Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 16503436 - 16507468


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
16503436  GTATTGTGAATAGCACATAGAGAAAAAGGTGTTATATAGTATAATTTTTTTAGTACTTTTACTTTTTTTTTAAAATATTG  chr1.fa
16503436  NNNNNNRNNNNAGCACANAGAGAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTNNNNNNNNNNNR  bay-0.fa
16503436  NNNNNNRNNNNNNNNNNNAGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  bor-4.fa
16503436  NNNTTGRGAATAGCACATAGAGAAAANGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  br-0.fa
16503436  NNNTTGRNNATAGCACATAGAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  bur-0.fa
16503436  NNNNNNRNNNNNNNACATAGAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  c24.fa
16503436  NNATTGRGAATAGCACATAGAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  col-0.fa
16503436  NNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  cvi-0.fa
16503436  NNNTNGRGANTAGCACATAGAGAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  est-1.fa
16503436  NNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  fei-0.fa
16503436  NNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  got-7.fa
16503436  NNNNNGRGNNTAGCNNNNAGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  ler-1.fa
16503436  NNNNNNRNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  lov-5.fa
16503436  NNNNNNRNNNTAGCACATAGAGAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  nfa-8.fa
16503436  NNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  rrs-10.fa
16503436  NTANNGRGAATAGCACATAGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  rrs-7.fa
16503436  NNNNNNRNNNNNNNNNNNAGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  sha.fa
16503436  GTATTGRGAATAGCACATAGAGAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  tamm-2.fa
16503436  NNNTNGRGAATNGCACATAGAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  ts-1.fa
16503436  NNNNNNRGNNTAGCACATAGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  tsu-1.fa
16503436  NNNNNNRNNNTNGCACATAGAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNR  van-0.fa
 
16503516  TCAACTATCTACAGTCTTAAAACACACCTCTTCCACAACTTGTACTTTTGAAGTATGGTTCTACGTGTATCGGTGTACAA  chr1.fa
16503516  NNNNNNNNNNRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNTGGTTCTNCNNNNNNNNNNCNNNNN  bay-0.fa
16503516  NNNNNNNNNNRRRRRRNNNAAACACACCNCTNNNNNNNNNNTNNNNNNNNNNNNNNGGTTCTACGNNNNNNNNNCNNNNN  bor-4.fa
16503516  NNNNNNNNNNRRRRRRTTNAAACACACCTCTNNNNNNNNNNTNNNNNNNNNNGTATGGTTCTACGTGTATCGGTGTACAA  br-0.fa
16503516  NNNNNNNNNNRRRRRRTNNAAACACACCNNNNNNNNNNNNNTNNNNNNNNNNGTATGGTTCTACGTGTATNNNNCNNNNN  bur-0.fa
16503516  NNNNNNNNNNRRRRRRTNNAAACACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCTACGTGTATCGGTGTACAA  c24.fa
16503516  NNNACTANNNRRRRRRTTAAAACACACCTCTTCCACAACTTGTACTTTTGAAGTATGGTTCTACGTGTATCGGTGTACAA  col-0.fa
16503516  NNNNNNNNNNRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
16503516  NNNNNNNNNNRRRRRRNNNNNACACACCTCTTCNNNNNNNNTNNNNNNNNNNNTATGGTTCTACGTGNNNNNNNCNNNNN  est-1.fa
16503516  NNNNNNNNNNRRRRRRNNNANNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNN  fei-0.fa
16503516  NNNNNNNNNNRRRRRRNNNAAACACANCTCTNNNNNNNNNNTNNNNNNNNNNNNATGGTTCTACNNNNNNNNNNNNNNNN  got-7.fa
16503516  NNNNNNNNNNRRRRRRNNNAAACACACCNNNNNNNNNNNNNTNNNNNNNNNNNTATGGTTCTACGTNNNNNNNNCNNNNN  ler-1.fa
16503516  NNNNNNNNNNRRRRRRNNNAAACACACCNNNNNNNNNNNNNTNNNNNNNNNNNNNTGGTTCTACGTNNNNNNNNCNNNNN  lov-5.fa
16503516  NNNNNNNNNNRRRRRRNNNAAACACACCNNNNNNNNNNNNNTNNNNNNNNNNNNATGGTTCTACGNNNNNNNNNCNNNNN  nfa-8.fa
16503516  NNNNNNNNNNRRRRRRTNAAAACACACCTCTTCCNNNNNNNTNNNNNNNNNNNNATGGTTCTACGNNNNNNNNNCNNNNN  rrs-10.fa
16503516  NNNNNNNNNNRRRRRRNNNNAACACACCTCTNNNNNNNNNNTNNNNNNNNNNGTNTGGTTCTACGTGNNNNNNNCNNNNN  rrs-7.fa
16503516  NNNNNNNNNNRRRRRRNNNNAACACNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNGGTTCTACGNNNNNNNNNCNNNNN  sha.fa
16503516  NNNNNNNNNNRRRRRRTNNAAACACACCTCTTCNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNN  tamm-2.fa
16503516  NNNNNNNNNNRRRRRRNNNAAACACACCNCTNCNNNNNNNNTNNNNNNNNNNNNATGGTTCTACGTGTATCGGTGTACAA  ts-1.fa
16503516  NNNNNNNNNNRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCTACGTGTNNNNNNCNNNNN  tsu-1.fa
16503516  NNNNNNNNNNRRRRRRTNNAAACACACCTCTNNNNNNNNNNTNNNNNNNNNNNTATGGTTCTACGTGTNNNNNNCNNNNN  van-0.fa
 
16503596  TTGTCCTGCAAATGGTGTGTTCTTTTTCTCTGATTTTTTAATTAAAAAAAATAGAAAACACATCTGTAAATGGTGACAAA  chr1.fa
16503596  NNNNNCTGCAAATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRNNNAAATGGTGACAAA  bay-0.fa
16503596  NNNTCCTGCAAATGGTGTGTTCNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRTNNAAATGGTGACAAA  bor-4.fa
16503596  TTGTCCTGCAAATGGTGTGTTCTTNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRTGNAAATGGTGACAAA  br-0.fa
16503596  NNNNCCTGCAAATGGTGTGNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRNNNAAATGGTGACAAA  bur-0.fa
16503596  TTGTCCTGCAAATGGTGTGNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRNNNNNATGGTGACAAA  c24.fa
16503596  TTGTCCTGCAAATGGTGTGNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNANNNRTGNAAATGGTGACAAA  col-0.fa
16503596  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNN  cvi-0.fa
16503596  NTGTCCTGCAAATGGTGTGTTCTNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRNNNAAATGGNGACAAA  est-1.fa
16503596  NNNNNCTGCAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNTGACAAN  fei-0.fa
16503596  NNNNNNNNCAAATGGTGTGTTNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNN  got-7.fa
16503596  NNNNCCTGCAAATGGTGTGTTNTNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRNNNAAATGGTGACAAA  ler-1.fa
16503596  NNNNCCTGCAAATGGTGTGNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNTGACAAA  lov-5.fa
16503596  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRNNNAAATGGTGACAAA  nfa-8.fa
16503596  NNNNNCTGCAAATGGTGTGTTCTTTTTNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRTGNAAATGGTGACAAN  rrs-10.fa
16503596  NNNTCCTGCAAATGGTGTGTTNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRTGNAAATGGTGACAAA  rrs-7.fa
16503596  NNNNCCTGCAAATGGTGTNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRNNNANATGGTGNCAAA  sha.fa
16503596  NTGTCCTGCAAATGGTGTGTTNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRTGNAAATGGTGACAAA  tamm-2.fa
16503596  TTGTCCTGCAAATGGTGTGTTCTTNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRTGNAAATGGTGNCAAA  ts-1.fa
16503596  NNNTCCTGCAAATGGTGTGTTNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRNNNAAATGGTGACAAA  tsu-1.fa
16503596  NNNNCCTGCAAATGGTGNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRNNNAAANNNNNNNNAA  van-0.fa
 
