Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 52239 - 54494


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
52239  ATGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  chr1.fa
52239  ATGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  bay-0.fa
52239  NTGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  bor-4.fa
52239  ATGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  br-0.fa
52239  ATGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  bur-0.fa
52239  ATGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGNGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  c24.fa
52239  ATGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  col-0.fa
52239  ATGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  cvi-0.fa
52239  ATGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  est-1.fa
52239  ATGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  fei-0.fa
52239  NNNGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATNATAG  got-7.fa
52239  ANGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  ler-1.fa
52239  NNNNGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAANGCGAGCTTTCCGATCTCCGACGAAGAAAGATCANAG  lov-5.fa
52239  ATGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  nfa-8.fa
52239  ATGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATNATAG  rrs-10.fa
52239  ATGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  rrs-7.fa
52239  ATGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  sha.fa
52239  NTGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCANAG  tamm-2.fa
52239  ANGGGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTANNNNNAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  ts-1.fa
52239  NNNNNGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAANNNNNNNNN  tsu-1.fa
52239  NNNNGGAAAAAGAACGGCTCTTCTTCTTGGCTCACCGCTGTAAAGCGAGCTTTCCGATCTCCGACGAAGAAAGATCATAG  van-0.fa
 
52319  TAATGACGTCGAAGAAGATGAAGAAAAGGTTTCTTATTCTTAGATCTTATTATTTGCTTACTATATTCAAAGTATGATTA  chr1.fa
52319  TAATGACGNCGAAGAAGANGNNGNAAAGGTTTCTTNTTNTTNNNTRTTNTTATTTGCTTACTATATTCAAAGTATGATTN  bay-0.fa
52319  TAATGACGTCGAAGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
52319  TAATGACGTCGAAGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
52319  TAATGACGTCGAAGAAGNNNNNNNAAAGGTTTCTTNTTNNNNNNNRNNNTTATTTGCTNACTATATTCAAAGTATGATTN  bur-0.fa
52319  TAATGACGNCGAAGAAGANGNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTTNTTTNNNNNCTATATTCNANNTNTGNTTN  c24.fa
52319  TAATGACGNCGAAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
52319  TAATGACGNCGAAGAAGANGNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNTATTCANNNNNNNNNNN  cvi-0.fa
52319  TAATGACGTCGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
52319  TAATGACGTCGAAGAAGANGNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNTATATNNNNNNNNNNNNTN  fei-0.fa
52319  TAATGACGTCGAAGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
52319  TAATGACGNCGAAGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
52319  TAATGACGNCGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
52319  TAATGACGTCGAAGAAGANGNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTN  nfa-8.fa
52319  TAATGACGTCGAAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
52319  TAATGACGNCGAAGAAGANGNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
52319  TAATGACGNCGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
52319  TAATGACGNCGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
52319  TAATGACGNCGAAGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
52319  NAATGACGNCGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
52319  TAATGACGTCGAAGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
52399  TTGGTTTTCATTTTTCTCTGTTTTTTTAAAAAAAGAAGAGAGAGAAGAGACGGTGGTTTAGAAAACCGGCGACTCAAGAA  chr1.fa
52399  TTGGTTNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNGACGGTGGTTNAGAAAACCGGCGACTCAAGAA  bay-0.fa
52399  NNNNNNNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNNACGGTGGTTTAGAAAACCGGCGACTCAAGAA  bor-4.fa
52399  NNNNNNNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNNACGGTGGTTTAGAAAACCGGCGACTCAAGAA  br-0.fa
52399  TTGGTTTTCNTTTTTNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNGACGGTGGTTNAGAAAACCGGCGACTCAAGAA  bur-0.fa
52399  TTGGTTNNNNNNTTTNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNGACGGTGGTTNAGAAAANCGGCGACTCAAGAA  c24.fa
52399  NNNNNNNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNNACGGTGGTTTAGAAAACCGGCGACTCAAGAA  col-0.fa
52399  NNNGTNNNNNNNTTTNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNNACGGTGGTTTAGAAAACCGGCGACTCAAGAA  cvi-0.fa
52399  NNNNNNNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNGACGGTGGTTTAGAAAACCGGCGACTCAAGAA  est-1.fa
52399  NNNGTNNNNNNNNTNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNGACGGTGGTNTAGAAAACCGGCGACTCAAGAA  fei-0.fa
52399  NNNNNNNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNGAGACGGTGGTTTAGAAAACCGGCGACTCAAGAA  got-7.fa
52399  NNNNNNNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNNNNGGTGGTTNAGAAAACCGGCGACTCAAGAA  ler-1.fa
52399  NNNNNNNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNNACGGTGGTTNAGAAAACCGGCGACTCAAGAA  lov-5.fa
52399  NNNNTNNNNNNNNTTNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNNACGGTGGTTTAGAAAANCGGCGACTCAAGAA  nfa-8.fa
52399  NNNNNNNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNGAGACGGTGGTTTAGAAAACCGGCGACTCAAGAA  rrs-10.fa
52399  NNNNNNNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNNACGGTGGTTNAGAAAACCGGCGACTCAAGAA  rrs-7.fa
52399  TTGGTTNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNNNNGGTGGTTNAGAAAANCGGCGACTCAAGAA  sha.fa
52399  NNNNNNNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNNANGGNGGTTTAGAAAANCGGCGACTCAAGAA  tamm-2.fa
52399  NNNNNNNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNNNNNNNGNNTNAGAAAACCGGCGACTCAAGAA  ts-1.fa
52399  NNNNNNNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNNNNNNNNGGTTTAGAAAACCGGCGACTCAAGAA  tsu-1.fa
52399  NNNNNNNNNNNNNNNNNNRNNNNNNNNNRNRNNNNNNNNNNNNNNNNAGACGGTGGTTTAGAAAACCGGCGACTCAAGAA  van-0.fa
 
