Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 53022 - 54494


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
53022  ATGACATTAAGGTGTATGCAAGCTCTGGTTCGAGTCCAGTCTCGTGTGCTTGACCAACGCAAACGCTTGTCTCATGACGG  chr1.fa
53022  ATGACATTAAGGRRTATGRRRRRRRRRNTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGNRGG  bay-0.fa
53022  ATGACATTAAGGRRTATGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGG  bor-4.fa
53022  ATGACATTAAGGRRTATGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGG  br-0.fa
53022  ATGACATTAAGGRRTATGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGNRGG  bur-0.fa
53022  ATGACATNAAGGRRTATGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGG  c24.fa
53022  ATGACATTAAGGRRTATGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGG  col-0.fa
53022  ATGACATTAAGGRRTATGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGG  cvi-0.fa
53022  ATGACATTAAGGRRTATGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGG  est-1.fa
53022  ATGACATTAAGGRRTATGRRRRRRRRRGTTCGAGTCCNRRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGNRGG  fei-0.fa
53022  NNNNCATTAANNRRTATNRRRRRRRRRGTTCGAGTCCNRRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGG  got-7.fa
53022  ATGACNTTANGNRRTATGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGG  ler-1.fa
53022  ATNNNNNNNNNNRRTATGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGNRGG  lov-5.fa
53022  ATGACATTAAGGRRTATGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGG  nfa-8.fa
53022  ATGACATTAAGGRRTATGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGG  rrs-10.fa
53022  ATGACATTAAGGRRTATGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGG  rrs-7.fa
53022  NNNNNGNNNNNNRRTATGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGG  sha.fa
53022  NNNNNNNNNNNNRRNNTGRRRRRRRRRGTTCGAGTCCARRRRRRRRRNCTTRRRRRRRRRRRNCGCTTGTCNCARGNRGG  tamm-2.fa
53022  ATGACATTANGGRRNNTGRRRRRRRRRNTTCGAGTCCNRRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGNRGG  ts-1.fa
53022  NNNNNNNNANNGRRTNNGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGG  tsu-1.fa
53022  ATGACATTAAGGRRTATGRRRRRRRRRGTTCGAGTCCARRRRRRRRRGCTTRRRRRRRRRRRACGCTTGTCTCARGARGG  van-0.fa
 
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCA  chr1.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCNGTTTTTGAATCTCGCTATCTTCAAGATTTGNCAGATCGACAATCCA  bay-0.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATNNNNNNNNNN  bor-4.fa
53102  NAGTCGCAAATCCGCGTTCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCA  br-0.fa
53102  TAGNCGCAAATCCGCGTTCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGNCAGATCGACAATCCA  bur-0.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCA  c24.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCNCGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCA  col-0.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCA  cvi-0.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCA  est-1.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCNGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCA  fei-0.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCNNNNNGACAATCCA  got-7.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCANNNNGTTTTTGAATCTCGCTNTCTTCAAGATTTGTNNNNNNGACAATCCA  ler-1.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCNGTTTTTGAATCTCGCTATCTTCAAGNTTNNNNNNNNCGACAATCCA  lov-5.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCA  nfa-8.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCNGTTTTTGAATCTCGCTATCTTCAAGNTTTGTCAGATCGACAATCCA  rrs-10.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCANNNNNNNNNNNNN  rrs-7.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCA  sha.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCNGTTTTTGAATCTCGCTATCTTCAAGATTTGTCNNNNNNACAATCCA  tamm-2.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGNCAGATCGACAATCCA  ts-1.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCNGTTTTTGAATCTCNNNNNNTTCAAGNTTTGTNNNNNNNACAATCCA  tsu-1.fa
53102  TAGTCGCAAATCCGCGTTCAGTGACTCTCACGCTGTTTTTGAATCTCGCTATCTTCAAGATTTGTCAGATCGACAATCCA  van-0.fa
 