16503676  AAATTAAACATACCCTGCGATTTTTGAAACGCCTCAAACATTCAGGGCCTAGAACGTAATATCCATGCAATTTAATTAAA  chr1.fa
16503676  AANNRNNNNNNNNNNNNNNATTTTTGAAACGCRNRAAACATTCAGGGCCTAGAACGTAATATCCATGNNNNNNNNNNNNN  bay-0.fa
16503676  ANNNRNNNCATACCCTGCGATTTTTGAAACGCRTRAAACATTCAGGGCCTAGAACGTAATATCNNNNNNNNNNNNNNNNN  bor-4.fa
16503676  AANNRNNNCATACCCTGCGATTTTTGAAACGCRNRAAACATTCAGGGCCTAGAACGTAATATCNNNNNNNNNNNNNNNNN  br-0.fa
16503676  ANNNRNNNNNNNNNNNNNNNTTTTTGAAACGCRNRAAACATTCAGGGCCTAGAACGTAATATCCATNNNNNNNNNNNNNN  bur-0.fa
16503676  ANNNRNNNCATACCCTGCGATTTTTGAAACGCRNRAAACATTCAGGGCCTAGAACGTAATATCCANNNNNNNNNNNNNNN  c24.fa
16503676  ANNNRNNNCATACCCTGCGATTTTTGAAACGCRTRAAACATTCAGGGCCTAGAACGTAATATCCATGNNNNNNNNNNNNN  col-0.fa
16503676  NNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
16503676  ANNNRNNNCATACCCTGCGATTTTTGAAACGCRTRAAACATTCAGGGCCTAGAACGTAATATCCANNNNNNNNNNNNNNN  est-1.fa
16503676  NNNNRNNNNNNNNNNNNCGATTTTTGAAACGNRNRNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
16503676  NNNNRNNNNNNACCCTGCGATTTTTGAAACGCRTRAAACATTCAGGGCCTAGAACGTAANNNNNNNNNNNNNNNNNNNNN  got-7.fa
16503676  ANNNRNANCATACCCTGCGATTTTTGAAACGCRTRAAANNNNNNNNANNNNNNNCGTAATATCCATNNNNNNNNNNNNNN  ler-1.fa
16503676  ANNNRNNNCATACCCTGCGATTTTTGAAACGCRTRAAACATTCAGGGCCTAGAACGTAATATNNNNNNNNNNNNNNNNNN  lov-5.fa
16503676  ANNNRNNNCATACCCTGCGATTTTTGAAACGCRNRNAACATTCAGGGCCTAGAACGTAATATCCANNNNNNNNNNNNNNN  nfa-8.fa
16503676  NNNNRNANCATACCCTGCGATTTTTGAAACGCRTRAAACATTCAGGGCCTAGAACGTAATATCCATNNNNNNNNNNNNNN  rrs-10.fa
16503676  ANNNRNNNCATACCCTGCGATTTTTGAAACGCRTRAAACATTCAGGGCCTAGAACGTAATATCNNNNNNNNNNNNNNNNN  rrs-7.fa
16503676  ANNNRNNNNATACCCTGCGATTTTTGAAACGCRNRNANCATTCAGGGCCTAGAACGTAATATCNNNNNNNNNNNNNNNNN  sha.fa
16503676  ANNNRNNNNNTACCCTGCGATTTTTGAAACGCRNRAAACATTCNNNANNNNNNACGTAATATCCNNNNNNNNNNNNNNNN  tamm-2.fa
16503676  AANNRNNNCATACCCTGCGATTTTTGAAACGCRNRAAACATTCAGGGCCTAGAACGTAATATCCATGNNNNNNNNNNNNN  ts-1.fa
16503676  ANNNRNNNNNNNNNNNNNNNTTTTTGAAACGCRTRAAACATTCAGGGCCTAGAACGTAATATCCATNNNNNNNNNNNNNN  tsu-1.fa
16503676  ANNNRNNNCANACCCTGCGATTTTTGAAACGCRTRAAACATTCAGGGCCTAGAACGTAATATCCANNNNNNNNNNNNNNN  van-0.fa
 
16503756  TTCTTATAAGAAATCATACTAAAAAAACATGTAAAATAGTCGAAATAGTACAACCTGGAAATAAATATTATGATATAATC  chr1.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNAAAANNNNNNNNNANAGTCGAAATAGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bay-0.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGTCGAAATAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANAGTCGAAATAGTACAACCTGGANNNNNNNNNNNNNNNNNNNNN  col-0.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAATAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAAATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAAATAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAATAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAATAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
16503756  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
16503836  ATAAATAGAACTAAGGACATGAAGGTTAGATCTGAGAATGAACTTGAAGTTGAGGATAAGCTTGTATCGAAAGATGATTT  chr1.fa
16503836  NNNNATAGAACNAAGGACATGAAGGTTAGATCTGAGAATGAACTTGAAGTTGAGNNNNNNNNNNNNNNCNNNNNNNNNNN  bay-0.fa
16503836  NNNNNNNNNNNNNNGGACATGAAGGTTAGNNNNNNNNATGAACTTGAAGTTGAGGATNNNNNNNNNNNCNNNNNNNNNNN  bor-4.fa
16503836  NNNNNNNNAACTAAGGACATGAAGGTTAGATCTGAGAATGAACTTGAAGTTGAGGATAANNNNNNNNNCNNNNNNNNTTT  br-0.fa
16503836  NNNNNNAGAACTAAGGACATGAAGGTTAGATCTGAGAATGAACTTGAAGTTGAGGATANNNNNNNNNNCNNNNNNNNNTT  bur-0.fa
16503836  NNNNNNNNNNNNNNGGACATGAAGGTTAGATCTGAGAANGAACTTGAAGTTGAGGNNNNNNNNNNNNNCNNNNNNNNNNN  c24.fa
16503836  NNNNNNNNNACTAAGGACATGAAGGTTAGATCTGAGAATGAACTTGAAGTTGAGGATAAGCTTGTATCGAAAGATGATTT  col-0.fa
16503836  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
16503836  NNNNNNNNNNCNAAGGACATGAAGGTTAGATCTGAGAATGAACTTGAAGTTGAGGATANNNNNNNNNNCNNNNNNNNNNN  est-1.fa
16503836  NNNNNNNNNNNNNNNNNNNNNAAGNNNNNNNNNNNNNNNNNNNTNGANGTTGAGGANNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
16503836  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTGAGGANNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
16503836  NNNNNNNNNNNNNNGGACATGAAGGTTAGATCTGAGAATGAACTTGAAGTTGAGGATAANNNNNNNNNCNNNNNNNNNNN  ler-1.fa
16503836  NNNNNNNNNNNNNNGGACATGAAGGTTAGATCNGAGAATGAACTTGAAGTTGAGGATNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
16503836  NNNNNNNNNNNNNNGGACATGAAGGTTAGATCTGAGAATGAACTTGAAGTTGAGGATANNNNNNNNNNCNNNNNNNNNNN  nfa-8.fa
16503836  NNNNNNNNNNNNNNNNNNNTGAAGGTTAGATCTGAGAATGAACTTGAAGTTGAGGATNNNNNNNNNNNNNNNNNNNNTTT  rrs-10.fa
16503836  NNNNNNNNNNCTAAGGACATGAAGGTTAGATCTGAGAATGAACTTGAAGTTGAGGATANNNNNNNNNNCNNNNNNNNNNN  rrs-7.fa
16503836  NNNNNNNNNNNNNNGGACATGAAGGTTANNNNNNNNNNNGAACTTGAAGTTGAGNNNNNNNNNNNNNNCNNNNNNNNNNN  sha.fa
16503836  NNNNNNNNNNCTAAGGACATGAAGGTTAGATCTGAGAATGAACTTGAAGTTGAGGATAANNNNNNNNNCNNNNNNNNNNN  tamm-2.fa
16503836  NNNNNNNNNNNNNNGGACATGAAGGTTAGATCTGAGAATGAACTTGAAGTTGAGGATANNNNNNNNNNCNNNNNNNNNNN  ts-1.fa
16503836  NNNNNNNNNNNNNNGGACATGAAGGTTAGATCTGAGAATGAACTTGAAGTTGAGGATNNNNNNNNNNNCNNNNNNNNNNN  tsu-1.fa
16503836  NNNNNNNNNNNNNNNGACATGAAGGTTAGATCTGAGAATGAACTTGAAGTTGAGGANNNNNNNNNNNNCNNNNNNNNNNN  van-0.fa
 
