Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 23519 - 31079


<
Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
23519  ATGGTAATGGAGGATGAGCCTAGAGAAGCCACAATAAAGCCTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  chr1.fa
23519  ATGGTAATGGAGGATGAGCCTAGAGAAGCCACAATAAAGCCTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  bay-0.fa
23519  NNNNNAATGGAGGATGAGCCTAGAGAAGCCACAATAAANNNNNNNTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  bor-4.fa
23519  NNNNTNATGGAGGATGAGCCTAGAGAAGCCACAATAAANNNNTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  br-0.fa
23519  ATGGTAATGGAGGATGAGCCTAGAGAAGCCACAATAAAGCCTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  bur-0.fa
23519  NNNGTAATGGAGGATGAGCCTAGAGAAGCCACAATAAAGCCTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  c24.fa
23519  NNNGTAATGGAGGATGAGCCTAGAGAAGCCACAANAANGCNTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  col-0.fa
23519  NNNGTAATGGAGGATGAGCCTAGAGAAGCCACAATAAAGCCTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  cvi-0.fa
23519  NNNNTAATGGAGGATGAGCCTAGAGAAGCCACAATAAAGCCTTCNTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  est-1.fa
23519  NNGGTAATGGAGGATGAGCCTAGAGAAGCCACAATAAAGCCTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  fei-0.fa
23519  NNNNNNNNGGAGGATGAGCCTAGAGAAGCCACAANNNNNNNNNNNNNNTGGCTAGATGCTTGCGAGGACATCTCTTGTNA  got-7.fa
23519  NNNNNNNTGGAGGATGAGCCTAGAGAAGCCACAATNNNNNNNNNNNNNNNGCTAGATGCTTGCGAGGACATCTCTTGTGA  ler-1.fa
23519  NNNNNNATGGAGGATGAGCCTAGAGAAGCCACAATNNNNNNNNNNNNTTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  lov-5.fa
23519  NNNGTAATGGAGGATGAGCCTAGAGAAGCCACAATAAANNNNNNNNATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  nfa-8.fa
23519  NNNNNNNNGGAGGATGAGCCTAGAGAAGCCACAATNNNNNNNNNNNATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  rrs-10.fa
23519  NNNGTAATGGAGGATGAGCCTAGAGAAGCCACAATAAANNNNNNTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  rrs-7.fa
23519  NNNNTAATGGAGGATGAGCCTAGAGAAGCCACAATAAAGCCTNNNNATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  sha.fa
23519  NNNNNAATGGAGGATGAGCCTAGAGAAGCCACAATAAANNNNNNNNNTTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  tamm-2.fa
23519  NNNNNAATGGAGGATGAGCCTAGAGAAGCCACAATNNNNNNNNNNNATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  ts-1.fa
23519  NNNNNNATGGAGGATGAGCCTAGAGAAGCCACNNNNNNNNNNNNNNNNTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  tsu-1.fa
23519  NNNNTAATGGAGGATGAGCCTAGAGAAGCCACAATAAAGCCTTCTTATTGGCTAGATGCTTGCGAGGACATCTCTTGTGA  van-0.fa
 
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  chr1.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCNTCA  bay-0.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGNTCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  bor-4.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  br-0.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  bur-0.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  c24.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  col-0.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  cvi-0.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  est-1.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  fei-0.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGNTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  got-7.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  ler-1.fa
23599  TCTTNTCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCNTCA  lov-5.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  nfa-8.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  rrs-10.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  rrs-7.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  sha.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  tamm-2.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  ts-1.fa
23599  TCTTNTCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  tsu-1.fa
23599  TCTTATCGATGATCTCGTGTCTGAATTTGATCCTTCCTCTGTTGCTGTCAATGAATCCACTGATGAAAACGGCGTCATCA  van-0.fa
 
23679  ATGATTTTTTCGGTGGGATTGATCACATTTTAGATAGTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  chr1.fa
23679  ATGATTTTTTCNNNNNGATTGATCACATTTTAGATAGTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  bay-0.fa
23679  ATGATTTTTTCGGTGGGATTGATCACATTNNNNNNNNNATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  bor-4.fa
23679  ATGATTTTTTCGGTGGGATTGATCACATTTTNNNNNNNANCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  br-0.fa
23679  ATGATTTTTTCGGTGGGATTGATCACATTTTAGATAGTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  bur-0.fa
23679  ATGATTTTTTCGGTGGGATTGATCACATTTTAGATAGTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  c24.fa
23679  ATGATTTTTTCGGTGGGATTGATCACATTNTNNNNNNNATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  col-0.fa
23679  ATGATTTTTTCGGTGGGATTGATCACATTTTAGATAGTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  cvi-0.fa
23679  ATGATTTTTTCGGTGGGATTGATCACATTTNNNNNNNNNTCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  est-1.fa
23679  ATGATTTTTTCGGTGGGATTGATCACATTTTAGATAGTATCAAGAACGGTGGAGGCTTNCCAAACAATGGCGTTTCTGAT  fei-0.fa
23679  ATGATTTTTTCGGTGGGATTGATNNNNNNNNNNNNNNNNTCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  got-7.fa
23679  ATGATTTTTTCGGTGGGATTGATCACNNNNNNNNNNNNNTCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  ler-1.fa
23679  ATGATTTTTTCGGTGGGATTGATNNNNNNNNNNNNNNNNNNNNGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  lov-5.fa
23679  ATGATTTTTTCGGTGGGATTGATCACATTTTAGATAGTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  nfa-8.fa
23679  ATGATTTTTTCGGTGGGATTGATCACATTTNNNNNNNNNTCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  rrs-10.fa
23679  ATGATTTTTTCGGTGGGATTGATCACATTTNNNNNNNTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  rrs-7.fa
23679  ATGATTTTTTCGGTGGGATTGATCACATTTTAGATAGTATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  sha.fa
23679  ATGATTTTTTCGGTGGGATTGATCACATTTTNNNNNNNATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  tamm-2.fa
23679  ATGATTTTTTCGGTGGGATTGATCACANNNNNNNNNNNNNNAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  ts-1.fa
23679  NTGATTTTTTCGGTGGGATTGATNNNNNNNNNNNNNNNNNNAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  tsu-1.fa
23679  ATGATTTTTTCGGTGGGATTGATCACANTTNNNNNNNNATCAAGAACGGTGGAGGCTTACCAAACAATGGCGTTTCTGAT  van-0.fa
 