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTATAGCATAATCAATTGATATGTTTTTTAGTTATAGACATGTTTTGC  chr1.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTATAGCATNNNNNNNTGATATGTTTTTTAGTNNNNNNNNTGTTTTGN  bay-0.fa
53182  NTNNNNNNNNNNCCTCCTAGGCCTTGCCTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTATAGCATANNNNNNNGATATGTTTTNTAGTTATAGACNTGTTTTGC  bur-0.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTATAGCATNNNNNNNNNATNNNNTTNTTNNNNNTANACNTGTTTTGC  c24.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTATAGCANNNNNNNNNNNNNNNNNTTNTNNNNNNNNNNNNNNTTTGN  cvi-0.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTATAGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGC  fei-0.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTATAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGC  nfa-8.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
53182  NTNNNNNNNNNNNCTCCTAGGCCTTGCCTAAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGC  sha.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGN  ts-1.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
53182  TGGTTAGTATAGCCTCCTAGGCCTTGCCTAAACTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
53262  TTTTTAGTTTATTCATAAGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  chr1.fa
53262  TTNTTNGTTTATTCATAAGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  bay-0.fa
53262  NNNNNNNNNNNNNNNNNNNNNNNNNCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  bor-4.fa
53262  NNNNNNNNNNNNNNNNNNNNNNNAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCNTG  br-0.fa
53262  TTTTTNGTNTANTCATAAGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  bur-0.fa
53262  TTNNNNNNNNNNNNATAAGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  c24.fa
53262  NNNNNNNNNNNNNNNNNNNNNNNAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  col-0.fa
53262  TNNNNNNNNNNNNNNTAAGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  cvi-0.fa
53262  NNNNNNNNNNNNNNNNNNNNNNNNGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  est-1.fa
53262  TTTTTNGNNNNNNNNTAAGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  fei-0.fa
53262  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  got-7.fa
53262  NNNNNNNNNNNNNNNNNNNNNNAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  ler-1.fa
53262  NNNNNNNNNNNNNNNNNNNNNNNNNCTGTTTTTAGCATGCNTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  lov-5.fa
53262  TTNNNNNNNNNNNNNNNAGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  nfa-8.fa
53262  NNNNNNNNNNNNNNNNNNNNNNNNGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  rrs-10.fa
53262  NNNNNNNNNNNNNNNNNNNNNNNAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  rrs-7.fa
53262  NNNNNNNNNNNNNNNNNAGGTTAAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  sha.fa
53262  NNNNNNNNNNNNNNNNNNNNNNNNGCTGTTTTTAGCATGCCNATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  tamm-2.fa
53262  TNNNNNNNNNNNNNNNNNNNNNNAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  ts-1.fa
53262  NNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTAGCATNNNNNNNNAGTTCAAATGGTGCATTCACANAGGTGTGCCTTG  tsu-1.fa
53262  NNNNNNNNNNNNNNNNNNNNNNNAGCTGTTTTTAGCATGCCTATCTAGTTCAAATGGTGCATTCACATAGGTGTGCCTTG  van-0.fa
 
53342  ATTATTTCTTTACTCTTAGGTATACATATTTTGTATATTTTTCAATCTTTAAGCAATTCTGTTTTTGTTAATTGTAAATT  chr1.fa
53342  ATTATTTCTTTACTCTTAGGTATACATNTNNNNNNNATTTTTCAATCTTTAAGCAATTNTGTTTTTGTTNATTGTAAATT  bay-0.fa
53342  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
53342  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNTT  br-0.fa
53342  ATTATTTCTTTACTCTTAGGTATANNNNNNTTGTATNTTTTTCAATCTTTAAGCAATTCTGTTTTTGTNNATTGTAAATT  bur-0.fa
53342  ATTATTTCTTTNCTNNNNNNNNNNNNNNNNNNNNNNNTTTTTCAATCTTTAAGCAATTCTGTTTTTGTTNATTGTAAATT  c24.fa
53342  ATTNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTNNNNNNNNNNNNNNN  col-0.fa
53342  ATTATTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATNTTNAANNAATTNTGTTTNNNNNNNNNGTAAATT  cvi-0.fa
53342  ATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
53342  ATTATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTTNNNNNANTTNTGTTNTNNNNAATTGTAAATT  fei-0.fa
53342  ATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
53342  ATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
53342  ATTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
53342  ATTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTNTGTTTTNNNNNNNNGTAAATT  nfa-8.fa
53342  ATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
53342  ATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
53342  ATTATTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNTGTTTTNNNNNNNNGTAAATT  sha.fa
53342  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
53342  ATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
53342  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
53342  ATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATT  van-0.fa
 