16503916  AGAGCCAAGAAATTCAACAAAGCAGTAGGAGGATTGGTTAATCCTATTTGGAAACAATCAAATCACTTGGAAAATTATGG  chr1.fa
16503916  NNNGCCAANNNNNNNNNNAAAGCAGNAGGANNNNNNNNNNNNNANNNNNNNNNACAANCNNANCACTTGGAAAATTATGG  bay-0.fa
16503916  NNAGCCAAGAAATTCAACAAAGCAGTAGGAGGANNNNNNNNNNNNNNNNNNNNNNNNNCNNANCACTTGGAAAATTATGG  bor-4.fa
16503916  AGAGCCAAGAAATTCAACAAAGCAGTAGGAGGATTNNNNNNNNANNNNNNNNNACAATCAAATCACTTGGAAAATTATGG  br-0.fa
16503916  AGAGCCAAGAAATTCAACAAAGCAGTAGGAGGATNNNNNNNNNANNNNNNNNNACAATCAAATCACTTGGAAAATTATGG  bur-0.fa
16503916  NGAGCCAAGAAATTCAACAAAGCAGNAGGAGGANNNNNNNNNNANNNNNNNNNNNNNTCAAANCACTTGGAAAATTATGG  c24.fa
16503916  AGAGCCAAGAAATTCAACAAAGCAGTAGGAGGATNGGTNAATCCTATTTGGAAACAATCAAANCACTTGGAAAATTATGG  col-0.fa
16503916  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
16503916  NNAGCCAAGAAATTCAACNAAGCAGTAGGAGGANNNNNNNNNNNNNNNNNNNNNNAATCAANNNNNTTGGAAAATTATGG  est-1.fa
16503916  NNNGCCAAGAAATTCNNNNNNNNNNNNNNAGNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATNN  fei-0.fa
16503916  NNNNCCAANAAATTCAACNNNNNAGTAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
16503916  AGAGCCAAGAAATTCAACAAAGCAGTAGGAGGNNNNNNNNNNNANNNNNNNNNNNAATCNNNNNACTTGGAAAATTATGG  ler-1.fa
16503916  NNNGCCAAGAAATTCAACAAAGCAGTAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAAATTATGG  lov-5.fa
16503916  NNNGCCAAGAAATTCAACAAAGCAGTAGGAGGNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNGAAAATTATGG  nfa-8.fa
16503916  AGAGCCAAGAAATTCAACAAAGCAGTAGGAGGNNNNNNNNNNNANNNNNNNNNNNAATCAAANCACTTGGAAAATTATGG  rrs-10.fa
16503916  NGAGCCAAGAAATTCAACNAAGCAGTAGGAGGNNNNNNNNNNNNNNNNNNNNNACAATCAANNNNNTTGGAAAATTATGG  rrs-7.fa
16503916  NNNGCCAAGAAATTCAACAAAGCAGNAGGAGGNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNTTGGAAAATTATGG  sha.fa
16503916  NGAGCCAAGAAATTCAACAAAGCAGTAGGAGGATNNNNNNNNNNNNNNNNNNNNCAATCAAANCNCTTGGAAAATTATGG  tamm-2.fa
16503916  NNAGCCAAGAAATTCAACAAAGCAGTAGGAGGANNNNNNNNNNANNNNNNNNNNNAATCAAANCACTTGGAAAATTATGG  ts-1.fa
16503916  NNNGCCAAGAAATTCAACAAAGCAGTAGGAGGNNNNNNNNNNNNNNNNNNNNNNNAATCAAANCACTTGGAAAATTATGG  tsu-1.fa
16503916  NNNGCCAAGAAATTCAACAAAGCAGTAGGAGGANNNNNNNNNNNNNNNNNNNNNNNNTCANNNNNNNTGGAAAATTATGG  van-0.fa
 
16503996  AGAAGGTCTTATTAAAAGTTTCATGAACACCACATATTTGACAACGACCTTGATATCCTTTACCTTGAGAGCCACGATTG  chr1.fa
16503996  AGANNNNNNNNNNNNNNNNNCNNNNNNNNCCACATATTTGACAACGARRNNNNNNRNNNNNRNNNNNNRRRRRRRRRRRN  bay-0.fa
16503996  NNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNCATATTTGACAACGARRTTGANNRCNTNTRCCTTGARRRRRRRRRRRG  bor-4.fa
16503996  NNNNNNNNNNNNNNNNNNTTTCATGAACACCACATATTTGACAACGARRTTGATARCCTTTRCCTTGARRRRRRRRRRRG  br-0.fa
16503996  AGANGNNNNNNNNNNNNNNNCNNNNNNNNCCACATATTTGACAACGARRTTGANNRCCTTTRCCTTGARRRRRRRRRRRG  bur-0.fa
16503996  NNNNNNNNNNNNNANAAGTTTCATGAACACCACATATTTGACAACGARRTTGNNNRNNNTTRCCTTGARRRRRRRRRRRG  c24.fa
16503996  AGANNNNNNNNTTAAAANTTTCATGAACACCACATATTTGACAACGARRTTGATNRCCTTTRCCTTGARRRRRRRRRRRG  col-0.fa
16503996  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNNNRNNNNNNRRRRRRRRRRRN  cvi-0.fa
16503996  ANNNNNNNNNNNNNNNNNNNCNNNNNNNNNCACATATTTGACAACGARRTTGATNRCCNTTRCCTTGARRRRRRRRRRRG  est-1.fa
16503996  NNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNGACAANGARRNTGNNNRNNNNNRCCNTGNRRRRRRRRRRRG  fei-0.fa
16503996  NNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNCATATTTGACAACGARRTTGANNRNNNNNRNCTTGARRRRRRRRRRRG  got-7.fa
16503996  NNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNACATATTTGACAACGARRTTGATNRNNNNNRNNNNANRRRRRRRRRRRG  ler-1.fa
16503996  NNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNCATATTTGACAACGARRTTGATNRCNNNTRCCTTGARRRRRRRRRRRG  lov-5.fa
16503996  NNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNACATATTTGACAACGARRTTGNNNRNNNNNRCCTTGARRRRRRRRRRRG  nfa-8.fa
16503996  ANNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNCATATTTGACAACGARRTTGATARCCTTTRCCTTGARRRRRRRRRRRG  rrs-10.fa
16503996  NNNNNNNNNNNNNNNNNNNNCNNNNNNNNNCACATATTTGACAACGARRTTGATARCNTTTRCCTTGARRRRRRRRRRRG  rrs-7.fa
16503996  NNNNNNNNNNNNNNNNNNNNCNNNNNNNNNCACATATTTGACAACGARRTNGNNNRNNNNNRCCTTGNRRRRRRRRRRRG  sha.fa
16503996  ANNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNCAACGARRTTGATNRCCTTTRCCTTGNRRRRRRRRRRRG  tamm-2.fa
16503996  NNNNNNNNNNNTTNNNNNNNTCATGAACACCACATATTTGACAACGARRTTGATNRCCTTTRCCTTGARRRRRRRRRRRG  ts-1.fa
16503996  NNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNCATATTTGACAACGARRTTNNNNRNNNNNRNNNNNNRRRRRRRRRRRG  tsu-1.fa
16503996  ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACAACGARRTTGATNRCNNNTRCCTTGARRRRRRRRRRRG  van-0.fa
 
