Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 32727 - 33009


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCAAGAGTATTAAATGGAAAAAGCGAATCAAGACCCCACAAGGGAAAAC  chr1.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCAAGAGTATTAAATGGAAAAAGCGAATCAAGACCCCACAAGGGAAAAC  bay-0.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCNNNNNNNNNNNATGGAAAAAGCGAATCAAGACCCCACAAGGGAAAAC  bor-4.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCAAGANNNNNNNNNGGAAAAAGCGAATCAAGACCCCACAAGGGAAAAC  br-0.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCAAGAGTATTAAATGGAAAAAGCGAATCAAGACCCCACAAGGGAAANN  bur-0.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCAAGAGTATTAAATGGAAAAAGCGAATCAAGACCCCACAAGGGAAAAC  c24.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCAAGNNNNNNNNATGGAAAAAGCGAATCAAGACCCCACAAGGGAAAAC  col-0.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCAAGAGTATTAAATGGAAAAAGCGAATCAAGACCCCACAAGGGANNNN  cvi-0.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAANNNNNNNNNNNNAATGGAAAAAGCGAATCAAGACCCCACAAGGGAAAAC  est-1.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCAAGAGTATTAAATGGAAAAAGCGAATCAAGACCCCACAAGNNNNNNN  fei-0.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAANNNNNNNNNNNNNNNNGAAAAAGCGAATCAAGACCCCACANNNNNNNNN  got-7.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCNNNNNNNNTAAATNGAAAAAGCGAATCAAGACCCCACAAGGGAAAAC  ler-1.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAANNNNNNNNNNNNNATGGAAAAAGCGAATCAAGACCCCACANNNNNNNNN  lov-5.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCAAGAGTATNAAATGGAAAAAGCGAATCAAGACCCCACAAGGGAAAAC  nfa-8.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCNNNNNNNNNNNATGGAAAAAGCGAATCAAGACCCCACAAGGGAAAAC  rrs-10.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCANNNNNNNNNNNTGGAAAAAGCGAATCAAGACCCCACAAGGGAAAAC  rrs-7.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCAAGAGTATTAAATGGAAAAAGCGAATCAAGACCCCACAAGNNNNNNN  sha.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCAANNNNNNNNNNTGGAAAAAGCGAATCAAGACCCCACAAGGNNNNNN  tamm-2.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCAAGNNNNNNNNATGGAAAAAGCGAATCAAGACCCCACAAGGGAAAAC  ts-1.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGANNNNNNNNNNNNNNNNNNNNNNNGCGAATCAAGACCCCACANNNNNNNNN  tsu-1.fa
32727  ACCCTAATTGGCAGAGAGAGAATCAATCGAATCAAGNNNNNNNNNTGGAAAAAGCGAATCAAGACCCCACAAGGNNNNNN  van-0.fa
 
