565  AGACGCTATGCGCTGATGAGNCNNNTGGCTTGACCTAAGGCTCATGCTTCCCACANNNNNNNNCCCTCTAGGACCGGGAA  sha.fa
84565  NGACGCTATGCGCTGATGNNNNNNNNGGCTTGACCTAAGGCTCATGCTTCCNANNANNNNNNNCCCTCTAGGACCGGGAA  tamm-2.fa
84565  NNNNGCTATGCGCTGATGNNNNNNNNGGCTTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  ts-1.fa
84565  AGACGCTATGCGCTGATGNNNNNNNNGGCTTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  tsu-1.fa
84565  AGACGCTATGCGCTGATGAGCCACGTGGCTTGACCTAAGGCTCATGCTTCCCACAAGTGGAAACCCTCTAGGACCGGGAA  van-0.fa
 
84645  TGAGATTCTTGTATTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCCGGTCCACCC  chr1.fa
84645  TGAGATTNNNNNNNNTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGNGAAGAAGTNTTTTCCCCAAGCCGGTCCACCC  bay-0.fa
84645  TGAGANNNNNNNNNTTTCGGTTGTAATNNNNNNAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCCGGTCCACCC  bor-4.fa
84645  TGAGATTCTTGTATTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCCGGTCCACCC  br-0.fa
84645  TGAGATTCTTGTNTTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCNGGTCCACCC  bur-0.fa
84645  TGAGATTCTTGTNTTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCNGGTCCACCC  c24.fa
84645  TGAGATTNTNNTNTTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCCGGTCCACCC  col-0.fa
84645  TGAGATTCTTGTATTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCCGGTCCACCC  cvi-0.fa
84645  TGAGATTCTTGTATTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCCGGTCCACCC  est-1.fa
84645  TGAGATTCTTGTATTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCCGGTCCACCC  fei-0.fa
84645  TGAGNNNNNNNNNTNNTNGGTTGTAANNNNNNNAAATAAACCGGCGAGTGAAGAAGTNTTTTCCCCAAGCCGGTCCACCC  got-7.fa
84645  TGANNNNNNNNTATTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGNATTTTCCCCAAGCCGGTCCACCC  ler-1.fa
84645  TGAGANTNNNNNNNNTTCGGTTGTAATNGAGAGAAATAAACCGGCNNNNNAAGAAGTATTTTCCCCAAGCCGGTCCACCC  lov-5.fa
84645  TGAGATTCTTGTNTTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCNGGTCCACCC  nfa-8.fa
84645  TGAGATTCTTGTNTTTTCGGTTGTAATCGANAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCCGGTCCACCC  rrs-10.fa
84645  TGAGANNNNNNTATTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCCGGTCCACCC  rrs-7.fa
84645  TGAGATTCTTGTATTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCNGGTCCACCC  sha.fa
84645  TGAGATTNTNNTNTTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCCGGTCCACCC  tamm-2.fa
84645  TGAGATTNTNNTNTTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCCGGTCCACCC  ts-1.fa
84645  TGAGNNNNNNNNNNNNNNNNTTGTNNNNNNNAGAAATAAACCGGCGAGTGAAGAAGTATTTTCCCCAAGCCGGTCCACCC  tsu-1.fa
84645  TGAGATTCTTGTATTTTCGGTTGTAATCGAGAGAAATAAACCGGCGAGTGAAGAAGTATTTT