16504076  TTGGAGCGGGAATGTTGTGTTTGATTCTGCTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTTACAGTT  chr1.fa
16504076  NTGGANNNRNNRNNNNNNNNTTGATTNNNNNGNNANTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGNNNNNNNN  bay-0.fa
16504076  TTGGAGCGRGARTGNTGTGNTTGATTCTGCTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTTACAGNN  bor-4.fa
16504076  TTGGAGCGRGARNGTTGTGNTTGATTCTGCTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTTACNGTT  br-0.fa
16504076  TTGGAGCGRNNRNNNTGTGNTTGATTCTGCTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTNNNNNNN  bur-0.fa
16504076  TTGGAGCGRNNRNNNNNNNNTTGANNNNNNTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTNNNNNNN  c24.fa
16504076  TTGGAGCGRNARNGNTGTGTTTGATTCTGCTGTCNCTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTTACNGTT  col-0.fa
16504076  NNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
16504076  TTGGAGCGRGARNGNTGTGNTTGATTCTGCTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTTACAGTT  est-1.fa
16504076  TTGGANCNRNNRNNNNGTGTTNNNNNNNNCTGTCACNGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTNNNNNNN  fei-0.fa
16504076  TTGGAGCGRGARNGNTGTGNTTGATTCTGCTGTCACTGGTTGTNGTTATTACCACGAGCAGAGGAGCGATTGTTNNNNNN  got-7.fa
16504076  TTGGAGCGRGNRNNNTGTNNTTGATTCTGCTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTTACAGNN  ler-1.fa
16504076  TTGGAGCGRNARNNNTGTGNTTGATTCTGCTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTTANNNNN  lov-5.fa
16504076  TTGGAGCGRNNRNNNNGTGTTTGATTCTGCTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTTACANNN  nfa-8.fa
16504076  TTGGAGCGRGARTGTTGTGNTTGATTCTGCTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTTACAGTT  rrs-10.fa
16504076  TTGGAGCGRGARNGTTGTGNTTGATTCTGCTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTTACNNNN  rrs-7.fa
16504076  TTGGAGCNRNNRNNNTGTNNNNNATTCTGCTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTNNNNNNN  sha.fa
16504076  TTGGAGCNRNARTGTTGTGNTTGATTCTGCTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTTACAGTT  tamm-2.fa
16504076  TTGGAGCGRGNRNGTTGTGNTTGATTCTGCTGTCNCTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTTACNNNN  ts-1.fa
16504076  TTGGAGCGRGARTGTTGTGTTTGATTCTGCTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTTACAGTT  tsu-1.fa
16504076  TTGGAGCGRGARNGTTGTGNTTGATTCTGCTGTCACTGGTTGTTGTTATTACCACGAGCAGAGGAGCGATTGTTACNNNN  van-0.fa
 
16504156  GTTGTTGTTATTGTAGGAGACTACGTTAGCGGTAACCGGAGTAGAGGAACAAGGGATCATCGCTTGAAGTTTAAGCTCAT  chr1.fa
16504156  NNNNNNNRRRNTGTAGGAGACNRCGTTAGCGGRRRRRRRAGNAGAGGAACAAGGGATCATCGCTTGRAGTTTAAGCNNNR  bay-0.fa
16504156  NNNNNNNRRRNNGTAGGAGACTRCGTTAGCGGRRRRRRRAGTAGAGGAACAAGGGATCATCGCTTGRANNTTANNNNNNR  bor-4.fa
16504156  GTTGNNGRRRTTGTAGGAGACTRCGTTAGCGGRRRRRRRAGTAGAGGAACAAGGGATCATCGCTTGRAGTTTAAGCNNNR  br-0.fa
16504156  NNNNNNNRRRNTGTAGGAGACTRCGTTAGCGGRRRRRRRAGTAGAGGAACAAGGGATCATCGCNNNRNNNNNNNNNNNNR  bur-0.fa
16504156  NNNNNNNRRRNNGTAGGAGACNRCGTTAGCGGRRRRRRRAGNAGAGGAACAAGGGATCANNNNNNNRNNNNNNNNNNNNR  c24.fa
16504156  GTTGNNGRRRTTGTAGGAGACTRCGTTAGCGGRRRRRRRAGTAGAGGAACAAGGGATCATCGCTTGRAGTTTAAGNNNNR  col-0.fa
16504156  NNNNNNNRRRNNNNNNNNNNNNRNNNNNNNNNRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNR  cvi-0.fa
16504156  NNNNNNNRRRNTGTAGGAGACTRCGTTAGCGGRRRRRRRAGTAGAGGAACAAGGGANCNNNNNNNNRNNNNNNNNNNNNR  est-1.fa
16504156  NNNNNNNRRRNNNTAGGAGACNRCGNTAGCGGRRRRRRRAGNAGAGGAACAAGGGATNNNNNNNNNRNNNNNNNNNNNNR  fei-0.fa
16504156  NNNNNNNRRRNNNTAGGAGACTRCGTTAGCGGRRRRRRRAGTAGAGGAACAAGGGATCATCGCTTGRNNNNNNNNNNNNR  got-7.fa
16504156  NNNNNNNRRRTTGTAGGAGACTRCGTTAGCGGRRRRRRRAGTAGAGGAACAAGGGATCATCGCTTGRAGTTTANNNNNNR  ler-1.fa
16504156  NNNNNNNRRRNNGTAGGAGACTRCGTTAGCGGRRRRRRRAGTAGAGGAACAAGGGATCATCGCTTGRAGTTTNNNNNNNR  lov-5.fa
16504156  NNNNNNNRRRNNNNNNNNNNNNRNNNTAGCGGRRRRRRRAGTAGAGGAACAAGGGATCATCGCTNGRAGNTTNNNNNNNR  nfa-8.fa
16504156  GNNNNNGRRRNTGTAGGAGACTRCGTTAGCGGRRRRRRRAGTAGAGGAACAAGGGATCATCGCTTGRAGTTTANNNNNNR  rrs-10.fa
16504156  NTTGTNNRRRTNGTAGGAGACTRCGTTAGCGGRRRRRRRAGTAGAGGAACAAGGNNNNNNNNNNNNRNNNNNNNNNNNNR  rrs-7.fa
16504156  NNNNNNNRRRNTGTAGGAGNCTRCGTTAGCGGRRRRRRRAGTAGAGGAACAAGGGATCATCGCTNGRNNNNNNNNNNNNR  sha.fa
16504156  GTTGNNGRRRTTGTAGGAGACTRCGTTAGCGGRRRRRRRAGTAGAGGAACAAGGGATCATCGCNNNRNNNNNNNNNNNNR  tamm-2.fa
16504156  NTTGTTGRRRNTGTAGGAGACTRCGTTAGCGGRRRRRRRAGTAGAGNAACAAGGGATCATCGCTTGRAGTTTAAGNNNNR  ts-1.fa
16504156  NTNNNNNRRRTTGTAGGAGACTRCGTTAGCGGRRRRRRRAGTAGAGGAACAAGGGATCATCGCTTGRAGTTTNNNNNNNR  tsu-1.fa
16504156  NNNNNNNRRRNNGTAGGAGACTRCGTTAGCGGRRRRRRRAGTAGAGGAACAAGGGATCATCGCTTGRANNTTNNNNNNNR  van-0.fa
 