32807  AATCCTTAAAGCAGACTTGAGATCGATCATACCCAAATTATGGATTCATATATTGTTAACGTATCGATTACTGAAAAGAT  chr1.fa
32807  AATCCTNAAAGCAGACTTGAGATCGATCATACCCAAATTATGGATTCATATATTGTTAACGTATCGATTACTGAAAAGAT  bay-0.fa
32807  AATCCTTAAAGCAGACTTGAGATCGATCATACCCAAATTANNNNNNNNNNNNNNNNNNNNNTATCNATTACTGNNNNNNN  bor-4.fa
32807  AATCCTTAAAGCAGACTTGAGATCGATCATACCCAAATTANNNNNNNNNNNNNTNTTAACGTATCGATTACTGAAAAGAT  br-0.fa
32807  GNNNNNNNNNNNNGACTTGAGATCGATCATACCCAAATTATGGATTCNTATATTGTTAACGTATCGATTACTGAAAAGAT  bur-0.fa
32807  GATCCTTAAAGCAGACTTGAGATCGATCATACCCAAATTATGGATTNATATATTGTTAACGTATCGATTACTGAAAAGAT  c24.fa
32807  AATCCTTAAAGCAGACTTGAGATCGATCATACCCAAATTANNNNNNNNNNNNNNNNNNACGTATCGATTACTGAAAAGAT  col-0.fa
32807  GATCCTTAAAGCAGACTTGAGATCGATCATACCCAAATTATGGANNNNNNTATTGTTAACGTATCGATTACTGAAAAGAT  cvi-0.fa
32807  AATCCTTAAAGCAGACTTGAGATCGATCATACCCAAATNNNNNNNNNNNNNNNNNNNNNNGTATCGATTACTGAAAAGNT  est-1.fa
32807  GANNCNTAAAGCAGACTTGAGATCGATCATACCCAAATTATGGATTNATATATTGTTAACGTATCGATTACTGAAAAGAT  fei-0.fa
32807  NNNNNNNNNNNNNNNNNTGAGATCGATCATACCCAAANNNNNNNNNNNNNNNNNNNNNNNNNNTCGATTACTGAANAGNT  got-7.fa
32807  AATCCTTAAAGCAGACTTGAGATCGATCATACCCAAATTNNNNNNNNNNNNNNNNNNNNCGTATCGATTACTGAAAAGAT  ler-1.fa
32807  GNNNNNNNNNNNNNACTTGAGATCGATCATACCCAAATTNNNNNNNNNNNNNNNNNNNNNGTATCGATTACTGAANNNNT  lov-5.fa
32807  AATCCTTAAAGCAGACTTGAGATCGATCATACCCAAATTATGGNNNNNNATATTGTTAACGTATCGATTACTGAAAAGAT  nfa-8.fa
32807  AATCCTTAAAGCAGACTTGAGATCGATCATACCCAAATNNNNNNNNNNNNNNNNNNNNNCGTATCGATTACTGAAAAGAT  rrs-10.fa
32807  AATCCTTAAAGCAGACTTGAGATCGATCATACCCAAATTNNNNNNNNNNNNNNNNNNNACGTATCGATTACTGAAAAGAT  rrs-7.fa
32807  GNNNNNNNNAGCAGACTTGAGATCGATCATACCCAAANNNNNNNNNNNNNNNNNNNTAACGTATCGATTACTGAAAAGAT  sha.fa
32807  GNNNNNNNNNNNAGACTTGAGATCGATCATACCCAAANNNNNNNNNNNNNNNNNNNNNNNNTNTCGATTACTGAAAANAT  tamm-2.fa
32807  AATCCTTAAAGCAGACTTGAGATCGATCATACCCAAATNNNNNNNNNNNNNNNNNNNNACGTATCGATTACTGAAAAGAT  ts-1.fa
32807  GNNNNNNNNNNNNGACTTGAGATCGATCATACCCAAATNNNNNNNNNNNNNNNNNNNNNNNNNNCGATTACNNNNNNNNN  tsu-1.fa
32807  GNNNNNNNNNNNAGACTTGAGATCGATCATACCCAAATTATGNNNNNNNNNNNNNNNNNNGTATCGATTACTGAAAAGAT  van-0.fa
 