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAA  chr1.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAA  bay-0.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGNAGGAGAATGGGTTGCAAAA  bor-4.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGANNNNNAAGGAGAATGGGTTGCAAAA  br-0.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAA  bur-0.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAA  c24.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGNAGGAGAATGGGTTGCAAAA  col-0.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAA  cvi-0.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAA  est-1.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACNGTGAAGGAGAATGGGTTGCAAAA  fei-0.fa
23759  ANNNNNNNTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACNGTGAAGGAGAATGGGTTGCAAAA  got-7.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACNNNNAAGGAGAATGGGTTGCAAAA  ler-1.fa
23759  ACCAATTCNCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACNGTGAAGGAGAATGGGTTGCAAAA  lov-5.fa
23759  ACCAATTCTCAAATCAACGAGNTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAA  nfa-8.fa
23759  ACNNNNNNTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAA  rrs-10.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAA  rrs-7.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGANGGAGAATGGGNNNNNNNT  sha.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGNNNNNNNNNT  tamm-2.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACNNNNNAGGAGAATGGGTTGCAAAA  ts-1.fa
23759  ACNNNNNNTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGNNNNNNNNGGAGAATGGNTTGCAAAA  tsu-1.fa
23759  ACCAATTCTCAAATCAACGAGGTTACTGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAA  van-0.fa
 
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  chr1.fa
23839  GAATGGCGGTAAGAGAGACGAANNNNCGAAAGAGGAAGNAGACAAGGATAGGAANAGAGCTAGGGTTTGTAGTTATCAGA  bay-0.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  bor-4.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  br-0.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  bur-0.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  c24.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  col-0.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  cvi-0.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  est-1.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  fei-0.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATNNNN  got-7.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAANGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  ler-1.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGNNNNNNGGATNGNNANAGAGCTAGGGTTTGTAGTTATCAGA  lov-5.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  nfa-8.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGNTANNNNN  rrs-10.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  rrs-7.fa
23839  NAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  sha.fa
23839  NNNNGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  tamm-2.fa
23839  GAATGGCGGTAAGAGAGACGAATTCNCGAAAGAGGAAGNNNNNNNNGATAGGAAGAGAGCNAGGGTTTGTAGTTNTCAGA  ts-1.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGN  tsu-1.fa
23839  GAATGGCGGTAAGAGAGACGAATTCTCGAAAGAGGAAGGAGACAAGGATAGGAAGAGAGCTAGGGTTTGTAGTTATCAGA  van-0.fa
 
23919  GTGAAAGGAGTAACCTTTCAGGTAGAGGGCATGTTAATAATTCTAGGGAGGGAGATAGGTTTATGAATAGGAAACGTACT  chr1.fa
23919  GTGAAAGGNNNNNNNTTTCAGGTAGAGGGCATGTTAATAATTCTAGGGAGGGAGATAGGTTTATGAATAGGAAACGTACT  bay-0.fa
23919  GTGAAAGNNNNNNNNNTTCAGGTAGAGGGCATGTTAATAANNNNNNNNNNNGAGATAGGNNNNTGAATAGGAAACGTACT  bor-4.fa
23919  GTGAANNNNNNNNNNNTTCAGGTAGAGGGCATGTTAATANNNNNNNNNNNNGNGNNNNNNNNATGAATAGGAAACGTACT  br-0.fa
23919  GTGAAAGGNNNNNNCTTTCAGGTAGAGGGCATGTTAATAATTCTAGGGAGGGAGATAGGTTTATGAATAGGAAACGTACT  bur-0.fa
23919  GTGAAAGGNNNNNNNNTTCAGGTAGAGGGCATGTTAATAATTCTAGGGAGGGAGATAGGTTTATGAATAGGAAACGTACT  c24.fa
23919  GTGAAAGNNNNNNNNNNTCAGGTAGAGGGCATGTTAATAATTNTANNNNNNNAGATNGNNNNNNNAATAGGAAACGTACT  col-0.fa
23919  GTGAAAGGNNNNNNCTTTCAGGTAGAGGGCATGTTAATAATTCTAGGGAGGGAGATAGGTTTATGAATAGGAAACGTACT  cvi-0.fa
23919  GTGAAANNNNNNNNNTTTCAGGTAGAGGGCATGTTAATNNNNNNNNNNNNNGAGATAGGTNTATGAATAGGAAACGTACT  est-1.fa
23919  GTGAAAGNNNNNNNCTTTCAGGTAGAGGGCATGTTAATAATTCTAGGGNGGGAGATNGGTTTATGAATAGGAAACGTACT  fei-0.fa
23919  NNNNNNNNNNNNNNNNNNCAGGTAGAGGGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNACGTACT  got-7.fa
23919  GTGANNNNNNNNNNNNNNCAGGTAGAGGGCATGTTAANNNNNNTAGGGAGGGAGATNNNNNNNNNAATAGGAAACGTACT  ler-1.fa
23919  GNNNNNNNNNNNNNNNNNCAGGTAGAGGGCATGTTAANNNNNNNNNNNNNNNNGATAGGTNNNNGAATAGGAAACGTACT  lov-5.fa
23919  GTGAAANNNNNNNNNNTTCAGGTAGAGGGCATGTTAATAATTCTAGGGAGGGAGATAGGTTTATGAATAGGAAACGTACT  nfa-8.fa
23919  NNNNNNNNNNNNNNNNNNNNNNNNNNGGGCANGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAGGAAACGTACT  rrs-10.fa
23919  GTGAAAGNNNNNNNNNNTCAGGTAGAGGGCATGTTAATAANTCTAGGNNNNNNNNNAGNNNNNNNAATAGGAANNNNNNT  rrs-7.fa
23919  GTGAAANNNNNNNNNNTTCAGGTAGAGGGCATGTTAATAATTCTAGGGAGGGAGATAGGTTTATGAATAGGAAACGTACT  sha.fa
23919  GNGAAAGGANNNNNNNNTCAGGTAGAGGGCATGTTAANNNNNNNNNNNNNNNNNNNNNNNNNNTGAATAGGAAACGTACT  tamm-2.fa
23919  GTGAAANNNNNNNNNNNNCAGGTAGAGGGCATGTTAATAATTNTAGGGAGNGAGATNGGTTTATGAATAGGAAACGTACT  ts-1.fa
23919  GNNNNNNNNNNNNNNNNTCAGGTAGAGGGCATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANAGGAAACGTACT  tsu-1.fa
23919  GTGAAAGGAGNNNNNNNTCAGGTAGAGGGCATGTTAANNNNNNNNNNNNNNGAGATAGGNNNNNGAATAGGAAACGTACT  van-0.fa
 