16504236  AATTAATGAGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCAATTTGATCGATGACGCGCTTGTAGTCATCTT  chr1.fa
16504236  NRNNNNNGAGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTNNNRNNNNNTNNNNNTNNNNTTGTAGTCATCTT  bay-0.fa
16504236  NRNNNNNNNGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNTNN  bor-4.fa
16504236  NRNNNNNNAGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCAARTTGATCGATGACGCGCTTGTAGTCATCTT  br-0.fa
16504236  NRNNNNNGAGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCAARNNNNNTNNNNNNNNGCTTGTAGTCATCTT  bur-0.fa
16504236  NRNNNNNNNGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCAARTTGATCGATGACGCGCTTGTAGTCATCTT  c24.fa
16504236  NRNNNNNGAGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCAARTTGATCGATGACGCGCTTGTAGTCATCTT  col-0.fa
16504236  NRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
16504236  NRNNNNNGAGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCNNRNNGNTTGATGACGCGCTTGTAGTCATCTT  est-1.fa
16504236  NRNNNNNNNGCTTCTCGTGTATCATNGTTAATGAGGAACACGTCCTTNNNRNNNNNTNNNNNNNNNNNNNTAGTCATCTT  fei-0.fa
16504236  NRNNNNNNNGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCAARTTGATCGATGACGNNNCNNNNNNNNNNTT  got-7.fa
16504236  NRNNNNNNAGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCAARTTGATCGATGACGCGCTTGTAGTCATCTT  ler-1.fa
16504236  NRNNNNNNNGCTTCTCGTGTATCNTAGTTAATGAGGAACACGTCCTTCAARTTNATCGNNNNANNNNNNNTAGTCATCTT  lov-5.fa
16504236  NRNNNNNNAGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCNNRNNNNNTNNNNNNNNNNTTGTAGTCANNNN  nfa-8.fa
16504236  NRNNNNNGAGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCAARTTGATCGATGACGNNNCNNNNGTCATCTT  rrs-10.fa
16504236  NRNNNNNNAGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCNNRNNNNTTGATGACGCGCTTGTAGTCATCTT  rrs-7.fa
16504236  NRNNNNNNNGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCAARTTGATCGATGACGCGCTTGTAGTCATCTT  sha.fa
16504236  NRNNNNNGAGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCNNRNNNNNTGATGACGCGCTTGTAGTCATCTT  tamm-2.fa
16504236  NRNNNNNNAGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCAARTTGATCGATGACGCGCTTGTAGTCATCTT  ts-1.fa
16504236  NRNNNNNGAGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCANRNNGNNTGNNGNCGCGCTTGTAGTCATCTT  tsu-1.fa
16504236  NRNNNNNNAGCTTCTCGTGTATCATAGTTAATGAGGAACACGTCCTTCAARTTGATCGATGACGCGCTTGTAGTCATCTT  van-0.fa
 
16504316  TGAGAGACCGCCTAGTATGTACTCGATTTGATCTTCATGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCAAAACTAG  chr1.fa
16504316  TGAGAGACCGCCTAGTATGTNCRCGRRRRRNNNNNRNTGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCAAAACRAG  bay-0.fa
16504316  TGAGAGACCGCCNAGTATGTACRCGRRRRRNTCTTRATGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCAAAACRAG  bor-4.fa
16504316  TGAGAGACCGCCTAGTATGTACRCGRRRRRATCTTRATGTGGGATGGCGTCATAAATTAGTGCCAGTTGATCAAAACRAG  br-0.fa
16504316  TGAGAGACCGCCNAGTATGTNCRCGRRRRRATCTTRATGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCAAAACRNG  bur-0.fa
16504316  TGAGAGACCGCCTAGTATGTNCRCGRRRRRNNCTNRATGTGGGNNNNNNTNNNAAATTAGTGCCAGTTGATCAAAACRAG  c24.fa
16504316  TGAGAGACCGCCTAGTATGTACRCGRRRRRNTCTTRATGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCAAAACRAG  col-0.fa
16504316  NNNNNNNNNNNNNNNNNNNNNNRNNRRRRRNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNN  cvi-0.fa
16504316  TGAGAGACCGCCTAGTATGTACRCGRRRRRATCTTRATGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCAAAACRAG  est-1.fa
16504316  TGAGAGACCGCCTAGTATGNNCRNNRRRRRNNCNNRNNGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCAANNNRNN  fei-0.fa
16504316  TGAGAGACCGCCTAGTATGTACRNNRRRRRANCTNRNTGTGGGATGGCGCCATAAATNNNNNNNNNNNNNNNNNNNNRAG  got-7.fa
16504316  TGAGAGACCGCCTAGTNNNNNGRNNRRRRRNNNNNRATGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCAAAACRAG  ler-1.fa
16504316  TGAGAGACCGCCNAGTATGTACRCGRRRRRANCTNRATGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCNANNCRAG  lov-5.fa
16504316  NNNNNNNNNNNNNNNNATGNNCRCGRRRRRATCTTRATGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCAAANCRNG  nfa-8.fa
16504316  TGAGAGACCGCCTAGTATGTACRCGRRRRRATCTTRATGTGGGATGGCGCCATAAATTNNNNNNNNNNNNNNNNNNCRAG  rrs-10.fa
16504316  TGAGAGACCGCCTAGTATGTACRCGRRRRRATCTTRATGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCAAAACRAG  rrs-7.fa
16504316  TGAGAGACCGCCTAGTATGNNCRCNRRRRRNNNNNRATGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCAANNNRAG  sha.fa
16504316  TGAGAGACCGCCTAGTATGTACRCGRRRRRATCTTRATGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCAAAACRAG  tamm-2.fa
16504316  TGAGAGACCGCCTAGTATGTACRCGRRRRRATCTTRATGTGGGATGGCGTCATAAATTAGTGCCAGTTGATCAAAACRAG  ts-1.fa
16504316  TGAGAGACCGCCTAGTATGTACRCGRRRRRATCTTRATGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCAAAACRAG  tsu-1.fa
16504316  TGAGAGACCGCCNAGTATGTACRCGRRRRRATCTTRATGTGGGATGGCGCCATAAATTAGTGCCAGTTGATCAAAACRAG  van-0.fa
 