53422  GCGTTTGTAATTTCATATGGTGGCTAACGTCTTTTGGAATTATGGTTATTTATTTGTTGTAGTCAAGAGAAGGAAGCAGC  chr1.fa
53422  GCGTTTGTAATTTCATATGGTGGCTAACGTCTTTTGGAATTNTGNTTNNNNNNNTGTTGTAGTCAAGAGAAGGAAGCAGC  bay-0.fa
53422  NNNNNNNNNNNNTCNTATGGTGGCTAACGTCTNTTNNNNNNNNNNNNNNNNNNNNNNNNNAGTCAAGAGAAGGAAGCAGC  bor-4.fa
53422  GCGTTTNNNNNNTCATATGGTGGCTAACGTCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNGTCAAGAGAAGGAAGCAGC  br-0.fa
53422  GCGTTTGTAATTTCATATGGTGGCTAACGTCTTTTGGAATTNTNNNNNNNNNNNTGTTGTAGTCAAGAGAAGGAAGCAGC  bur-0.fa
53422  GCGTTTGTAATTTCATATGGTGGCTAACGTCTTTTGGAATTNTGNNNNNNNNNNTGTTGTAGTCAAGAGAAGGAAGCAGC  c24.fa
53422  NCGTTTGNNNNNTCATATGGTGGCTAACGTCTTTTGGNNNNNNNNNNNNNNNNNNNNNNNNGTCAAGAGAAGGAAGCAGC  col-0.fa
53422  GCGTTTGTAATTTCATATGGTGGCTAACGTCTTTTGGAANNNNNNNNNNNNNNNTGTTGTAGTCAAGAGAAGGAAGCAGC  cvi-0.fa
53422  NNNTTTGTAATTTCATATGGTGGCTAACGTCTTTTGGNNNNNNNNNNNNNNNNNNNNNNNAGTCAAGAGAAGGAAGCAGC  est-1.fa
53422  GCGTTTGTAATTTCATATGGTGGCTAACGTCTTTTGGANNNNNNNNNNNNNNNNTGTTGTAGTCAAGAGAAGGAAGCAGC  fei-0.fa
53422  NNNNNNNNNNNNNNNNNTGGTGGCTAACGTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGAAGGAAGCAGC  got-7.fa
53422  GCNTTNGTAATTTCATATGGTGGCTAACGTCTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAGAAGGAAGCAGC  ler-1.fa
53422  NNNTNNGTAATTTCATATGGTGGCTAACGTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGAAGGAAGCAGC  lov-5.fa
53422  GCGTTTGTAATTTCATATGGTGGCTAACGTCTTTTGGANNNNNNNNNNNNNNNNNGTNGTAGTCAAGAGAAGGAAGCAGC  nfa-8.fa
53422  GCGTTTGTAATTTCATATGGTGGCTAACGTCTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAGAAGGAAGCAGC  rrs-10.fa
53422  NNNNTTGTAATTTCNTATGGTGGCTAACGTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGAAGGAAGCAGC  rrs-7.fa
53422  GCGTTTGTAATTTCATATGGTGGCTAACGTCTTTTGGNNNNNNNNNNNNNNNNNNNNNGTAGTCAAGAGAAGGAAGCAGC  sha.fa
53422  NNNNNNNNNNNNNNNNNTGGTGGCTAACGTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGAAGGAAGCAGC  tamm-2.fa
53422  NNGTTNNNNNNNNCNTATGGTGGCTAACGTCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAGAAGGAAGCAGC  ts-1.fa
53422  NNNNNNNNNNNNNNNNNNNGTGNNNNNCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAAGGAAGCAGC  tsu-1.fa
53422  GCGTTTGTAATTTCATATGGTGGCTAACGTCTTTTGGNNNNNNNNNNNNNNNNNNNNNNNAGTCAAGAGAAGGAAGCAGC  van-0.fa
 