23999  CGTAATTGGGACGAGGCGGGTAACAATAAGAAGAAAAGGGAATGTAACAATTACAGAAGAGATGGTAGAGATAGAGAAGT  chr1.fa
23999  CGTAATTGGGACGAGGCGGGTAACAATAAGAAGAAAAGGGAATGTAACAATTACAGAAGAGATGGTNGAGATAGAGAAGT  bay-0.fa
23999  CGTAATTGGGACGAGGCGGGTAACAATAANNNNNNNNNNNNNNGTANNNNNNNNAGAAGAGNNNNNNNNNNNNNNNNNNN  bor-4.fa
23999  CGTAATTGGGACGAGGCGGGTAACANNNNNNNNNNNNNNNNNNGTAANAATTNCAGAAGAGNNNNNNNNNNNNNNNNNNN  br-0.fa
23999  CGTAATTGGGACGAGGCGGGTAACAANAAGAAGAAAAGGGAATGTAACAATTACAGAAGAGATGGTAGAGATAGAGNAGT  bur-0.fa
23999  CGTAATTGGGACGAGGCGGGTAACNANNANAAGAAAAGGGAATGTAACAATTACAGAAGAGATGGNNNNNANAGNGAAGT  c24.fa
23999  CGTAATTGGGACGAGGCGGGTAACAATAANNNNNNNNNNNNNNNNNNNNNNNNCAGAAGANATNNNNNNNNNNNNNNNNN  col-0.fa
23999  CGTAATTGGGACGAGGCGGGTAACAATAANNNNANNANGGAATGTAACAATTACAGAAGAGATNNNNNNNATNGNNNNNT  cvi-0.fa
23999  CGTAATTGGGACGAGGCGGGTAACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGAGATNNNNNNNNNNNNNNNNN  est-1.fa
23999  CGTAATTGGGACGAGGCGGGTAACAANAAGAAGAAAANGGAATGTAACAATTACAGAAGAGATGGTNGAGATAGNNNNNN  fei-0.fa
23999  CGTAATTGGGACGAGGCGGGTAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
23999  CGTAATTGGGACGAGGCGGGTAACANNNNNNNNNNNNNNNNNNNTANNNNNNNCAGAANNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
23999  CGTAATTGGGACGAGGCGGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNANNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
23999  CGTAATTGGGACGAGGCGGGTAACAATAANNNNANNNNNNNATGTAACAATTACAGAAGAGATNNNNNNNNNNNNNNNNN  nfa-8.fa
23999  CGTAATTGGGACGAGGCGGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGAAGANNNNNNNNNNNNNNNNNNNN  rrs-10.fa
23999  CGTAATTGGGACGAGGCGGGTAACAATAANANNNNNNNNNAATGTAACAATTACAGAAGAGATNNNNNNNNNNNNNNNNN  rrs-7.fa
23999  CGTAATTGGGACGAGGCGGGTAACAATAAGAANAAAAGGGAATGTAACAATTACAGAAGAGATNNNNNNNNNNNNNNNNN  sha.fa
23999  CGTAATTGGGACGAGGCGGGTAACAANNNNNNNNNNNNNNNNNGTAACAATNACAGAAGAGATNNNNNNNNNNNNNNNNN  tamm-2.fa
23999  CGTAATTGGGACGAGGCGGGTAACAANNNNNNNNNNNNGNNANGTAACAATTACAGAAGAGANNNNNNNNNNNNNNNNNN  ts-1.fa
23999  CGTAATTGGGACGAGGCGGGTAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
23999  CGTAATTGGGACGAGGCGGGTAACANNNNNNNNNNNNNNNNNNNNNANNNTNACAGAAGAGATNNNNNNNNNNNNNNNNN  van-0.fa
 
24079  TAGGGGTTATTGGGAGAGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGATCATGAAA  chr1.fa
24079  TAGGGNNNNTTGGGAGAGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTNGGAAGCTGANCATGAAA  bay-0.fa
24079  NNNNNNNTNTTNNNNNNNGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGATCATGAAA  bor-4.fa
24079  NNNNNNNNNTTNGGNGAGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGANCATGAAA  br-0.fa
24079  TAGGGGTTATTGGGAGAGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGATCATGAAA  bur-0.fa
24079  TAGGGGTTATTGGGAGAGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGANCATGAAA  c24.fa
24079  NNNNNNNNNNNGGGAGAGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGATCATGAAA  col-0.fa
24079  TNNNNNNNNTTGGGAGAGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGATCATGAAA  cvi-0.fa
24079  NNNNNNNNNNTGGGNGAGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGANCATGANN  est-1.fa
24079  NNNNNNNNNTTGGGNGAGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGANCATGAAA  fei-0.fa
24079  NNNNNNNNNNNNNNNNNNNGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGATCATGANN  got-7.fa
24079  NNNNNNNTATTGGGNGAGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGANCNNGNNN  ler-1.fa
24079  NNNNNNNNNNTGGGAGAGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTNNNNNNNNNNNNNNNNNNN  lov-5.fa
24079  NNNNNNNNNTTGGGAGAGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGANCATGAAA  nfa-8.fa
24079  NNNNNNNNNNNGGNNNNNNGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGATCATGANN  rrs-10.fa
24079  NNNNNNNNNNNNNNNNNGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGATCATGAAA  rrs-7.fa
24079  NNNNNNTTNTTGGGAGAGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGATCATGAAA  sha.fa
24079  NNNNNNNNNNNNNNNNNNGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGANCATGAAA  tamm-2.fa
24079  NNNNNNNNNNNNNNNNNNNGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGANCATGAAA  ts-1.fa
24079  NNNNNNNNNNNNNNNNNNNGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGANCATGNNN  tsu-1.fa
24079  NNNNNNNNATTNNNNNNGGGATAAAGTTGGTTCCAATGAGTTGGTTTATAGGTCAGGGACTTGGGAAGCTGANCATGAAA  van-0.fa
 