16504396  TAGTGAGGCCTAGAACATATTCATCAATGGAACTAGATCATTTCTTCCATTGTTTGATTTGTTCACGGATCTGTTGCTTG  chr1.fa
16504396  TAGTGAGGCCTAGAACANATTCATCAATGGANNNNNNNCATTTCTTCNNTRRRRRRRRRRRRRRRRRRRRRRRRRNNTTG  bay-0.fa
16504396  TAGTGAGGCCTAGAACATATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRGCTTG  bor-4.fa
16504396  TAGTGAGGCCTAGAACATATTCATCAATGGAACTAGATCATTTCTTCNNNRRRRRRRRRRRRRRRRRRRRRRRRRGCTTG  br-0.fa
16504396  TAGTGAGGCCTAGAACATATTCATCAATGGAACTAGATCATTTCTTCCATRRRRRRRRRRRRRRRRRRRRRRRRRGCTTG  bur-0.fa
16504396  TAGTGAGGCCTAGAACATATTCATCNNNNNANNNNNNTCATNNCNNCNNNRRRRRRRRRRRRRRRRRRRRRRRRRGCTTG  c24.fa
16504396  TAGTGAGGCCTAGAACATATTCATCAATGGAACTAGATCATTTCTTCNNNRRRRRRRRRRRRRRRRRRRRRRRRRGCTTG  col-0.fa
16504396  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRNNNNN  cvi-0.fa
16504396  TAGTGAGGCCTAGAACATATTCATCAATGGAACNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRGCNTA  est-1.fa
16504396  NAGTGAGGCCTAGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRGCNTG  fei-0.fa
16504396  TAGTGAGGCCTAGAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRGCTTG  got-7.fa
16504396  TAGTGAGGCCTAGAACATATTCATCANNNNNNNNNNNNNNTNNCTTCNNTRRRRRRRRRRRRRRRRRRRRRRRRRGCTTG  ler-1.fa
16504396  TAGTGAGGCCTAGAACATATTCATCANNNNNNNNNNNTNNNNNNNNCNNNRRRRRRRRRRRRRRRRRRRRRRRRRGCTTG  lov-5.fa
16504396  TAGTGAGGCCTAGAACATATTCATCNNNNNANNNNNNNNNNNNNNNNNNTRRRRRRRRRRRRRRRRRRRRRRRRRGCTTG  nfa-8.fa
16504396  TAGTGAGGCCTAGAACATATTCNTCAATGGNACTNNNNNNNTTCTTCNNNRRRRRRRRRRRRRRRRRRRRRRRRRGCTTG  rrs-10.fa
16504396  TAGTGAGGCCTAGAACATATTCATCNATGGAACTAGATCATTTCTTCNNNRRRRRRRRRRRRRRRRRRRRRRRRRNCNNA  rrs-7.fa
16504396  NAGTGAGGCCTAGAACATNTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRGCNTG  sha.fa
16504396  TAGTGAGGCCTAGAACATANNNNNNNNNNNNNNNNNNNNNNTTCTTCNNNRRRRRRRRRRRRRRRRRRRRRRRRRGCTTG  tamm-2.fa
16504396  TAGTGAGGCCTAGAACATATTCATCAATGGAACTNGNNCNTTTCTTCNNNRRRRRRRRRRRRRRRRRRRRRRRRRGCTTG  ts-1.fa
16504396  TAGTGAGGCCTAGAACATATTCATCNATNGNNCNAGATCATTTCTTCNNNRRRRRRRRRRRRRRRRRRRRRRRRRGCTTG  tsu-1.fa
16504396  TAGTGAGGCCTAGAACATATTCATCANNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRGCTTG  van-0.fa
 
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGATTTTACGCCATATCTGGACAGAGGTGGTAGCTTGGAACAAGAGAGG  chr1.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAANNARNNNNNNTNNNNNNNNNRNNNAGGTGGTNNNRNNNGNNNNNNNARR  bay-0.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGARNNNNNNTNNNNNNNGNRCAGAGGTGGTANNRNNNGNNNNNNGARR  bor-4.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGARTTTACGCCATATCTGGRCAGAGGTGGTAGCRNNGGNNNAGAGARR  br-0.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGARTTNACGTNNNNTCNGGRCAGAGGTGGTNNNRNNNGNNNAGAGARR  bur-0.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGARTTTACGCCATATCTGGRCAGAGGTGGTNNNRNNNGNNNNNNGNRR  c24.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGARTTTACGCCATATCTGGRCAGAGGTGGTAGCRTGGRACAAGAGARR  col-0.fa
16504476  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNRNNNRNNNNNNNNRR  cvi-0.fa
16504476  NNNNNNNNNCTAGGGTTGGCATAAGTGTCAACGARNNNACGTNNNNNNNNNRCAGAGGTGGTAGNRNNGGNNNAGAGARR  est-1.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAANNNRNNNNNNTNNNNNNNNNRNNGAGGTGGTNNNRNNNGNNNNNNGNRR  fei-0.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGARTTTACGCCATATCTGGRCAGAGGTGGTANNRNNNGNNNNNNGARR  got-7.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGARTTTACGCCATATCTGGRCAGAGGTGGTAGCRNNGGNNNAGAGARR  ler-1.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGARTTTACGCCATATCTGGRCAGAGGTGGTNNNRNNNGANNAGNGARR  lov-5.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGNRNNNACGTNNNNTCNNNRCNGAGGTGGTNNNRNNNGNNNNNNGARR  nfa-8.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGARTTTACGCCATATCTGGRCAGAGGTGGTAGCRTGGGANNNNAGARR  rrs-10.fa
16504476  NNNNNNNNNCTAGGGTTGGCATAAGTGTCAACGARNNNACGTCATATCNGGRCAGAGGTGGTAGCRTGGGNNNAGAGARR  rrs-7.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGARTTTACGCCATATCTGGRCAGAGGTGGTNNNRNNNGNNNNNNNNRR  sha.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGARNTNACGTNNNNTCNGNRCAGAGGTGGTAGCRNNGGNNNAGAGARR  tamm-2.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGARTTTACGCCATATCTGGRCAGAGGTGGTNNNRNNNGNNNNNAGARR  ts-1.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGARNNNACGTNNNNTCNGGRCAGAGGTGGTAGCRNGGGANNAGAGARR  tsu-1.fa
16504476  TGTCCACAGCTAGGGTTGGCATAAGTGTCAACGARTTTACGCCATATCTGGRCAGAGGTGGTNGCRNGGGNNNAGAGARR  van-0.fa
 
16504556  TTGAACCGCAACAGAGATAGCACCGATGAGGCTACAGTAAATGAGTTTATCCTGGCACTTCCAGAGTTTGTAGTCCGGAT  chr1.fa
16504556  RRRRRRRRRRRRRRRRRRRRCANCGATNNNNNRNGNNNNNNNNNNRNNNNNNNNNNGRNNNCAGAGTTTGNNRNNRGGAT  bay-0.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGANNNRNGNNNNNNNNNNRNNNTCCTGGNGRTTCCAGAGTTTGTARTCRGGAT  bor-4.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGANNCRNGNNNNNNNNNNRTTATCCTGGCRRTTCCAGAGTTTGTARTCRGGAT  br-0.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGANNNRNGNNNNNNNNNGRTTNTCCTGGCRRTTCCAGAGNTNNNNRNNRNNNN  bur-0.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGANNNRNGNNNNNNNNNNRNNATCCTGGCRRTTCCAGAGTTTGNARTCRGGAT  c24.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGAGGCRARAGTAAATGAGRTTATCCTGGCRRTTCCAGAGTTTGTARTCRGGAT  col-0.fa
16504556  RRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNRNRNNNNNNNNNNRNNNNNNNNNNRRNNNNNNNNNNNNNNRNNRNNNN  cvi-0.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGANNNRNGNNNNNNNNNNRNNNTCCTNNCRRTTCCAGAGTTTGTARTNRGGAT  est-1.fa
16504556  RRRRRRRRRRRRRRRRRRRRNNNCGATNNNNNRNGNNNNNNNNNNRNNNNNNNNNNRRNNNNNNNNNTTGNNRNNRGNAT  fei-0.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGNNNNRNGNNNNNNNNNNRNNNTCNNNNNRRNNNCAGAGTTTGTARTCRGGAT  got-7.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGANNNRNGNNNNNNNNNNRNNNTCCTGNCGRTTCCAGAGTTTGTARTCRGGAT  ler-1.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGANNNRNGNNNNNNNNNNRNNATCCTGNCGRNTCCAGAGTTTGTARTCRGGAT  lov-5.fa
16504556  RRRRRRRRRRRRRRRRRRRRCANCGATNNNNNRNGNNNNNNNNNNRNNNTCCTNNNGRNNNCAGAGTTTGNARNCRGGAT  nfa-8.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGANNNRNGNNNNNNNNNNRTTATCCTGGCGRTTCCAGAGTTTGTARTCRGGAT  rrs-10.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGANGNRNGNNNNNNNNNNRNNNTCCTGGCGRTTCCAGAGTTTGTARTCRGGAT  rrs-7.fa
16504556  RRRRRRRRRRRRRRRRRRRRCANCGATGNNNNRNGNNNNNNNNNNRNNNNNNNNNNRRNNNCAGAGTTTGNARNCRGGAT  sha.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGANNNRNGNNNNNNNNNNRNNNTCCTNGCGRTTCCAGAGTTTGTARTCRGGAT  tamm-2.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGANNNRNGNNNNNNNNNNRTTATCCTGGCRRTTCCAGAGTTTGTARTCRGGAT  ts-1.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGANNNRNGNNNNNNNNNNRNNNTCCTGGCGRTTCCAGAGTTTGTARTCRGGAT  tsu-1.fa
16504556  RRRRRRRRRRRRRRRRRRRRCACCGATGANNNRNGNNNNNNNNNNRNNNTCCTNNCGRTTCCAGAGTTTGTARTCRGGAT  van-0.fa
 
