Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 28500 - 28706


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
28500  TACTTTTCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  chr1.fa
28500  TACTTTTCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGNNNNNGAAGCAAAGTCTGTCT  bay-0.fa
28500  NNNNNNNCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  bor-4.fa
28500  NNNNNNTCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  br-0.fa
28500  NNNNTTTCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  bur-0.fa
28500  NNNTTTTCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  c24.fa
28500  NNNNNTTCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  col-0.fa
28500  NNNNNNTCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  cvi-0.fa
28500  NNNNNNNCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  est-1.fa
28500  NNNTTTTCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  fei-0.fa
28500  NNNNNNNNNNNNNTNNNNNGGACTTGNNNGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTNN  got-7.fa
28500  NNNNNNNNNAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCNNNNN  ler-1.fa
28500  NNNNNNNNNNNNATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCN  lov-5.fa
28500  NNNNNTTCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  nfa-8.fa
28500  NNNNNNTCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCN  rrs-10.fa
28500  NNNNNNNCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  rrs-7.fa
28500  NNNNNNTCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  sha.fa
28500  NNNNNNTCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  tamm-2.fa
28500  NNNNNNTCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  ts-1.fa
28500  NNNNNNNNNNATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCN  tsu-1.fa
28500  NNNNNNTCTAATATCACGAGGACTTACATGGCCTCAAGTCACCTGTGGTGTTGTGCAAGAAGGAGAAGCAAAGTCTGTCT  van-0.fa
 
28580  ATGTATTATGAGATAGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  chr1.fa
28580  ATGTATTATGAGATAGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTNCTTCTTGCACAACCT  bay-0.fa
28580  ANNNNNNNNNNNNNNGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  bor-4.fa
28580  ATGNATTATGAGATAGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  br-0.fa
28580  ATGTATTATGAGATAGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  bur-0.fa
28580  ATGTATTATGAGATAGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  c24.fa
28580  ATGTATTATGAGATAGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  col-0.fa
28580  ATGTATTATGAGATAGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  cvi-0.fa
28580  ATNNNNNNTNNNNNNNNTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  est-1.fa
28580  ATGTATTATGAGATAGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  fei-0.fa
28580  NNNNNNNNNNNNNNNNNTACTTCTATGGCTAGGATNTATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  got-7.fa
28580  NNNNNNNNNNAGATAGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTNCTTCTTGCACAACCT  ler-1.fa
28580  NNNNNNNNNNNNNTNGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCNACTTCTTGCACAACCT  lov-5.fa
28580  ATGTATTATGAGATAGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  nfa-8.fa
28580  NNNNNNNNNNNNNNNNNTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  rrs-10.fa
28580  ATGTATTANGANATNGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTNCTTCTTGCACAACCT  rrs-7.fa
28580  ATGTATTATGAGATAGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  sha.fa
28580  ATGTATTATGAGATAGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  tamm-2.fa
28580  ATGTATTATGAGATAGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  ts-1.fa
28580  NNNNNNNNNNNNNNNNNNACTTCTATGGCTAGGATNTATGTTGTACAAGACCGGCTTTTCTTCTNCTTCTTGCACAACCT  tsu-1.fa
28580  NNNNNNNNNGAGATNGCTACTTCTATGGCTAGGATATATGTTGTACAAGACCGGCTTTTCTTCTACTTCTTGCACAACCT  van-0.fa
 
28660  GAGGTTATTGAGGCTATACAAGTCTTCTTCTATAATGTTATTTATTA   chr1.fa
28660  GAGGTTATTGAGGCTATACAAGTCTTCTTCTATAATGTTATTTATTA   bay-0.fa
28660  GAGGTTATTGAGGCTATACAAGNNNNNNNNNNNNNNNNNNNNNNNNN   bor-4.fa
28660  GAGGTTATTGAGGCTATACAAGTCTTNNNNNNNNNNNNNNNNNNNNN   br-0.fa
28660  GAGGTTATTGAGGCTATACAAGTCTTCTTCTATNNNNNNNTTTATTA   bur-0.fa
28660  GAGGTTATTGAGGCTATACAAGTCTTCTTCTNNNNNNNNNNNNNNNA   c24.fa
28660  GAGGTTATTGAGGCTATACAAGTCTTNNNNNNNNNNNNNNNNNNNNN   col-0.fa
28660  GAGGTTATTGAGGCTATACAAGTCTTCTTNNNNNNNNNNNNNNNNNN   cvi-0.fa
28660  GAGGTTATTGAGGCTATACAAGTNNNNNNNNNNNNNNNNNNNNNNNN   est-1.fa
28660  GAGGTTATTGAGGCTATACAAGTCTTCTTCNNNNNNNNNNNNNNTTA   fei-0.fa
28660  GAGGTTATTGAGGCTATACAAGTNNNNNNNNNNNNNNNNNNNNNNNN   got-7.fa
28660  GAGGTTATTGAGGCTATACAAGTNNNNNNNNNNNNNNNNNNNNNNNN   ler-1.fa
28660  GAGGTTATTGAGGCTATACAAGTNNNNNNNNNNNNNNNNNNNNNNNN   lov-5.fa
28660  GAGGTTATTGAGGCTATACAAGTCTTCTTCNNNNNNNNNNNNNNNNA   nfa-8.fa
28660  GAGGTTATTGAGGNTATACAANNNNNNNNNNNNNNNNNNNNNNNNNN   rrs-10.fa
28660  GAGGTTATTGAGGCTATACAAGTCTNNNNNNNNNNNNNNNNNNNNNN   rrs-7.fa
28660  GAGGTTATTGAGGCTATACAAGTCTTCTTNNNNNNNNNNNNNNNNNA   sha.fa
28660  GAGGTTATTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN   tamm-2.fa
28660  GAGGTTATTGAGGCTATACAAGTCTTCTTCTNNNNNNNNNNNNNNNN   ts-1.fa
28660  GAGGTTATTGAGGCTATACAAGNNNNNNNNNNNNNNNNNNNNNNNNN   tsu-1.fa
28660  GAGGTTATTGAGGCTATACAAGNNNNNNNNNNNNNNNNNNNNNNNNN   van-0.fa
 
visited.