24159  GAGATGTTAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGT  chr1.fa
24159  GAGATGTNAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGANTAAGCCTGAAGAACGT  bay-0.fa
24159  NNNNNNNNAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGT  bor-4.fa
24159  GNNNNNNNAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGT  br-0.fa
24159  GAGATGTTAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGT  bur-0.fa
24159  GAGATGTNAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGT  c24.fa
24159  GAGNNNNNNNNAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGT  col-0.fa
24159  NNNNNGTTAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGT  cvi-0.fa
24159  NNNNNGTNAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGN  est-1.fa
24159  GAGATGTNAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGT  fei-0.fa
24159  NNNNNNNNNNNNAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGN  got-7.fa
24159  NNNNNGTNAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGANTAAGCCTGAAGAACGT  ler-1.fa
24159  NNNNNNNNAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGT  lov-5.fa
24159  GAGNNNNNAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGT  nfa-8.fa
24159  NNNNNNNNAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAANGT  rrs-10.fa
24159  GNGANGTNAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGT  rrs-7.fa
24159  GAGATGTNAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGANGAGAACAAGAGTAAGCCTGAAGAACGT  sha.fa
24159  NNNNNNNNAAGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGT  tamm-2.fa
24159  GAGANNNNNNGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGT  ts-1.fa
24159  NNNNNNNNNNGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGANNNN  tsu-1.fa
24159  NNNNNNNNNNGAAAGTGAGTGGTGGAAACCGCGAATGCGATGTCAAGGCAGAGGAGAACAAGAGTAAGCCTGAAGAACGT  van-0.fa
 
24239  AAAGAGAAGGTTGTGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  chr1.fa
24239  AAAGAGAAGNRTNNGGAAGAGCAANCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCNNNNNCGAAAAACACGATTGC  bay-0.fa
24239  AAAGAGAAGGRTGTGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  bor-4.fa
24239  AAAGAGAAGGRTGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  br-0.fa
24239  AAAGAGAAGGRTGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  bur-0.fa
24239  AAAGAGAAGGRTGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  c24.fa
24239  AAAGAGAAGGRTGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  col-0.fa
24239  AAAGAGAAGGRTNNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  cvi-0.fa
24239  AAAGAGAAGGRTGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  est-1.fa
24239  AAAGAGAAGGRNGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  fei-0.fa
24239  AAAGAGAANGRTGTGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  got-7.fa
24239  AAAGAGAAGGRTGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCNAAAGCGAAAAACACGATTGC  ler-1.fa
24239  AAAGAGAAGGRTGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  lov-5.fa
24239  AAAGAGAAGGRTGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  nfa-8.fa
24239  AAAGAGANGGRTGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  rrs-10.fa
24239  AAAGAGAAGGRTNNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  rrs-7.fa
24239  AAAGAGAAGGRTGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  sha.fa
24239  AAAGAGANGGRTGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  tamm-2.fa
24239  AAAGAGAAGGRNGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  ts-1.fa
24239  NAAGAGANGGRTGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  tsu-1.fa
24239  AAAGAGANGGRTGNGGAAGAGCAAGCAAGGCGATACCAGTTGGATGTTCTTGAACAAGCTAAAGCGAAAAACACGATTGC  van-0.fa
 
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTTATTAAAAGTGTTCATAAGGATCTGATGAGCCAGA  chr1.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTTATTAAAAGTGTTCATAAGGATCTGATGAGCCAGA  bay-0.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTNNNNNNNNNNNNTCATAAGGATCTGATGAGCCAGA  bor-4.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTTNNNNNNNNNNTTCATAAGGATCTGATGAGCCAGA  br-0.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTTATTAAAAGTGTTCATAAGGATCTGATGAGCCAGA  bur-0.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTTATTANNNNNGTTCATAAGGATCTGATGAGCCAGA  c24.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTNNNNNNNNNNNNTCATAAGGATCTGATGAGCCAGA  col-0.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTTANNNNNNGTGTTCATAAGGATCTGATGAGCCAGA  cvi-0.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTNNNNNNNNNNNNNCATAAGGATCTGATGAGCCAGA  est-1.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTTANNNNNNNTGTTCATAAGGATCTGATGAGCCAGA  fei-0.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTNTNNNNNNNNNNNNNNNNNNNAAGGATCTGATGAGCCAGA  got-7.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTTANNNNNNNNNNTCATAAGGATCTGATGAGCCAGA  ler-1.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTNNNNNNNNNNNNNNNCNTAAGGATCTGATGAGCCAGA  lov-5.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTTATNNNNNNTGTTCATAAGGATCTGATGAGCCAGA  nfa-8.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCNNNNNNNNNNNNNNNNNNANGATCTGATGAGCCAGA  rrs-10.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTTNNNNNNNGNGTTCATAAGGATCTGATGAGCCAGA  rrs-7.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTTANNNNNNNNGTTCATAAGGATCTGATGAGCCAGA  sha.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCNNNNNNNNNNNNNTCATAAGGATCTGATGAGCCAGA  tamm-2.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTTANNNNNNNNGTTCATAAGGATCTGATGAGCCAGA  ts-1.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTNNNNNNNNNNNNNNNNNNNAAGGATCTGATGAGCCAGA  tsu-1.fa
24319  TTTCCTTGAGACCGGTGCTGGAAAGACACTTATCGCGATTCTTCTNNNNNNNNNNNNNCNTAAGGATCTGATGAGCCAGA  van-0.fa
 