53502  GCCGCGGAAGATTGGGATGACCGACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  chr1.fa
53502  GCCGCGGAAGATTNNRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  bay-0.fa
53502  GCCGCGGAAGATTGGRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  bor-4.fa
53502  GCCGCGGAAGATTGGRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCNTT  br-0.fa
53502  GCCGCGGAAGATTGGRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  bur-0.fa
53502  GCCGCGGAAGATTGGRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  c24.fa
53502  GCCGCGGAAGATTGGRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  col-0.fa
53502  GCCGCGGAAGATTGNRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  cvi-0.fa
53502  GCCGCGGAAGATTGGRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  est-1.fa
53502  GCCGCGGAAGATNGNRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  fei-0.fa
53502  GCCGCGGAAGATTGGRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  got-7.fa
53502  GCCGCGGAAGATTGGRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  ler-1.fa
53502  GCCGCGGAAGATTGGRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  lov-5.fa
53502  GCCGCGGAAGATTGNRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  nfa-8.fa
53502  GCCGCGGAAGATTGGRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  rrs-10.fa
53502  GCCGCGGAAGATTGGRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  rrs-7.fa
53502  GCCGCGGAAGATTGNRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  sha.fa
53502  GCCGCGGAAGATTGNRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  tamm-2.fa
53502  GCCGCGGAAGATTGNRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGANGCTACAACGGAGACGGGACACAGCATT  ts-1.fa
53502  GCCGCGGAAGATTGGRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  tsu-1.fa
53502  GCCGCGGAAGATTGGRRRRRRRRACCACACACGATAGACGCAGTGAAAGTGATGCTACAACGGAGACGGGACACAGCATT  van-0.fa
 
53582  GAGACATGACAAGACTAATTTGTCACAAGCTTTCTCTCAAAAGGTAAAATTAATTAAACCGGCATATAGTCTGTTATATA  chr1.fa
53582  GAGACATGACAAGACTAATTTGTCACNAGCTTTCTCTCAAAAGGTAAAATTAATTAAACCGGCATATAGTCTGTTATATA  bay-0.fa
53582  GAGACATGACAAGACTAATTTGTCACAAGCTTTCTNNNNNNNNNNNNNNNNNATTAAACCGGCATATAGNNNNNNNNNNN  bor-4.fa
53582  GAGACNTGACAAGACTAATTTGTCACNNNNNNNCTCTCANNNNNNNNNNNNNATTAAACCGGCATATAGTNNNNNNNNNN  br-0.fa
53582  GAGACATGACAAGACTAATTTGTCACNAGCTTTCTCTCAAAAGGTAAAATTAATTAAACCGGCATATAGTCTGTTATATA  bur-0.fa
53582  GAGACATGACAAGACTAATTTGTCACAAGCTTTCTCTCAAAAGGNAAAATTAATTAAACCGGCATATAGTNNNNNNNNNA  c24.fa
53582  GAGACATGACAAGACTAATTTGTCACNAGCTTTCTCTCANNNNNNNNNATTAATTAAACCGGCATATAGNNNNNNNNNNN  col-0.fa
53582  GAGACATGACAAGACTAATTTGTCACNAGCTTTCTCTCAAAANNNNNNATTAATTAAACCGGCATATAGTCNNNNNNNNN  cvi-0.fa
53582  GAGACATGACAAGACTAATTTGTCACAAGCTTTCTCTCAANNNNNNNNNNNNATTAAACCGGCATATAGTCNNNNNNNNN  est-1.fa
53582  GAGACATGACAAGACTAATTTGTCACAAGCTTTCTCTCAANNNNNNNAATTAATTAAACCGGCATATAGTCNNNNNNNTA  fei-0.fa
53582  GAGACATGACNNNNNNNNNTTGTCACNNNNNTTCTCNNNNNNNNNNNNNNNNNNNNNNNNGGCATATNNNNNNNNNNNNN  got-7.fa
53582  GAGACATNNNNNNNNNNNNNTNNCNCNAGCTNTCNCTNNNNNNNNNNNNNNNATTAAACCGGCATATANNNNNNNNNNNN  ler-1.fa
53582  GAGACATGACANNNNNNNNNNNTCACNAGCTTTCTCNNNNNNNNNNNNNNNAATTAAACCGGCATATANNNNNNNNNNNN  lov-5.fa
53582  GAGACATGACAAGACTAATTTGTCACAAGCTTTCTCTCAAAANNNNNNNTTAATTAAACCGGCATATAGTNNNNNNNNNN  nfa-8.fa
53582  GAGACATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAANCCGGCATANNNNNNNNNNNNNN  rrs-10.fa
53582  GAGACATGACAAGACNAATTTGTCACNAGCTTTCTCTCNNNNNNNNNNNNNNNTTAAACCGGCATATANNNNNNNNNNNN  rrs-7.fa
53582  GAGACATGACAAGACNAATTTGNCACAAGCTTTCTCTCAAANNNNNNNNTTAATTAAACCGGCATATAGTNNNNNNNNNN  sha.fa
53582  GAGACATGACAAGNCTAANNNGTCACNAGCTTTCTCNNNNNNNNNNNNNNTAATTAAACCGGCATATANNNNNNNNNNNN  tamm-2.fa
53582  GAGNCANGANAAGACNAATTNGTNACNAGCTTTCNCTCAAANNNNNNNNTTAATTAAACCGGCATATAGNNNNNNNNNNN  ts-1.fa
53582  GAGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCATANNNNNNNNNNNNNN  tsu-1.fa
53582  GAGACATGACAAGACTAATTTGTCACAAGCTTTCTCTCAANNNNNNNNNNNNATTAAACCGGCATATAGNNNNNNNNNNN  van-0.fa
 