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTTAACGTAAACTCAAAACCCTCTCCGGA  chr1.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACNTCAGGAAGATTCACTTAACGNAAACTCAAAACCCTCNCCGGA  bay-0.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCANTTAACGTAAACTCAAAACCCTCTCCGGA  bor-4.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTTANNNNAAACTCAAAACCCTCTCCGGA  br-0.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTTAACGTAAACTCAAAACCCTCTCCGGA  bur-0.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTTAACGNAAACTCAAAACCCTCTCCGGA  c24.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTTAACGTAAACNCAAAACCCTCTCCGGA  col-0.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTTAACGTAAACTCAAAACCCTCTCCGGA  cvi-0.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTTAACGTAAACTCAAAACCCTCTCCGGA  est-1.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTTAACGTAAACTCAAAACCCTCTCCGGA  fei-0.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGANNNNNNNNNNNNNNNCNCAAAACCCTCTCCGGA  got-7.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTNNNNNNNNACTCAAAACCCTCNCCGGA  ler-1.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTTANCGNAAACTCAAAACCCTCNCCGGA  lov-5.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTTAACGNAAACTCAAAACCCTCNCCGGA  nfa-8.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTTANCGTAAACTCAAAACCCTCTCCGGA  rrs-10.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTTNNNNNNNNCNCAAAACCCTCTCCGGA  rrs-7.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTTAACGNAAACTCAAAACCCTCNCCGGA  sha.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTNANNGNANNCNCAAAACCCTCTCCGGA  tamm-2.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCNCTTAACGNAAACTCAAAACCCTCNCCGGA  ts-1.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGANNNNNNNNNNNNNNNNNNCNCAAAACCCTCTCCGGA  tsu-1.fa
52479  TCTCCGGTGAAGTCTTCCGGTATCTCTCCACCAGCACCTCAGGAAGATTCACTTAACGTAAACTCAAAACCCTCTCCGGA  van-0.fa
 
52559  GACAGCACCGAGTTACGCAACTACGACGCCGCCATCCAACGCCGGTAAACCCCCGTCCGCCGTAGTCCCCATCGCCACGT  chr1.fa
52559  GACAGCACCGAGTTACGCAACTNCGACGCCGCNATCCAACGCCGGNNNNNNNNCGTCCGCCGTNNNNNNNATCGCCACGT  bay-0.fa
52559  GACAGCACCGAGTTACGCANNNNNNACGCCGCCATCCAACGCCGGTAAACCCCCGTCCGCCGTAGTCNCCATCGCCACGT  bor-4.fa
52559  GACAGCACCGAGTTACGCAACTNCGACGCCGCCATCNAACGCCGGNAANCCNCCGTCCGCCGTAGTCNCCATCGCCACGT  br-0.fa
52559  GACAGCACCGAGTTACGCAACTNCGACGCCGCCATCCAACGCCGGTAAACCNCCGTCCGCNNNNNNNNCCATCGCCACGT  bur-0.fa
52559  GACAGCACCGAGTTACGCAACTNCGACGCCGCCATCCAACGCCGGNAANCCNCCGTCCGCCGTNNNNNCCATCGCCACGT  c24.fa
52559  GACAGCACCGAGTTACGCAACTNCGACGCCGCCATCCAACGCCGGNAANCCNCCGTCCGCCGTAGTCNCCATCGCCACGT  col-0.fa
52559  GACAGCACCGAGTTACGCAACTNCGACGCCGCCATCCAACGCCGGNAANCCNCCGTCCGCCGTNNNNNCCATCGCCACGT  cvi-0.fa
52559  GACAGCACCGAGTTACGCAACTNCGACGCCGCCATCCAACGCCGGTAAACCNCCGTCCGCCGTAGTCNCCATCGCCACGT  est-1.fa
52559  GACAGCACCGAGTTACGCAACTNCGACGCCGCCATCCAACGCCGGNAANCCNCCGTCCGCCGTNNNNNCCATCGCCACGT  fei-0.fa
52559  GACAGCACCGAGTTACGCAACTACGACGCCGCCATCCAACGCCGGTAAACCCCCGTCCGCCGTAGTCNCCATCGCCACGT  got-7.fa
52559  GACAGCACCGAGTTACGCAACTACGACGCCGCCATCCAACGCCGGNAAACCCCCGTCCGCCGTAGTCNCCATCGCCACGT  ler-1.fa
52559  GACAGCACCGAGTTACGCAACTACGACGCCGCCATCCAACGCCGGNAANCCNCCGTCCGCCGTNNNNNCCATCGCCACGT  lov-5.fa
52559  GACAGCACCGAGTTACGCAACTNCGACGCCGCCATCCAACGCCGGNAANCCNCCGTCCGCCGTAGTCNCCATCGCCACGT  nfa-8.fa
52559  GACAGCACCGAGTTACGCAACTNCGACGCCGCCATCCAACGCCGGTAAACCNCCGTCCGCCGTAGTCNCCATCGCCACGT  rrs-10.fa
52559  GACAGCACCGAGTTACGCAACTACGACGCCGCCATCCAACGCCGGNAANCCNCCGTCCGCCGTAGTCNCCATCGCCACGT  rrs-7.fa
52559  GACAGCACCGAGTTACGCANNNNNNACGCCGCCATCCAACGCCGGNNNNNNNNCGTCCGCCGTNNNNNCCATCGCCACGT  sha.fa
52559  GACAGCACCGAGTTACGCANNNNNNACGCCGCCATCCAACGCCGGNAANCCNCCGTCCGCCGTNNNNNCCATCGCCACGT  tamm-2.fa
52559  GACAGCACCGAGTTACGCAACTNCGACGCCGCCATCCAACGCNNNNAANCCNCCGTCCGCCGTAGTCNCCATCGCCACGT  ts-1.fa
52559  GACAGCACCGAGTTACGCAACNACGACGCCGCCATCCAACGCCGGNAAACCCCCGTCCGCCGTAGTCNCCATCGCCACGT  tsu-1.fa
52559  GACAGCACCGAGTTACGCAACTNCGACGCCGCCATCCAACGCCGGTAAACCNCCGTCCGCCGTAGTCNCCATCGCCACGT  van-0.fa
 