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCTAATAAGAAACATGTTTGT  chr1.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCTAATAAGANNNNNNNNNNN  bay-0.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCTAATAAGANNNNNNNNNNN  br-0.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCTAATANCNNNNNNNNNNNN  bur-0.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCTAATAAGANNNNNNNNNNN  c24.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCTAATAAGNNNNNNNNNNNN  col-0.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCNNNNNNNNNNNNNNNNNNN  cvi-0.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCTAATAAGNNNNNNNNNNNN  est-1.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCTAATAAGANNNNNNNNNNN  fei-0.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCTAATAANNNNNNNNNNNNN  ler-1.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCNTTTGGTTTATCAGGTACCGCCNNNNNNNNNNNNNNNNNNN  lov-5.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCTAATAAGANNNNNNNNNNN  nfa-8.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCTAATNNNNNNNNNNNNNNN  rrs-10.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCTAANNNNNNNNNNNNNNNN  rrs-7.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCNNNNNNNNNNNNNNNNNNN  sha.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCNNNNNNNNNNNNNNNNNNN  tamm-2.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCTAATAAGNNNNNNNNNNNN  ts-1.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCGCCTAATAAGNNNNNNNNNNNN  tsu-1.fa
24399  ACAGAAAAATGCTCTCGGTGTTCTTGGTTCCCAAAGTGCCTTTGGTTTATCAGGTACCNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
24479  ATTCTTTTTTAAAAAATTGGTTACCTATTGGTTTTGGTTGGTTGATTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  chr1.fa
24479  NNNNTTNTTTAAAAAATTGGTTACCTNTTGGTTTTGNNNNGTTGATTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  bay-0.fa
24479  NNNNNNNNNNNNNNNNNNNNNNNNNTATTGGTTTTGGTTGGTTGATTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  bor-4.fa
24479  NNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTTTTGGTNGGNTGNTTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  br-0.fa
24479  NNNNNNNNNNNNNNNNNNNNNTACCTATTGGTTTTGGTTGGTTGATTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  bur-0.fa
24479  NNNNNNNNNNNNNNNNNNNNNNACCTNTTGGTTTTGGTTNGTTGATTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  c24.fa
24479  NNNNNNNNNNNNNNNNNNNNNNNNNTATTGGTTTTGGTTGGTTGATTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  col-0.fa
24479  NNNNNNNNNNNNNNNNNNNNNNNNCTATTGGTTTTGGTTGGTTGATTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  cvi-0.fa
24479  NNNNNNNNNNNNNNNNNNNNNNNNNNATTGGTTTTGGTTGGTTGATTTATCTTACNTTATCAGCAAGCAGAAGTGATCCG  est-1.fa
24479  NNNNNNNNNNNNNNNNNNNNNTACCTATTGGTTTTGGTTNGTTGATTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  fei-0.fa
24479  NNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTTTTGGTTGGTTGATTTNTNNNNCGTTATCAGCAAGCAGAAGTGATCCG  got-7.fa
24479  NNNNNNNNNNNNNNNNNNNNNNANNTNTTGGTTTTGGTTNGNNGNTTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  ler-1.fa
24479  NNNNNNNNNNNNNNNNNNNNNNNNNNATTGGTTTTGGTTGGTTGATTTNTNNTNCGTTATCAGCAAGCAGAAGTGATCCG  lov-5.fa
24479  NNNNNNNNNNNNNNNNNNNNTTACCTATTGGTTTTGGTTGGTTGATTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  nfa-8.fa
24479  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTTGGTTGGTTGATTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  rrs-10.fa
24479  NNNNNNNNNNNNNNNNNNNNNNNNCTATTGGTTTTGGTTGGTTGATTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  rrs-7.fa
24479  NNNNNNNNNNNNNNNNNNNNNNNNCTATTGGTTTTGGTTGGTTGATTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  sha.fa
24479  NNNNNNNNNNNNNNNNNNNNNNNNNNATTGGTTTTGGTTGGTTGATTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  tamm-2.fa
24479  NNNNNNNNNNNNNNNNNNNNNNNNNNATTGGTTTTGGTTNGNNGNTTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  ts-1.fa
24479  NNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTTTTGGTTGGTTGATTTNTCTTACGTTATCAGCAAGCAGAAGTGATCCG  tsu-1.fa
24479  NNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGTTTTGGTTGGTTGATTTATCTTACGTTATCAGCAAGCAGAAGTGATCCG  van-0.fa
 
24559  TAATCAAACTTGTTTTCAAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  chr1.fa
24559  TAATCAAACTTNTTTTCAAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  bay-0.fa
24559  TAATCAAANNNNNNNNNNNNTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  bor-4.fa
24559  TAATCAAACNNNNNTTCAAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  br-0.fa
24559  TAATCAAACTTGTTTTCAAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  bur-0.fa
24559  TAATCAAACTTGTTTTCAAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  c24.fa
24559  TAATCAAANNNNNNNNCNAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  col-0.fa
24559  TAATCAAACTTGTTTTCAAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  cvi-0.fa
24559  TAATCAAACTTNNTTTCAAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGNG  est-1.fa
24559  TAATCAAACTTGTTTTCAAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  fei-0.fa
24559  TAATCANNNNNNNNNNNNNNNTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  got-7.fa
24559  TAATCAANNNNNNNNNNAAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  ler-1.fa
24559  TAATCNNNNNNNNNNNNNNNNTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  lov-5.fa
24559  TAATCAAACTNNNNNNCAAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  nfa-8.fa
24559  TAATCAAANNNNNNNNCAAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  rrs-10.fa
24559  TAATCAANNNNNNNNTCAAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  rrs-7.fa
24559  TAATCAAACTNNNNNNNNAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  sha.fa
24559  TAATCAAACNNNNNNNNNNGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  tamm-2.fa
24559  TAATCANNNNNNNNNNNNNNTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  ts-1.fa
24559  TAATCANNNNNNNNNNNNNNNTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  tsu-1.fa
24559  TAATCAAACTTGTTTTCAAGTTGGACATTATTGTGGTGAGATGGGACAGGACTTTTGGGATTCTCGAAGGTGGCAACGAG  van-0.fa
 