16504636  TGGGAGAGGTAACGCCATGGACAGTGATTGTGGTGGCAGGTTCTTTGACCGAACCATCTACGTAGCCGACAAGGTCATAT  chr1.fa
16504636  TGGGAGAGRRRRRRRCATGGACNGTNATNGTGGTGNNNNNNNNNNNNNNNNNNNNNNCNACGTAGCCGACAAGGTCATAT  bay-0.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGCNNNNNNNNNNNNNNNNNNATCTACGTAGCCGACAAGGTCATAT  bor-4.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGCNGNNNNNNNNNNNNNNNCATCTACGTAGCCGACAAGGTCATAT  br-0.fa
16504636  NNNGANNGRRRRRRRCATGGACAGTGATTGTGGTGGNNNNNNNNNNNNNNNNNNCATCTACGTAGCCGACAAGGTCATAT  bur-0.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGNNNNNNNNNNNNNNNNNNNNTCTACGTAGCCGACAAGGTCATAT  c24.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGCNGGTTCTTTGACCGAACCATCTACGTAGCCGACAAGGTCATAT  col-0.fa
16504636  NNNNNNNNRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGCNNNNNNNNNNNNNNNNNCATCTACGTAGCCGACAAGGTCATAT  est-1.fa
16504636  TGGGAGAGRRRRRRRCANGGACAGTGATTGTGGTGGNNNNNNNNNNNNNNNNNNNNNNTACGTAGCCGACAAGGTCATAT  fei-0.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGNNNNNNNNNNNNNNNNNNNNTCTACGTAGCCGACAAGGTCATAT  got-7.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGCNNNNNNNNNNNNNNNNNNATCTACGTAGCCNANNNANNNATAT  ler-1.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGNNNNNNNNNNNNNNNNNNCATCTACGTAGCCGACAAGGTCATAT  lov-5.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGCNNNNNNNNNNNNNNNNNNATCTACGTAGCCGACAAGGTCATAT  nfa-8.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGCNNNNNNNNNNNNNNNNNNNTCTACGTAGCCGACAAGGTCATAT  rrs-10.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGCNNNNNNNNNNNNNNNNNNNTCTACGTAGCCGACAAGGTCATAT  rrs-7.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGNNNNNNNNNNNNNNNNNNNNNCTACGTAGCCGACAAGGTCATAT  sha.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGNNNNNNNNNNNNNNNNNNNATCTACGTAGCCGACAAGGTCATAT  tamm-2.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGNNNNNNNNNNNNNNNNNNNNNNNTCTACGTAGCCGACAAGGTCATAT  ts-1.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGCNNNNNNNNNNNNNNNNNNATCTACGTAGCCGACAAGGTCATAT  tsu-1.fa
16504636  TGGGAGAGRRRRRRRCATGGACAGTGATTGTGGTGGCNNNNNNNNNNNNNNNNNCATCTACGTAGCCGACAAGGTCATAT  van-0.fa
 
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTTGTTGTTGTCAGCTTTGTGACATAGGACATGTTCAC  chr1.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTNNNRRRRRRRRNNTTTGNRRRRRRRRRRRRRRRRRR  bay-0.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTNNNRRRRRRRRNNNNNNNRRRRRRRRRRRRRRRRRR  bor-4.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTNGNRRRRRRRRGCTTTGTRRRRRRRRRRRRRRRRRR  br-0.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCNNNTNNNAAANTTNGNRRRRRRRRGCTTTGTRRRRRRRRRRRRRRRRRR  bur-0.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTNNNRRRRRRRRGCTTTGNRRRRRRRRRRRRRRRRRR  c24.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTNGNRRRRRRRRGCTTTGTRRRRRRRRRRRRRRRRRR  col-0.fa
16504716  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRNNNNNNNRRRRRRRRRRRRRRRRRR  cvi-0.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTTGTRRRRRRRRGCTTTGTRRRRRRRRRRRRRRRRRR  est-1.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTNNNRRRRRRRRNNNTNNNRRRRRRRRRRRRRRRRRR  fei-0.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTNGNRRRRRRRRGCTTTGTRRRRRRRRRRRRRRRRRR  got-7.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTNGNRRRRRRRRGCTTTGTRRRRRRRRRRRRRRRRRR  ler-1.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAANNNNNNRRRRRRRRNNNTNNNRRRRRRRRRRRRRRRRRR  lov-5.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTNNNRRRRRRRRGCTTTGTRRRRRRRRRRRRRRRRRR  nfa-8.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTTGTRRRRRRRRGCTTTGTRRRRRRRRRRRRRRRRRR  rrs-10.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTTGTRRRRRRRRGCTTTGTRRRRRRRRRRRRRRRRRR  rrs-7.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTNNNNRRRRRRRRNNNNNNNRRRRRRRRRRRRRRRRRR  sha.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTNGTRRRRRRRRGCTTTGTRRRRRRRRRRRRRRRRRR  tamm-2.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTTGNRRRRRRRRGCTTTGTRRRRRRRRRRRRRRRRRR  ts-1.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTTGTRRRRRRRRGCTTTGTRRRRRRRRRRRRRRRRRR  tsu-1.fa
16504716  GCACCCAATAGAGCATGAACTTGAAGATGCCACAGGAGAAAGTTNGNRRRRRRRRGCTTTGTRRRRRRRRRRRRRRRRRR  van-0.fa
 
16504796  ATTGAGGAGAGAGGTGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGATATGATGACGCTTGAAGAA  chr1.fa
16504796  RRRRRRRRRNGNGGTGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGARNTGATGACGCTTGANNNR  bay-0.fa
16504796  RRRRRRRRRAGAGGTGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGARATGATGACGCTTGANNNR  bor-4.fa
16504796  RRRRRRRRRAGNGGTGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGARATGATGACGCTTGAAGAR  br-0.fa
16504796  RRRRRRRRRAGNGGTGGAATCGATGACGGCAACAATNNTNNNNNNNNNNGACATAGCCGGARATGATGACGCTTGANNNR  bur-0.fa
16504796  RRRRRRRRRANNGGTGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGARATGATGACGCTTGANNNR  c24.fa
16504796  RRRRRRRRRAGAGGTGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGARATGATGACGCTTGAAGNR  col-0.fa
16504796  RRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNR  cvi-0.fa
16504796  RRRRRRRRRAGNGGTGGAATCGATGACGACAACAATTTCTGTGGAGAAAGACATAGCCGGARATGATGACGCTTGAAGAR  est-1.fa
16504796  RRRRRRRRRNNNGGTGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGARATGATGACGCTTNNNNNR  fei-0.fa
16504796  RRRRRRRRRANAGGTGGAATCGATGACGNNNNNNGNNNNNNNNNNNAAAGACATAGCCGGARATGATGACGCTTGANNNR  got-7.fa
16504796  RRRRRRRRRNGAGGNGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGARATGATGACGCTTGANNNR  ler-1.fa
16504796  RRRRRRRRRANNGGNGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGARATGATGACGCTTGAANNR  lov-5.fa
16504796  RRRRRRRRRNNNGGTGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGARATGATGACGCTTGANNNR  nfa-8.fa
16504796  RRRRRRRRRAGAGGTGGAATCGATGACGGCAANNGNNNNNNNNNNGAAAGACATAGCCGGARATGATGACGCTTGAAGNR  rrs-10.fa
16504796  RRRRRRRRRAGAGGTGGAATCGATGACGACAACAATTTCTGTGGAGAAAGACATAGCCGGARATGATGACGCTTGAAGAR  rrs-7.fa
16504796  RRRRRRRRRNGNGGTGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGARATGATGACGCTTGANNNR  sha.fa
16504796  RRRRRRRRRAGNGGTGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGARATGATGACGCTTGAANNR  tamm-2.fa
16504796  RRRRRRRRRAGNGGTGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGARATGATGACGCTTGANNNR  ts-1.fa
16504796  RRRRRRRRRAGAGGTGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGARATGATGACGCTTGAAGAR  tsu-1.fa
16504796  RRRRRRRRRAGAGGTGGAATCGATGACGGCAACAATTTCTGTGGAGAAAGACATAGCCGGARNTGATNNNNNNNGANNNR  van-0.fa
 