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  chr1.fa
52639  CAGCATCNAAGACACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  bay-0.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTANNNNNNAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  bor-4.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATNCAGACTTCTTTC  br-0.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  bur-0.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  c24.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  col-0.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  cvi-0.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  est-1.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  fei-0.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTNNNNNNNNGAAAATTACGCTGCTGTTGTCATCCAGACNNNNNNN  got-7.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  ler-1.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTNNNNN  lov-5.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  nfa-8.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTANNNNNNAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTNNN  rrs-10.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACGCNAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  rrs-7.fa
52639  CAGCATCTAAGNCACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  sha.fa
52639  CAGCATCNAAGACACTCGCACCGAGGCGGATTTATTACGCNAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTNNN  tamm-2.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  ts-1.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACNNNNNAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTN  tsu-1.fa
52639  CAGCATCTAAGACACTCGCACCGAGGCGGATTTATTACGCAAGAGAAAATTACGCTGCTGTTGTCATCCAGACTTCTTTC  van-0.fa
 
52719  AGAGGATATTTGGTGAGCAATTATTAATGACCTATATTTTTACTTTCATTTTTTTAACCAACTTGACTTCTAGACCACTT  chr1.fa
52719  AGAGGATATTTGGTGAGCAATTATTAATGACCTATATTTNNNNNNNNNNTRTTTTAACCAACTTGACTTCTAGACCACTT  bay-0.fa
52719  AGNGGATATTTGGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNTGACTTCTAGACCACTT  bor-4.fa
52719  AGAGGATATTTGGTGAGNAATTATNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNGACTTCTAGACCACTT  br-0.fa
52719  AGAGGATATTTGGTGAGCAATTATTAATGACCNATATTTNNNNNNNNNNNRNNTTAACCAACTTGACTTCTAGACCACTT  bur-0.fa
52719  AGAGGATATTTGGTGAGCAATTATTAATGNNNNNNNNNNNNNNNNNNNNNRNNTTAACCAACTTGACTTCTAGACCACTT  c24.fa
52719  AGAGGATATTTGGTGAGCAATTATNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNCTTGACTTCTAGACCACTT  col-0.fa
52719  AGAGGATATTTGGTGAGCAATTATTNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTAACCAACTTGACTTCTAGACCACTT  cvi-0.fa
52719  AGAGGATATTTGGTGAGCNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNTGACTTCTAGACCACTT  est-1.fa
52719  AGAGGATATTTGGTGAGCAATTATTANNNNNNNNNNNNNNNNNNNNNNNNRNNTTAACCAACTTGACTTCTAGACCACTT  fei-0.fa
52719  NNNNNNNNTTNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNCTTNNNNNNNNNNN  got-7.fa
52719  NGAGGATATTTGGTGAGCAATTANNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNGACTTCTAGACCACTT  ler-1.fa
52719  NNNNNATATTTGGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNACTTCTAGACNNNNN  lov-5.fa
52719  AGAGGATATTTGGTGAGCAATTATNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTAACCAACTTGACTTCTAGACCACTT  nfa-8.fa
52719  NGAGGATATTTGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNACTTCTAGACCACTT  rrs-10.fa
52719  AGAGGATATTTGGTGAGNAANTNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNTGACTTCTAGACCANTT  rrs-7.fa
52719  AGAGGATATTTGGTGAGCAATTATTNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTAACCANCTTGACTTCTAGNNNNNNN  sha.fa
52719  NNANGATATTTGGTGAGNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNGACTTNNNNNNNNNNN  tamm-2.fa
52719  AGAGGATATTTGGTGAGCAATTATNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNACTTCTNGACCACTT  ts-1.fa
52719  NNNNNNNNNNTGNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNACTNNNNNNNNNNNN  tsu-1.fa
52719  AGAGGATATTTGGTGAGCAATTANNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNCTTGACTTCTAGACCACTT  van-0.fa
 