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTGATGCTTCTTTTTCATACCAGCTTTGATCTTTTATATGAATCAGTTCTTGAAG  chr1.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTNNNNNNNNTTNTTCATACCAGCTTTGATCTTTTATATGAATCAGTTCTTGAAG  bay-0.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTGNNNNNNCTTTTTCATACCAGCTTTGNTCNNNNNNNNNNNNNNNNNCTTGAAG  bor-4.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTNNNNNNNNNNNNNCATACCAGCTTTGNNNNNNNNNNNNNNNNNNNTCTTNNNN  br-0.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTGATGCTTCTTTTTCATACCAGCTTTGATCTTTTATATGAATCAGTTCTTGAAG  bur-0.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTGATGCTTCTTTTTCATACCAGCTTTGATCTTTTNTANGANTCAGTTCTTGAAG  c24.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTNNNNNNNNNNTTTCATACCAGCTTTGATCTNNNNNNNNNNNNNNTTCTTGAAG  col-0.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTNNNNNTTCTTTTTCATACCAGCTTTGATCTTNNNNNNNNNNNNGTTCTTGAAG  cvi-0.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTGNTGNNNNNNNNTCATACCAGCTTTGATCNNNNNNNNNNNNNNNNNCTTGAAG  est-1.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTGATGNTTNTTNTTCATACCAGCTTTGATCTTTTNTNNNNNNNAGTTCTTGAAG  fei-0.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTNNNNNNNNNNNTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTGATGNNNNTTTTTCANACNAGCTTTGATNNNNNNNNNNNNNNNGTTCTTGAAG  ler-1.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTGNNNNNNNNTTTTCATACCAGCTTTGATNNNNNNNNNNNNNNNNNNCTTGAAG  lov-5.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTGNTGCTTCTTTTTCATACCAGCTTTGATCTTTTNTNNNNNNNAGTTCTTGAAG  nfa-8.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGNNN  rrs-10.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTNNNNNNNNTTTTTCATACCAGCTTTGATCTTNNNNNNNNNNNNNNTCTTGAAG  rrs-7.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTGNTGNTTCTTNTTCATACCAGCTTTGATCTNNNNNNNNNNNNAGTTCTTGAAG  sha.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTNNNNNNNNNNNTNNANACNAGNTTTGATNNNNNNNNNNNNNNNNNTCTTGAAG  tamm-2.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTGNNNNNNNNNNTTCATACCAGCTTTGATCTTTNNNNNNNNNNNGTTCTTGAAG  ts-1.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTNNNNNNNNNNTTTTTCATACCAGCTTTGANNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
24639  AGTTTGAGTCTAAGCAGGTTGCTTTTTNNNNNNNNNNNTTCATACCAGCTTTGATCNNNNNNNNNNNNNNNNNNNTGAAG  van-0.fa
 
24719  TTAACGAGTTTTTTTCTATTTTCTTCTACGCAGGTTCTAGTTATGACAGCACAAATTCTGTTGAATATACTGAGACACAG  chr1.fa
24719  TTNACGAGTTTTTTNNNNNNTTCTTCTACGCAGGTTCTAGTTATGACAGCACAAATTCTGTTGAATATACTGAGACACAG  bay-0.fa
24719  TNNACGAGTTNNNNNNNNNNNNNNNNNNNNCAGGTTCTAGTTATGACAGCACAAATTCTGTTGAATATACTGNNNNACAG  bor-4.fa
24719  NNNNNNNNNNNNNNNNNNNNNNNTTCTACGCAGGTTCTAGTTATGACAGCACAAATTCNGTTGAATATACTGNNNNNCAG  br-0.fa
24719  TTAACGAGTTTNNNNNNNNNNNNNNNTACGCAGGTTCTAGTTATGACAGCACAAATTCTGTTGAATATACTGAGACACAG  bur-0.fa
24719  TTAACGAGTTTTTNNNNNNNTTCTTCTACGCAGGTTCTAGTTATGACAGCACAAATTCTGTTGAATATACTGAGACACAG  c24.fa
24719  TTAACGNNNNNNNNNNNNNNTTCTTCTACGCAGGTTCTAGTTATGACAGCACAAATTCTGTTGAATATACTNNNNNNNNG  col-0.fa
24719  TTAACGAGTTNNNNNNNNNNNNNNNNNNCGCAGGTTCTAGTTATGACAGCACAAATTCTGTTGAATATACTGAGACACAG  cvi-0.fa
24719  TNNNNNNNNNNNTNNNNNNNNNNTTCTACGCAGGTTCTAGTTATGACAGCACAAATTCTGTTGANTATACTGNGACACAG  est-1.fa
24719  TTAACGAGTNTNNNNNNNNNNTCTTCTACGCAGGTTCTAGTTATGACAGCACAAATTCTGTTGAATATACTGAGACACAG  fei-0.fa
24719  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGGTTCTAGTTATGACAGCACAAATTCTGNNNNNNNNNNNNNNNNNNNN  got-7.fa
24719  NNNNCGAGTTTTNNNNNNNNNNCTTCTACGCAGGTTCTAGTTATGACAGCACAAATTCTGTTNNNNANNNNNNNNNNNNG  ler-1.fa
24719  TTNANNNNNNNNNNNNNNNNNNNNNNNNNNCAGGTTCTAGTTATGACAGCACAAATTCTGNNNNNNNNANNNNNNNNNAG  lov-5.fa
24719  TTAACGAGTTTTTNNNNNNNTTCTTCTACGCAGGTTCTAGTTATGACAGCACAAATTCTGTTGAATATACTGAGANACAG  nfa-8.fa
24719  NNNNNNNNNNNNNNNNNNNNNNNNNNTACGCAGGTTCTAGTTATGACAGCACAAATTCTGTNGAATATANNNNNNNNNNN  rrs-10.fa
24719  TTAACGAGTTTNNNNNNNNNNNNNNNNNNNCAGGTTCTAGTTATGACAGCACAAATTCTGTTGAATATACTGNNNNACAG  rrs-7.fa
24719  TTAACGAGTTTTNNNNNNNNNNCTTCTACGCAGGTTCTAGTTATGACAGCACAAATTCTGTTGAATATACTGANACACAG  sha.fa
24719  TTNNNNNGTNTNNNNNNNNNNNNNNCTACGCAGGTTCTAGTTATGACAGCACAAATTCTGTTNAATATACTNNNNNNNAG  tamm-2.fa
24719  TTAACGNGTTTTTNNNNNNNNTCTTCTACGCAGGTTCTAGTTATGACAGCACAAATTCTGTTGNATATANNNNNNNNNAG  ts-1.fa
24719  NNNNNNNNNNNNNNNNNNNNNTNTTCTACGCAGGTTCTAGTTATGACAGCACAAATTCTNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
24719  TTNACNAGNTNNNNNNNNNNNNNNNNNNNGCAGGTTCTAGTTATGACAGCACAAATTCTGTTGAATATACTGAGNCACAG  van-0.fa
 