16504876  CAAGCTTGTAGAGAAAGAAGGGGATCGAGAAGAAGAAGAGAGGTAGAAAAGAGAGGCGGCGTTTTTTGTTTTTAAAAATA  chr1.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNAGAAGNNNNNNNNNNNNNNNNAGAGGCGGCGTTTTTNNNNRNRNRNNNNN  bay-0.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNAGANNNNNNNNNNNNNNNNAGAGAGGCGGCGTTTTTTNNNRNRNRNNNNN  bor-4.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNAGAANNNNNNNNNNNGAAAAGAGAGGCGGCGNTTTTTNNNRNRNRNNNNN  br-0.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNAAAGAGAGGCGGCGTTTTTTNNNRNRNRNNNNN  bur-0.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNGAGAGGCGGCGTTTTTTNNNRNRNRNNNNN  c24.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRAGNAGAANNNNNNNNNNNNNAAAGAGAGGCGGCGTTTTTNNNNRNRNRNNNNN  col-0.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNRNNNNN  cvi-0.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNAGANNNNNNNNNNNNNNAAAGAGAGGCGGCGTTTTTNNNNRNRNRNNNNN  est-1.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNAGAGAGGCGGCGTTTTTNNNNRNRNRNNNNN  fei-0.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNAAGAGAGGCGGCGTTTTTTNNNRNRNRNNNNN  got-7.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNAGNNNNNNNNNNNNNNNNAAGAGAGGCGGCGTTTTTNGNNRNRNRNNNNN  ler-1.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNAGAGAGGCGGCGTTTTTTNNNRNRNRNNNNN  lov-5.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNAAAGAGAGGCGGCGTTTTTTNNNRNRNRNNNNN  nfa-8.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNAGANNNNNNNNNNNNNAAAAGAGAGGCGGCGTTTTTTGNTRNRNRNNNNN  rrs-10.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNAGANNNNNNNNNNNNNNAAAGAGAGGCGGCGTTTTTTNNNRNRNRNNNNN  rrs-7.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNAGAGAGGCGGCGTTTTTTNNNRNRNRNNNNN  sha.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNAGANNNNNNNNNNNNNNNNAGAGAGGCGGCGTTTTTTNNTRNRNRNNNNN  tamm-2.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNAGNNNNNNNNNNNNNNNNAAGAGAGGCGGCGTTTTTTNNNRNRNRNNNNN  ts-1.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNNGNNNNNNNNNNNNNNNNAAGAGAGGCGGCGTTTTTTNNNRNRNRNNNNN  tsu-1.fa
16504876  NNRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNGAGAGGCGGCGTTTTTNNNNRNRNRNNNNN  van-0.fa
 
16504956  TTTAGGTCTATATAGAATCACTGCTCTGATACCATGTAATCTGAGAGTGAATTGTCTTATTATGATGAATGTGTTACAAC  chr1.fa
16504956  NNNNNNNNNNNNNNNNNTCNCTRRRRRRANACCATGNAATCTGAGNGTRANNRRRRRRRRRRRRRRRRRRRRRRRRRRRR  bay-0.fa
16504956  NNNNNNNNNNNNNNGAATCNCTRRRRRRATACCATGTAATCTGAGANNRNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRR  bor-4.fa
16504956  NNNNNNNNNNNNTAGAATCACTRRRRRRATACCATGTAATCTGAGAGTRNATRRRRRRRRRRRRRRRRRRRRRRRRRRRR  br-0.fa
16504956  NNNNNNNNNNNNNAGAATCACTRRRRRRATACCATGTAATCTGAGNGTRANTRRRRRRRRRRRRRRRRRRRRRRRRRRRR  bur-0.fa
16504956  NNNNNNNNNNNNNNNNATCNCTRRRRRRATNCCNTGNAATCTGAGNGNRNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRR  c24.fa
16504956  NNNNNNNNNNNNNNGAATCACTRRRRRRATACCATGTAATCTGAGAGTRAATRRRRRRRRRRRRRRRRRRRRRRRRRRRR  col-0.fa
16504956  NNNNNNNNNNNNNNNNNNNNNNRRRRRRNNNNNNNNNNNNNNNNNNNNRNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRR  cvi-0.fa
16504956  NNNNNNNNNNNNNAGAATCACTRRRRRRATACCATGTAATCTGAGNGTRNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRR  est-1.fa
16504956  NNNNNNNNNNNNNNNNNNNNNNRRRRRRNNNNNNNNNNNTCTGAGNNNRNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRR  fei-0.fa
16504956  NNNNNNNNNNNNNNNNNNCNNTRRRRRRANACCATNTAATCTGAGNNNRNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRR  got-7.fa
16504956  NNNNNNNNNNNNNNGAATCNCTRRRRRRATACCATGTAATCTGAGNGTRNNTRRRRRRRRRRRRRRRRRRRRRRRRRRRR  ler-1.fa
16504956  NNNNNNNNNNNNNNNNNTNNCTRRRRRRATACCATGTAATCTGAGNNNRNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRR  lov-5.fa
16504956  NNNNNNNNNNNNNNNNATCNCTRRRRRRATNCCATGTAATCTGAGNNNRNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRR  nfa-8.fa
16504956  NNNNNNNNNNNNNNNAATCACTRRRRRRATACCATGTAATCTGAGAGTRNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRR  rrs-10.fa
16504956  NNNNNNNNNNNNNNGAATCACTRRRRRRATACCATGTAATCTGAGAGTRAATRRRRRRRRRRRRRRRRRRRRRRRRRRRR  rrs-7.fa
16504956  NNNNNNNNNNNNNNNNATCNCTRRRRRRNTNCCATGTANNNNNAGNNNRNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRR  sha.fa
16504956  NNNNNNNNNNNNNNNAATCACTRRRRRRATACCATGTAATCTGAGAGTRANTRRRRRRRRRRRRRRRRRRRRRRRRRRRR  tamm-2.fa
16504956  NNNNNNNNNNNNNNGAATCACTRRRRRRATACCATGTAATCTGAGNGNRAANRRRRRRRRRRRRRRRRRRRRRRRRRRRR  ts-1.fa
16504956  NNNNNNNNNNNNNAGAATCACTRRRRRRATACCATGTAATCTGAGAGNRNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRR  tsu-1.fa
16504956  NNNNNNNNNNNNNAGAATCNCTRRRRRRATACCATGTAATCTGAGNGTRNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRR  van-0.fa
 
16505036  ATATATAGTACTTAGTCTAGGGTTTACACAACTACTAATGACAATTATATCCTTAATATATACAACTTCTTATATTCCAA  chr1.fa
16505036  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCTTCTTANATTCCNN  bay-0.fa
16505036  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNN  bor-4.fa
16505036  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNATATTCCNA  br-0.fa
16505036  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNATATTCCAA  bur-0.fa
16505036  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNN  c24.fa
16505036  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNTATTNNNN  col-0.fa
16505036  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNN  cvi-0.fa
16505036  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNN  est-1.fa
16505036  RRR