52799  TTTAGTGACAATGATGTGTGTCTATGTCTATAAAATTAACATTGCTTATACAAGATCTACCATTTAAAAGATTGGGATTT  chr1.fa
52799  TTTAGTGACAATGATGTGTGTCTATGTCTATAAAATTAACATTGCTTATACAAGATCTACCATTTAAAAGATTGGGATTT  bay-0.fa
52799  TTTAGTGACAATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
52799  TTTAGTGACAATGATGTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
52799  TTTAGTGACAATGATGTGTGTCTATGTCTATAAAATTAACATTGCTTATACAAGATCTACCATTTAAAAGATTGGGATTT  bur-0.fa
52799  TTTAGTGACAATGATGTGTGTCTATGTCTATAAAATTAACATTGCTTATACAAGATCTACCATTTAAAAGATTGGGATTN  c24.fa
52799  TTTAGTGACAATGATGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAANNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
52799  TTTAGTGACAATGATGTGTGTCTATGTCTANAAAATTNANNTNGCTTATACAAGNNNNNNCATTTAAAAGATTGGGANNN  cvi-0.fa
52799  TTTAGTGACAATGATGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAANNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
52799  TTTAGTGACAATGATGTGTGTCTATGTCTATAAAATTANNNNNGCTTATACAAGATCTACCATTTAAAAGATTGNGATTN  fei-0.fa
52799  NNNAGTGACAATGATGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
52799  TTTAGTGACNATGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
52799  NNTAGTGACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
52799  TTTAGTGACAATGATGTGTGTCTATGTCTANAAAATTAACATTGCTTATACAAGANNNNNNATTTAAAAGATTGGNNNNN  nfa-8.fa
52799  TTTAGTGACAATGATGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
52799  TTTAGTGACAATGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
52799  NNNNNNNNNNATGATGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNTATACAAGATNNACCNTTTAAAAGATTGGGNNNN  sha.fa
52799  NNNNNNNNNNNNGATGTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
52799  TTTAGTGACAATGATGTGNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
52799  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
52799  TTTAGTGACAATGATGTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAANNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
52879  CATTTAGATAATTTTTTTTTGGGTCTTGATATAAGTTTTGTTCTTTCTAATTTGGTAAGGCAAGAAGAGCATTAAGAGCA  chr1.fa
52879  CATTNNNNNNNNNTTTTTTNNNNNNNTNNNNNNNNNTTTGTTNTTTCTAATTTGGTAAGGCAAGAAGRRRRRRRRRRRRR  bay-0.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTAAGGCAAGAAGRRRRRRRRRRRRR  bor-4.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGGTAAGGCAAGAAGRRRRRRRRRRRRR  br-0.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTCTAATTTGGTAAGGCAAGNANRRRRRRRRRRRRR  bur-0.fa
52879  NNNNNNNNNNNNNNTTTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGGTAAGGCAAGAAGRRRRRRRRRRRRR  c24.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGGTAAGGCAAGAAGRRRRRRRRRRRRR  col-0.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGGTAAGGCAAGAAGRRRRRRRRRRRRR  cvi-0.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTTGGTAAGGCAAGAAGRRRRRRRRRRRRR  est-1.fa
52879  NNNNNNNNNNNNNNTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNCNAATTTGGTAAGGCAAGAAGRRRRRRRRRRRRR  fei-0.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAAGNNGRRRRRRRRRRRRR  got-7.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGGTAAGGCAAGAAGRRRRRRRRRRRRR  ler-1.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGNAAGGCAAGNNNRRRRRRRRRRRRR  lov-5.fa
52879  NNNNNNNNNNNNNNTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGGTAAGGCAAGAAGRRRRRRRRRRRRR  nfa-8.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGTAAGGCAAGAAGRRRRRRRRRRRRR  rrs-10.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGTAAGGCAAGAAGRRRRRRRRRRRRR  rrs-7.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGTAAGGCAAGAAGRRRRRRRRRRRRR  sha.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTAAGGCAAGAAGRRRRRRRRRRRRR  tamm-2.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTAAGGCAAGAAGRRRRRRRRRRRRR  ts-1.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGCAAGANGRRRRRRRRRRRRR  tsu-1.fa
52879  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGTAAGGCAAGAAGRRRRRRRRRRRRR  van-0.fa
 
52959  TTAAAAGGGTTAGTGAAGCTACAAGCATTGGTGAGGGGACATAATGTGAGAAAGCAAGCTAAAATGACATTAAGGTGTAT  chr1.fa
52959  RRRRRRRGGTTAGTGAAGCTACRAGCATTGGTGAGGGGACATAATGTGAGAAAGCAAGCTAAAATGACATTAAGGRRTAT  bay-0.fa
52959  RRRRRRRNNTTAGTGAAGCTACRAGCATTGGTGAGGGGACATAATGTGAGAAAGCAAGCTAAAATGACATTAAGGRRTAT  bor-4.fa
52959  RRRRRRRGGTTAGTGAAGCTACRAGCATTGGTGAGGGGACANAATGTGAGAAAGCAAGCTAAAATGACATTAAGGRRTAT  br-0.fa
52959  RRRRRRRGGTTAGTGAAGCTACRAGCATTGGTGAGGGGACATAATGTGAGAAAGCAAGCTAAAATGACATTAAGGRRTAT  bur-0.fa
52959  RRRRRRRGGTTAGTGAAGCTACRAGCATTGGTGAGGGGACATAATGTGAGAAAGCAAGCTAAAATGACATNAAGGRRTAT  c24.fa
52959  RRRRRRRGGTTAGTGAAGCTACRAGCATTGGTGAGGGGACATAATGTGAGAAAGCAAGCTAAAATGACATTAAGGRRTAT  col-0.fa
52959  RRRRRRRGGTTAGTGAAGCTACRAGCATTGGTGAGGGGACATAATGTGAGAAAGCAAGCTAAAATGACATTAAGGRRTAT  cvi-0.fa
52959  RRRRRRRGGTTAGTGAAGCTACRAGCATTGGTGAGGGGACATAATGTGAGAAAGCAAGCTAAAATGACATTAAGGRRTAT  est-1.fa
52959  RRRRRRRGGTTAGTGAAGCTACRAGCATTGGTGAGGGGACATAATGTGAGAAAGCAAGCTAAAATGACATTAAGGRRTAT  fei-0.fa
52959  RRRRRRRNNNNNNNGAAGCNACRAGCATTGGTGAGGGGACANANTGTGAGAAAGCANNNNNNNNNNNCATTAANNRRTAT  got-7.fa
52959  RRRRRRRNNNTAGTGAAGCNANRNGNATTGGTGAGGGGACATAATGTGAGAAAGCAAGCTAAAATGACNTTANGNRRTAT  ler-1.fa
52959  RRRRRRRNNNTAGTGAAGCNNCRNNNATTGGTGAGGGGACNNNNNGNNAGNNNNCAAGCTAAAATNNNNNNNNNNRRTAT  lov-5.fa
52959  RRRRRRRGGTTAGTGAAGCTACRAGCATTGGTGAGGGGACATAATGTGAGAAAGCAAGCTAAAATGACATTAAGGRRTAT  nfa-8.fa
52959  RRRRRRRGGTTAGTGAAGCTACRAGCATTGGTGAGGGGACATAATNTGAGAAANCAAGCTAAAATGACATTAAGGRRTAT  rrs-10.fa
52959  RRRRRRRGNNTAGTGAAGCTACRAGCATTGGTGAGGGGACATAATGTGAGAAAGCAAGCTAAAATGACATTAAGGRRTAT  rrs-7.fa
52959  RRRRRRRGGTTAGTGAAGCTNCRAGCATTGGTGAGGGGACATAATGTGAGAAAGCAANNNNNNNNNNNGNNNNNNRRTAT  sha.fa
52959  RRRRRRRNNNTAGTGANGCNNNRNNNATTGGTGAGGGGACATAATGTGAGAAAGNNNNNNNNNNNNNNNNNNNNNRRNNT  tamm-2.fa
52959  RRRRRRRGNNTAGTGAAGCNNCRAGCATTGGTGAGGGGACATAATGTGAGAAAGCAAGCNAAAATGACATTANGGRRNNT  ts-1.fa
52959  RRRRRRRNNNNNNNNNNNNNNNRNNNATTGGTGAGGGGACNNNNNNNGAGANNNNNNNCNNNNNNNNNNNNANNGRRTNN  tsu-1.fa
52959  RRRRRRRGGTTAGTGAAGCNNNRAGNNTTGGTGAGGGGACATAATGTGAGAAAGCAAGCTAAAATGACATTAAGGRRTAT  van-0.fa
 