24799  TATCATTAGAATGGAAACAATTGATCTTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATACTCTTTAG  chr1.fa
24799  TATCATTAGAATGGAAACAATTGATCTTCTTATTCTCGACGAGTGNCACCACGCTGTCAAGAAACATCCATACTCTTTAG  bay-0.fa
24799  TATCATTAGNNNNNNAACAATTNNNNTTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATACTCTTTAG  bor-4.fa
24799  TATCATTAGAATGGAAANNNNNNNNCNTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATACTCTTTAG  br-0.fa
24799  TATCATTAGAATGGAAACAATTGATCTTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATACTCTTTAG  bur-0.fa
24799  TATCATTAGAATGGAAACAATTGATCTTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATACTCTTTAG  c24.fa
24799  TATCATTAGAATGGAAACAATNNNNNTTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATACTCTTTAG  col-0.fa
24799  TATCATTAGAATGGAAACAATTGATCTTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATACTCTTTAG  cvi-0.fa
24799  TATCATTAGAATGGAAACAANNNNNCTTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATACNCTTTAG  est-1.fa
24799  TATCATTAGAATGGAAACAATTGATCTTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATACTCTTTAG  fei-0.fa
24799  NANNNNNNNNNNNNNNNNNNNNNNNNTTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACANCNNNNNNNNTNNN  got-7.fa
24799  TATCATTNNNNNNNNNNNNNNNNNNNNNNNTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATNNNNNNNNG  ler-1.fa
24799  TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCNNNNNNNNNNAG  lov-5.fa
24799  TATCATTAGAATGGAAACAATTGATCTTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATACTCTTTAG  nfa-8.fa
24799  NNTCNTNNGNNNNGAAANNNNNNNNNNNCTTATTCTCGACGAGTGTCACCACGCTGTCAAGANNNNNNNNNNNNNNNNNN  rrs-10.fa
24799  TATCATTAGAATNGAAACAATTGATCTTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATACTCTTTAG  rrs-7.fa
24799  TATCATTAGAATGGAAACAATTGNTCTTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATACTCTTTAG  sha.fa
24799  TATCATTAGAATGGAAACAATTGATCTTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATNCTCTTTAG  tamm-2.fa
24799  TATCATTAGAANGGAAACAATTGATCTTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACANCCATACTCTTTAG  ts-1.fa
24799  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACANNNNNNNNNNNNAG  tsu-1.fa
24799  TATCATTAGAATNGAAACAANNNNNNNTCTTATTCTCGACGAGTGTCACCACGCTGTCAAGAAACATCCATACTCTTTAG  van-0.fa
 
24879  TGATGTCAGAGTTTTACCATACAACTCCTAAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTA  chr1.fa
24879  TGATGTCAGAGTTTTACCATACAACRCCNAAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTA  bay-0.fa
24879  TGATGTCAGAGTTTTACCATNNNNNRNNNNAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTA  bor-4.fa
24879  TGATGTCAGAGTTTTACCATACNNNRNNNNAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTA  br-0.fa
24879  TGATGTCAGAGTTTTACCATACAACRCCTAAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTA  bur-0.fa
24879  TGATGTCAGAGTTTTACCATACAACRCCNAAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTA  c24.fa
24879  TGATGTCAGAGTTTTACCATACNNNRNNNNNAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTA  col-0.fa
24879  TGATGTCAGAGTTTTACCATACANCRNNNAAAGATANAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTA  cvi-0.fa
24879  TGATGTCAGAGTTTTACCATACNNNRNNNNNNNATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTNN  est-1.fa
24879  TGATGTCAGAGTTTTACCATACAACRCCNAAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTA  fei-0.fa
24879  NNATGTCAGAGTTTTACCATACNNNRNNNNAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTNN  got-7.fa
24879  TGATGTCAGAGTTTTACCATACNNNRNNNNAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTNN  ler-1.fa
24879  TGNTGTCAGAGTTTTACCANANNNNRNNNNNNGATAAAAGACCTGCCATCTTTGGAATGNCTGCTTCGCCTGTTAATTNN  lov-5.fa
24879  TGATGTCAGAGTTTTACCATACANCRNNNAAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTA  nfa-8.fa
24879  NNNNNTCAGAGTTTTACCATACNNNRNNNAAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTN  rrs-10.fa
24879  TGATGTCAGAGTTTTACCATACANNRNNNAAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTNAATTTA  rrs-7.fa
24879  TGATGTCAGAGTTTTACCATACANNRNNNAAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTA  sha.fa
24879  TGATGTCAGAGTTTTACCATACNNNRNNNAAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTA  tamm-2.fa
24879  TGATGTCAGAGTTTTACCATACANNRNNNAAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTA  ts-1.fa
24879  NGANGTCAGAGTTTTACCNNNNNNNRNNNNNNNATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATNNN  tsu-1.fa
24879  TGATGTCAGAGTTTTACCATACANNRNNNAAAGATAAAAGACCTGCCATCTTTGGAATGACTGCTTCGCCTGTTAATTTA  van-0.fa
 