32887  GTATACCAAATCTGTTCACTTTTTCTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAAGATTA  chr1.fa
32887  GTATACCAAATCTGTTCACTTTTTCTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAAGATTA  bay-0.fa
32887  NNNTNNCNAATCTGTTCACTTNNNNTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAANNNNN  bor-4.fa
32887  GTATACCAAATCTGTTCACTTTTTCTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAANACCCAGAAGNNNN  br-0.fa
32887  GTATACCAAATCTGTTCACTTTTTCTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAANNNNNNCAGAAGATTA  bur-0.fa
32887  GTATACCAAATCTGTTCACTTTTTCTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAATACNNNNNNNNNNN  c24.fa
32887  GTATACCAAATCTGTTCACNTTTTCTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAAGATNA  col-0.fa
32887  GTATACCAAATCTGTTCACTTTTTCTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAAGATTA  cvi-0.fa
32887  GTATACCAAATCTGTTCNNNNNNTCTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAAGATTN  est-1.fa
32887  GTATACCAAATCTGTTCACTTTTTCTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAAGATTA  fei-0.fa
32887  GTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATGGATGATTGAGATTTGAAGCAACAAAATACNNNNNNNNNNN  got-7.fa
32887  GTATACCAAATCTGTTCACTTTNTCTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAAGATTA  ler-1.fa
32887  GTATANNNNNNCTGTTCNNNNNNNCTCTATAGNCTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAAGATTA  lov-5.fa
32887  GTATACCAAATCTGTTCACTTTTTCTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAAGATTA  nfa-8.fa
32887  GTATACCAAATCTGTTCACNNNNNNNCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAAGATNA  rrs-10.fa
32887  GTATACCANATCTGTTCNCTTTTTCTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAAGATTA  rrs-7.fa
32887  GTATACCAAATCTGTTCACTTTTTCTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAAGATTA  sha.fa
32887  GTATACCAAATCTGTTCACTTTTTNNCNNNNNACTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAAGATNN  tamm-2.fa
32887  GTATACCNAATCTGTTCNCTTTTNCNCTATAGACTCGATGGATGATTGNGATTTGAAGCAACAAAATACCCAGAAGATNA  ts-1.fa
32887  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATGGATGATTGAGATTTGAAGCAACAAAATACCNNNNNNNNNN  tsu-1.fa
32887  GTATACCAAATCTGTTCACTTTNTCTCTATAGACTCGATGGATGATTGAGATTTGAAGCAACAAAATACCCAGAAGANTN  van-0.fa
 
32967  AACATGGAAAAGCATCAAACTTTGATGATCTTAGAACGATGAC   chr1.fa
32967  AACATGGAAAAGCANCAAACTTTGATGATCTTAGAACGATGAC   bay-0.fa
32967  NNCATGGAAAAGCATCAAACTTTGNTGATCTTAGAACGANNNN   bor-4.fa
32967  NNNANGGAAAAGCATCAAACTTTGATGATCTTAGAACNNNNNN   br-0.fa
32967  AACATGGAAAAGCATCANACTTTGATGATCTTAGAACGATGAC   bur-0.fa
32967  NNCATGGAAAAGCATCAAACTTTGATGATCTTAGAACGATGAC   c24.fa
32967  AACATGGAAAAGCATCAAANNNNNNNGATCTTAGAACGATNNN   col-0.fa
32967  AACATGGAAAAGCATCAAACTTTGATGATCTTAGAACGATGAN   cvi-0.fa
32967  NNNNTGGAAAAGCATCAAACTTTGNTGATCTTAGAACNNNNNN   est-1.fa
32967  AACATGGAAAAGCATCAAACTTTGATGATCTTAGAACGATGAC   fei-0.fa
32967  NACATGNNNNNGCATCNNNNNNNNNNNNNCTTAGAACGNNNNN   got-7.fa
32967  AACATGGAAAAGCATCNNNNNNNNNTGATCTTAGAACGATGAC   ler-1.fa
32967  AACATGGNNNNNNATCNNNNNNNNNNNATCTTAGAACGANNNN   lov-5.fa
32967  AACATGGAAAAGCATCAAACTTTGATGATCTTAGAACGATGAN   nfa-8.fa
32967  AACATGGAAAAGCATCAANNNNNNNNGATCTTAGAACGATGAC   rrs-10.fa
32967  AACATGGAAANGCATCAAACTNNNNNNATCTTAGAACGATGAC   rrs-7.fa
32967  AACATGGAAAAGCATCAAACTTTGATGATCTTAGAACGATGNN   sha.fa
32967  NNCATGGAAAAGCATCANNNNNNNNNNATCTTAGAACGNNNNN   tamm-2.fa
32967  AACATGGAAAAGCATCAAANNNNNNNNATCTTAGAACGATGAN   ts-1.fa
32967  NNCATGGNNNNNNNNNNNNNNNNNNNNNTCTTAGAACNNNNNN   tsu-1.fa
32967  NANNNNGAAAAGCATCAAACTTTGATGATCTTAGAACGNNNNN   van-0.fa
 
visited.