53039  GCAAGCTCTGGTTCGAGTCCAGTCTCGTGTGCTTGACCAACGCAAACGCTTGTCTCATGACGGTAGTCGCAAATCCGCGT  chr1.fa
53039  GRRRRRRRRRNTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGNRGGTAGTCGCAAATCCGCGT  bay-0.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGGTAGTCGCAAATCCGCGT  bor-4.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGGNAGTCGCAAATCCGCGT  br-0.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGNRGGTAGNCGCAAATCCGCGT  bur-0.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGGTAGTCGCAAATCCGCGT  c24.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGGTAGTCGCAAATCCGCGT  col-0.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGGTAGTCGCAAATCCGCGT  cvi-0.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGGTAGTCGCAAATCCGCGT  est-1.fa
53039  GRRRRRRRRRGTTCGAGTCCNRRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGNRGGTAGTCGCAAATCCGCGT  fei-0.fa
53039  NRRRRRRRRRGTTCGAGTCCNRRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGGTAGTCGCAAATCCGCGT  got-7.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGGTAGTCGCAAATCCGCGT  ler-1.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGNRGGTAGTCGCAAATCCGCGT  lov-5.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGGTAGTCGCAAATCCGCGT  nfa-8.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGGTAGTCGCAAATCCGCGT  rrs-10.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGGTAGTCGCAAATCCGCGT  rrs-7.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGGTAGTCGCAAATCCGCGT  sha.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRNCTTRRRRRRRRRRRNCGCTTGTCNCARGNRGGTAGTCGCAAATCCGCGT  tamm-2.fa
53039  GRRRRRRRRRNTTCGAGTCCNRRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGNRGGTAGTCGCAAATCCGCGT  ts-1.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGGTAGTCGCAAATCCGCGT  tsu-1.fa
53039  GRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGGTAGTCGCAAATCCGCGT  van-0.fa
 
53119  TCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCATGGTTAGTATAGCCTCC  chr1.fa
53119  TCAGTGACTCTCACGCNGTTTTTGAATCTCGCTATCTTCAAGATTTGNCAGATCGACAATCCATGGTTAGTATAGCCTCC  bay-0.fa
53119  TCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATNNNNNNNNNNNTNNNNNNNNNNCCTCC  bor-4.fa
53119  TCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCATGGTTAGTATAGCCTCC  br-0.fa
53119  TCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGNCAGATCGACAATCCATGGTTAGTATAGCCTCC  bur-0.fa
53119  TCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCATGGTTAGTATAGCCTCC  c24.fa
53119  TCAGTGACTCTCNCGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCATGGTTAGTATAGCCTCC  col-0.fa
53119  TCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCATGGTTAGTATAGCCTCC  cvi-0.fa
53119  TCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCATGGTTAGTATAGCCTCC  est-1.fa
53119  TCAGTGACTCTCACGCNGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCATGGTTAGTATAGCCTCC  fei-0.fa
53119  TCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCNNNNNGACAATCCATGGTTAGTATAGCCTCC  got-7.fa
53119  TCAGTGACTCTCANNNNGTTTTTGAATCTCGCTNTCTTCAAGATTTGTNNNNNNGACAATCCATGGTTAGTATAGCCTCC  ler-1.fa
53119  TCAGTGACTCTCACGCNGTTTTTGAATCTCGCTATCTTCAAGNTTNNNNNNNNCGACAATCCATGGTTAGTATAGCCTCC  lov-5.fa
53119  TCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCATGGTTAGTATAGCCTCC  nfa-8.fa
53119  TCAGTGACTCTCACGCNGTTTTTGAATCTCGCTATCTTCAAGNTTTGTCAGATCGACAATCCATGGTTAGTATAGCCTCC  rrs-10.fa
53119  TCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCANNNNNNNNNNNNNNTNNNNNNNNNNNCTCC  rrs-7.fa
53119  TCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCATGGTTAGTATAGCCTCC  sha.fa
53119  TCAGTGACTCTCACGCNGTTTTTGAATCTCGCTATCTTCAAGATTTGTCNNNNNNACAATCCATGGTTAGTATAGCCTCC  tamm-2.fa
53119  TCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGNCAGATCGACAATCCATGGTTAGTATAGCCTCC  ts-1.fa
53119  TCAGTGACTCTCACGCNGTTTTTGAATCTCNNNNNNTTCAAGNTTTGTNNNNNNNACAATCCATGGTTAGTATAGCCTCC  tsu-1.fa
53119  TCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCATGGTTAGTATAGCCTCC  van-0.fa
 