24959  AAGGGTACTGATTGTTTCTTGTATACAGTTCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTGTAAACGT  chr1.fa
24959  AAGGGTACTGATTGTTTCTTGTATACAGTTCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTGTAAACGT  bay-0.fa
24959  NNNNNNNNNNATTGTTTNTNNNNNNNNNTTCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTGTAAACGT  bor-4.fa
24959  ANNNNNNNNNATTGTTTCTTGTNNNNNGTTCTCTAAGCTTGCCAATGTTCTTGAANGTGACACTTTTTGTTTGTAAACGT  br-0.fa
24959  AAGGGTACTGATTGTTTCTTGTATACAGTTCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTGTAAACGT  bur-0.fa
24959  AAGGGTACTGATTGTTTCTTGTATACAGTTCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTGTAAACGT  c24.fa
24959  AAGNNNNNNNATTGTTNCTTGTATACAGTTCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTGTAAACGT  col-0.fa
24959  AAGGNTACTGATTGTTTCTTGTATACAGTTCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTNTAAACGT  cvi-0.fa
24959  NNNNNNNNNNATNGTTTCTTNNNNNNNNNNCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTGTAAACGT  est-1.fa
24959  AAGGGTACTGATTGTTTCTTGTATACAGTTCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTGTAAACGT  fei-0.fa
24959  NNNNNNNNNNNTTGNNNNNNNNNNNNNNNNCTCTAAGCTTGCCAATGTTCTTGNNNNNNNNNNNNNTTGTTTGNAAACGT  got-7.fa
24959  NNNNNNNNTGATTGTNTCTTGTANNNNNTTCTCTAAGCTTGCCAATGTTCTTGAANGTGACACTTTTTGTTTGTAAACGT  ler-1.fa
24959  NNNNNNNNTGANTGNTTCTTNNNNNNNNNTCTCTAAGCTTGCCAATGTTCTTGAAANNNNNNNNNTTTGTTTGTAAACGT  lov-5.fa
24959  AAGGGTACTGATTGTTTCTTGTATACAGTTCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTGTAAACGT  nfa-8.fa
24959  NNNNNNNNNNATTGTTTCTTNNNNNNNNNTCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTGTAAACGT  rrs-10.fa
24959  ANGNNTACTGATTGTTTCTTGTATNCAGTTCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTGTAAACGT  rrs-7.fa
24959  AAGGGTACTGATTGTTTCTTGTATACAGTTCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTGTAAACGT  sha.fa
24959  ANNNNNNNTGATTGTTTCTTGTNTACAGTTCTCTAAGCTTGCCAATGTTCTTGAAANTGACACTTTTTGTTTGTAAACGT  tamm-2.fa
24959  AAGGGTNCTGATTGTTTCTTGTATNCAGTTCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTGTAAACGT  ts-1.fa
24959  NNNNNNNNNNATTGNNNNNTNNNNNNNNNNCTCTAAGCTTGCCAATGTTCTTNANNGNGNNANTTTTTGTTTGTAAACGT  tsu-1.fa
24959  NNNNNNNNTGATTGTTTCTTGTNNNNNNNNCTCTAAGCTTGCCAATGTTCTTGAAAGTGACACTTTTTGTTTGTAAACGT  van-0.fa
 
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATAA  chr1.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATAA  bay-0.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATNN  bor-4.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATNN  br-0.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATAA  bur-0.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATAA  c24.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATAN  col-0.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATAA  cvi-0.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTNNNN  est-1.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATAA  fei-0.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTNGTACTANNN  got-7.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATNN  ler-1.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATNN  lov-5.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATAA  nfa-8.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATAA  rrs-10.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATAA  rrs-7.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATAA  sha.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATAA  tamm-2.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTTTGTACTATAA  ts-1.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTNNNNNNNNNNN  tsu-1.fa
25039  AGGTGTTTCAAGCCAAGTAGATTGTGCGATAAAGATACGTAACCTCGAGACCAAGTTGGATTCTACGGTNNNNNNTATNN  van-0.fa
 
25119  AAGATCGAAAAGAATTAGAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGCTGCTACTATGTGG  chr1.fa
25119  AAGATCGAAAAGAATNARAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  bay-0.fa
25119  NNNNNNNNNNNNNNNNNRAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  bor-4.fa
25119  NNNNNNNNNNNNNNNNNRNGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  br-0.fa
25119  AAGATCGAAAAGAATTARAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  bur-0.fa
25119  AAGATCGAAAAGAANNNRAGAAACATGTGCCTATGCCCTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  c24.fa
25119  NNNNNNGAAAANNNNNNRAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  col-0.fa
25119  AAGATCGAAAAGAATNNRAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  cvi-0.fa
25119  NNNNNNNNNNNNNNNNNRAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  est-1.fa
25119  AAGATCGAAAAGAANNNRAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  fei-0.fa
25119  NNNNNNNNNNNNNNNNNRNNNAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  got-7.fa
25119  NNNNNNNNAAAGAANNNRAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  ler-1.fa
25119  NNNNNNNNNNNNNNNNNRNNNAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAANGRTGCTACTATGTGG  lov-5.fa
25119  AAGATCGAAAAGAANNNRAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  nfa-8.fa
25119  NNNNNNNNNNNNNNNNNRAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  rrs-10.fa
25119  NNNNNNGAAAANNNNNNRAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  rrs-7.fa
25119  AAGATCGAAAAGAANNNRAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  sha.fa
25119  NNNNNCNNNNNNNNNNNRAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  tamm-2.fa
25119  AAGANCGAAAAGAANNNRAGAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  ts-1.fa
25119  NNNNNNNNNNNNNNNNNRNNAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  tsu-1.fa
25119  NNNNNNNNNNNNNNNNNRANAAACATGTGCCTATGCCTTCAGAGATAGTCGTCGAGTATGACAAAGRTGCTACTATGTGG  van-0.fa
 
25199  TCTCTTCATGAGACAATAAAGCAAATGATTGCAGCTGT