53199  TAGGCCTTGCCTAAACTATAGCATAATCAATTGATATGTTTTTTAGTTATAGACATGTTTTGCTTTTTAGTTTATTCATA  chr1.fa
53199  TAGGCCTTGCCTAAACTATAGCATNNNNNNNTGATATGTTTTTTAGTNNNNNNNNTGTTTTGNTTNTTNGTTTATTCATA  bay-0.fa
53199  TAGGCCTTGCCTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
53199  TAGGCCTTGCCTAAACTATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
53199  TAGGCCTTGCCTAAACTATAGCATANNNNNNNGATATGTTTTNTAGTTATAGACNTGTTTTGCTTTTTNGTNTANTCATA  bur-0.fa
53199  TAGGCCTTGCCTAAACTATAGCATNNNNNNNNNATNNNNTTNTTNNNNNTANACNTGTTTTGCTTNNNNNNNNNNNNATA  c24.fa
53199  TAGGCCTTGCCTAAACTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
53199  TAGGCCTTGCCTAAACTATAGCANNNNNNNNNNNNNNNNNTTNTNNNNNNNNNNNNNNTTTGNTNNNNNNNNNNNNNNTA  cvi-0.fa
53199  TAGGCCTTGCCTAAACTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
53199  TAGGCCTTGCCTAAACTATAGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGCTTTTTNGNNNNNNNNTA  fei-0.fa
53199  TAGGCCTTGCCTAAACTNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
53199  TAGGCCTTGCCTAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
53199  TAGGCCTTGCCTAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
53199  TAGGCCTTGCCTAAACTATAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGCTTNNNNNNNNNNNNNNN  nfa-8.fa
53199  TAGGCCTTGCCTAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
53199  TAGGCCTTGCCTAAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
53199  TAGGCCTTGCCTAAACTATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGCNNNNNNNNNNNNNNNNN  sha.fa
53199  TAGGCCTTGCCTAAACTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
53199  TAGGCCTTGCCTAAACTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGNTNNNNNNNNNNNNNNNN  ts-1.fa
53199  TAGGCCTTGCCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
53199  TAGGCCTTGCCTAAACTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
53279  AGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTATTTCTTTACTCTT  chr1.fa
53279  AGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTATTTCTTTACTCTT  bay-0.fa
53279  NNNNNNNNCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGNNNNNNNNNNNNNNNNN  bor-4.fa
53279  NNNNNNAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCNTGNNNNNNNNNNNNNNNNN  br-0.fa
53279  AGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTATTTCTTTACTCTT  bur-0.fa
53279  AGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTATTTCTTTNCTNNN  c24.fa
53279  NNNNNNAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTNTNNNNNNNNNNNN  col-0.fa
53279  AGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTATTTCNNNNNNNNN  cvi-0.fa
53279  NNNNNNNGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTNNNNNNNNNNNNNN  est-1.fa
53279  AGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTATTTNNNNNNNNNN  fei-0.fa
53279  NNNNNNNNNNNNTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTNNNNNNNNNNNNNN  got-7.fa
53279  NNNNNAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTNNNNNNNNNNNNNN  ler-1.fa
53279  NNNNNNNNCTGTTTTTAGCATGCNTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTATNNNNNNNNNNNN  lov-5.fa
53279  AGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTATNNNNNNNNNNNN  nfa-8.fa
53279  NNNNNNNGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTNNNNNNNNNNNNNN  rrs-10.fa
53279  NNNNNNAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTNNNNNNNNNNNNNN  rrs-7.fa
53279  AGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTATTTCTNNNNNNNN  sha.fa
53279  NNNNNNNGCTGTTTTTAGCATGCCNATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGNNNNNNNNNNNNNNNNN  tamm-2.fa
53279  NNNNNNAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTNNNNNNNNNNNNNN  ts-1.fa
53279  NNNNNNNNNNNTTTTTAGCATNNNNNNNNAGTTCAAATGGTGCATTCACANAGGTGTGCCTTGNNNNNNNNNNNNNNNNN  tsu-1.fa
53279  NNNNNNAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTGATTNNNNNNNNNNNNNN  van-0.fa
 
53359  AGGTATACATATTTTGTATATTTTTCAATCTTTAAGCAATTCTGTTTTTGTTAATTGTAAATTGCGTTTGTAATTTCATA  chr1.fa
53359  AGGTATACATNTNNNNNNNATTTTTCAATCTTTAAGCAATTNTGTTTTTGTTNATTGTAAATTGCGTTTGTAATTTCATA  bay-0.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCNTA  bor-4.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNTTGCGTTTNNNNNNTCATA  br-0.fa
53359  AGGTATANNNNNNTTGTATNTTTTTCAATCTTTAAGCAATTCTGTTTTTGTNNATTGTAAATTGCGTTTGTAATTTCATA  bur-0.fa
53359  NNNNNNNNNNNNNNNNNNNNTTTTTCAATCTTTAAGCAATTCTGTTTTTGTTNATTGTAAATTGCGTTTGTAATTTCATA  c24.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTNNNNNNNNNNNNNNNNCGTTTGNNNNNTCATA  col-0.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNATNTTNAANNAATTNTGTTTNNNNNNNNNGTAAATTGCGTTTGTAATTTCATA  cvi-0.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGTAATTTCATA  est-1.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNATCTTNNNNNANTTNTGTTNTNNNNAATTGTAAATTGCGTTTGTAATTTCATA  fei-0.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCNTTNGTAATTTCATA  ler-1.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNGTAATTTCATA  lov-5.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTNTGTTTTNNNNNNNNGTAAATTGCGTTTGTAATTTCATA  nfa-8.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTTTGTAATTTCATA  rrs-10.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTAATTTCNTA  rrs-7.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNTGTTTTNNNNNNNNGTAAATTGCGTTTGTAATTTCATA  sha.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTNNNNNNNNCNTA  ts-1.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
53359  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTGCGTTTGTAATTTCATA  van-0.fa
 
53439  TGGTGGCTAACGTCTTTTGGAATTATGGTTATTTATTTGTTGTAGTCAAGAGAAGGAAGCAGCGCCGCGGAAGATTGGGA  chr1.fa
53439  TGGTGGCTAACGTCTTTTGGAATTNTGNTTNNNNNNNTGTTGTAGTCAAGAGAAGGAAGCAGCGCCGCGGAAGATTNNRR  bay-0.fa
53439  TGGTGGCTAACGTCTNTTNNNNNNNNNNNNNNNNNNNNNNNNNAGTCAAGAGAAGGAAGCAGCGCCGCGGAAGATTGGRR  bor-4.fa
53439  TGGTGGCTAACGTCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNGTCAAGAGAAGGAAGCAGCGCCGCGGAAGATTGGRR  br-0.fa
53439  TGGTGGCTAACGTCTTTTGGAATTNTNNNNNNNNNNNTGTTGTAGTCAAGAGAAGGAAGCAGCGCCGCGGAAGATTGGRR  bur-0.fa
53439  TGGTGGCTAACGTCTTTTGGAATTNTGNNNNNNNNNNTGTTGTAGTCAAGAGAAGGAAGCAGCGCCGCGGAAGATTGGRR  c24.fa
53439  TGGTGGCTAACGTCTTTTGGNNNNNNNNNNNNNNNNNNNNNNNNGTCAAGAGAAGGAAGCAGCGCCGCGGAAGATTGGRR  col-0.fa
53439  TGGTGGCTAACGTCTTTTGGAANNNNNNNNNNNNNNNTGTTGTAGTCAAGAGAAGGAAGCAGCGCCGCGGAAGATTGNRR  cvi-0.fa
53439  TGGTGGCTAACGTCTTTTGGNNNNNNNNNNNNNNNNNNNNNNNAGTCAAGAGAAGGAAGCAGCGCCGCGGAAGATTGGRR  est-1.fa
53439  TGGTGGCTAACGTCTTTTGGANNNNNNNNNNNNNNNNTGTTGTAGTCAAGAGAAGGAAGCAGCGCCGCGGAAGATNGNRR  fei-0.fa
53439  TGGTGGCTAACGTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGAAGGAAGCAGCGCCGCGGAAGATTGGRR  got-7.fa
53439  TGGTGGCTAACGTCTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAGAAGGAAGCAGCGCCGCGGAAGATTGGRR  ler-1.fa
53439  TGGTGGCTAACGTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGAAGGAAGCAGCGCCGCGGAAGATTGGRR  lov-5.fa
53439  TGGTGGCTAACGTCTTTTGGANNNNNNNNNNNNNNNNNGTNGTAGTCAAGAGAAGGAAGCAGCGCCGCGGAAGATTGNRR  nfa-8.fa
53439  TGGTGGCTAACGTCTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAGAAGGAAGCAGCGCCGCGGAAGATTGGRR  rrs-10.fa
53439  TGGTGGCTAACGTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGAAGGAAGCAGCGCCGCGGAAGATTGGRR  rrs-7.fa
53439  TGGTGGCTAACGTCTTTTGGNNNNNNNNNNNNNNNNNNNNNGTAGTCAAGAGAAGGAAGCAGCGCCGCGGAAGATTGNRR  sha.fa
53439  TGGTGGCTAACGTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGAAGGAAGCAGCGCCGCGGAAGATTGNRR  tamm-2.fa
53439  TGGTGGCTAACGTCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAGAAGGAAGCAGCGCCGCGGAAGATTGNRR  ts-1.fa
53439  NNGTGNNNNNCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAAGGAAGCAGCGCCGCGGAAGATTGGRR  tsu-1.fa
53439  TGGTGGCTAACGTCTTTTGGNNNNNNNNNNNNNNNNNNNNNNNAGTCAAGAGAAGGAAGCAGCGCCGCGGAAGATTGGRR  van-0.fa
 
53519  TGACCGACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACAAGACTA  chr1.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACAAGACTA  bay-0.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACAAGACTA  bor-4.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCNTTGAGACNTGACAAGACTA  br-0.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACAAGACTA  bur-0.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACAAGACTA  c24.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACAAGACTA  col-0.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACAAGACTA  cvi-0.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACAAGACTA  est-1.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACAAGACTA  fei-0.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACNNNNNNN  got-7.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATNNNNNNNNNN  ler-1.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACANNNNNN  lov-5.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACAAGACTA  nfa-8.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGNNNNNNNNN  rrs-10.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACAAGACNA  rrs-7.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACAAGACNA  sha.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACAAGNCTA  tamm-2.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGANGCTACAACGGAGACGGGACACAGCATTGAGNCANGANAAGACNA  ts-1.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACANNNNNNNNNNN  tsu-1.fa
53519  RRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATTGAGACATGACAAGACTA  van-0.fa
 
53599  ATTTGTCACAAGCTTTCTCTCAAAAGGTAAAATTAATTAAACCGGCATATAGTCTGTTATATATATTGAGCTTGTTGATA  chr1.fa
53599  ATTTGTCACNAGCTTTCTCTCAAAAGGTAAAATTAATTAAACCGGCATATAGTCTGTTATATATATTGAGCTTGTTGATA  bay-0.fa
53599  ATTTGTCACAAGCTTTCTNNNNNNNNNNNNNNNNNATTAAACCGGCATATAGNNNNNNNNNNNNNNNNNNNNNNTTGATA  bor-4.fa
53599  ATTTGTCACNNNNNNNCTCTCANNNNNNNNNNNNNATTAAACCGGCATATAGTNNNNNNNNNNNNNNNNNCTTGTTGATA  br-0.fa
53599  ATTTGTCACNAGCTTTCTCTCAAAAGGTAAAATTAATTAAACCGGCATATAGTCTGTTATATATATTGAGCTTGTTGATA  bur-0.fa
53599  ATTTGTCACAAGCTTTCTCTCAAAAGGNAAAATTAATTAAACCGGCATATAGTNNNNNNNNNATATTGAGCTTGTTGATA  c24.fa
53599  ATTTGTCACNAGCTTTCTCTCANNNNNNNNNATTAATTAAACCGGCATATAGNNNNNNNNNNNNNNNNNNCTTGTTGATA  col-0.fa
53599  ATTTGTCACNAGCTTTCTCTCAAAANNNNNNATTAATTAAACCGGCATATAGTCNNNNNNNNNTATTGAGCTTGTTGATA  cvi-0.fa
53599  ATTTGTCACAAGCTTTCTCTCAANNNNNNNNNNNNATTAAACCGGCATATAGTCNNNNNNNNNNNNNNNNNTTGTTGATA  est-1.fa
53599  ATTTGTCACAAGCTTTCTCTCAANNNNNNNAATTAATTAAACCGGCATATAGTCNNNNNNNTATATTGAGCTTGTTGATA  fei-0.fa
53599  NNTTGTCACNNNNNTTCTCNNNNNNNNNNNNNNNNNNNNNNNNGGCATATNNNNNNNNNNNNNNNNNNNNNNNNTTGATA  got-7.fa
53599  NNNTNNCNCNAGCTNTCNCTNNNNNNNNNNNNNNNATTAAACCGGCATATANNNNNNNNNNNNNNNNNNNCTTGTTGATA  ler-1.fa
53599  NNNNNTCACNAGCTTTCTCNNNNNNNNNNNNNNNAATTAAACCGGCATATANNNNNNNNNNNNNNNNNNNNNNNNTGATA  lov-5.fa
53599  ATTTGTCACAAGCTTTCTCTCAAAANNNNNNNTTAATTAAACCGGCATATAGTNNNNNNNNNNNNNTGAGCTTGTTGATA  nfa-8.fa
53599  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAANCCGGCATANNNNNNNNNNNNNNNNNNNNNNNTGTTGATA  rrs-10.fa
53599  ATTTGTCACNAGCTTTCTCTCNNNNNNNNNNNNNNNTTAAACCGGCATATANNNNNNNNNNNNNNNNNNNNTTGTTGATA  rrs-7.fa
53599  ATTTGNCACAAGCTTTCTCTCAAANNNNNNNNTTAATTAAACCGGCATATAGTNNNNNNNNNNTATTGAGCTTGTTGATA  sha.fa
53599  ANNNGTCACNAGCTTTCTCNNNNNNNNNNNNNNTAATTAAACCGGCATATANNNNNNNNNNNNNNNNNNNNNTGTTGATA  tamm-2.fa
53599  ATTNGTNACNAGCTTTCNCTCAAANNNNNNNNTTAATTAAACCGGCATATAGNNNNNNNNNNNNNNNNNNCTTGTTGATA  ts-1.fa
53599  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCATANNNNNNNNNNNNNNNNNNNNNNNNNTTGANN  tsu-1.fa
53599  ATTTGTCACAAGCTTTCTCTCAANNNNNNNNNNNNATTAAACCGGCATATAGNNNNNNNNNNNNNNNNNNNTTGTTGATA  van-0.fa
 
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  chr1.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATNTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  bay-0.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACNANNCTACGGAAGGACACCACGAGGTAGAACTTGA  bor-4.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  br-0.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  bur-0.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  c24.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  col-0.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  cvi-0.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  est-1.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  fei-0.fa
53679  NCATCGTTTCGTTTCAATGGNAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  got-7.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  ler-1.fa
53679  ACATCGTTTCGTTTCAATGGNAAGATGTGNAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  lov-5.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  nfa-8.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  rrs-10.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACNANNNTACGGAAGGACACCACGAGGTAGAACTTGA  rrs-7.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  sha.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  tamm-2.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  ts-1.fa
53679  NNNNCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  tsu-1.fa
53679  ACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACACCACGAGGTAGAACTTGA  van-0.fa
 
53759  AGAGGAAAGGCCAAAATGGCTTGACCGGTGGATGGCTACTAGACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  chr1.fa
53759  AGAGGAAAGGCCAAAATGGCTTGANCRRTGGATGGCTACTNRACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  bay-0.fa
53759  AGAGGAAAGGCCAAAATGGCTTGANCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  bor-4.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  br-0.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  bur-0.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  c24.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  col-0.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  cvi-0.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  est-1.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  fei-0.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACNGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  got-7.fa
53759  AGAGGAAAGGCCAAAATGGCTTGANCRRTGGATGGCTACNARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  ler-1.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACNARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  lov-5.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  nfa-8.fa
53759  AGAGGAAAGGCCAAAATGGCTTGANCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  rrs-10.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  rrs-7.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTNRACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  sha.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  tamm-2.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  ts-1.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCNAGTAGTAGAGCTTCGGTTG  tsu-1.fa
53759  AGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAGTAGTAGAGCTTCGGTTG  van-0.fa
 
53839  ACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAGCAGGAAGCCCGAGTCGT  chr1.fa
53839  ACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAGCAGGAAGCCCGAGTCGT  bay-0.fa
53839  ACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAANNNNNNNNANNNNNAGCCCGAGTCGT  bor-4.fa
53839  ACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAGCAGGAAGCCCGAGTCGT  br-0.fa
53839  ACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAGCAGGAAGCCCGAGTCGT  bur-0.fa
53839  ACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAGCAGGAAGCCCGAGTCGT  c24.fa
53839  ACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAGCAGGAAGCCCGAGTCGT  col-0.fa
53839  ACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAGCAGGAAGCCCGAGTCGT  cvi-0.fa
53839  ACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAGCAGGAAGCCCGAGTCGT  est-1.fa
53839  ACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAGCAGGAAGCCCGAGTCGT  fei-0.fa
53839  ACCAAAGGGTNTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAGCAGGAAGCCCGAGTCGT  got-7.fa
53839  ACCAAAGGGTNTNNGNTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAGCAGGAAGCCCGAGTCGT  ler-1.fa
53839  ACCAAAGGGTTTCAGTNAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAGCAGGAAGCCCGAGTCGT  lov-5.fa
53839  ACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAGCAGGAAGCCCGAGTCGT  nfa-8.fa
53839  ACCAAAGGGTTTCNGTTAAANCCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAGCAGGAAGCCCGAGTCGT  rrs-10.fa
53839  ACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGNNNNNNNANNNGAAGCCCGAGTCGT  rrs-7.fa
53839  ACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGNNNNNNNANNNNAAGCCCGAGTCGT  sha.fa
53839  ACCAAAGGGTTTCAGTTAAAACCGNTGAAATCGACACTTCTCAGCCTTACTCAANNNNNNNNANN