53662  TATTGAGCTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  chr1.fa
53662  TATTGAGCTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATNTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  bay-0.fa
53662  NNNNNNNNNNNTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACNANNCTACGGAAGGACAC  bor-4.fa
53662  NNNNNNNCTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  br-0.fa
53662  TATTGAGCTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  bur-0.fa
53662  TATTGAGCTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  c24.fa
53662  NNNNNNNCTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  col-0.fa
53662  TATTGAGCTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  cvi-0.fa
53662  NNNNNNNNTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  est-1.fa
53662  TATTGAGCTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  fei-0.fa
53662  NNNNNNNNNNNTTGATANCATCGTTTCGTTTCAATGGNAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  got-7.fa
53662  NNNNNNNCTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  ler-1.fa
53662  NNNNNNNNNNNNTGATAACATCGTTTCGTTTCAATGGNAAGATGTGNAGGACGGTTGGTAACCAATCCACGGAAGGACAC  lov-5.fa
53662  NNNTGAGCTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  nfa-8.fa
53662  NNNNNNNNNTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  rrs-10.fa
53662  NNNNNNNNTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACNANNNTACGGAAGGACAC  rrs-7.fa
53662  TATTGAGCTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  sha.fa
53662  NNNNNNNNNTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  tamm-2.fa
53662  NNNNNNNCTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  ts-1.fa
53662  NNNNNNNNNNNTTGANNNNNNCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  tsu-1.fa
53662  NNNNNNNNTTGTTGATAACATCGTTTCGTTTCAATGGAAAGATGTGGAGGACGGTTGGTAACCAATCCACGGAAGGACAC  van-0.fa
 
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCGGTGGATGGCTACTAGACCGTGGGATAAACGAGCTAG  chr1.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGANCRRTGGATGGCTACTNRACCGTGGGATAAACGAGCTAG  bay-0.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGANCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAG  bor-4.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAG  br-0.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAG  bur-0.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAG  c24.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAG  col-0.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAG  cvi-0.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAG  est-1.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAG  fei-0.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACNGTGGGATAAACGAGCTAG  got-7.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGANCRRTGGATGGCTACNARACCGTGGGATAAACGAGCTAG  ler-1.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACNARACCGTGGGATAAACGAGCTAG  lov-5.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAG  nfa-8.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGANCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAG  rrs-10.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAG  rrs-7.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTNRACCGTGGGATAAACGAGCTAG  sha.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAG  tamm-2.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAG  ts-1.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCNAG  tsu-1.fa
53742  CACGAGGTAGAACTTGAAGAGGAAAGGCCAAAATGGCTTGACCRRTGGATGGCTACTARACCGTGGGATAAACGAGCTAG  van-0.fa
 
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  chr1.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  bay-0.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAANNNNNNNNA  bor-4.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  br-0.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  bur-0.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  c24.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  col-0.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  cvi-0.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  est-1.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  fei-0.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTNTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  got-7.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTNTNNGNTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  ler-1.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTNAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  lov-5.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  nfa-8.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCNGTTAAANCCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  rrs-10.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGNNNNNNNA  rrs-7.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGNNNNNNNA  sha.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGNTGAAATCGACACTTCTCAGCCTTACTCAANNNNNNNNA  tamm-2.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  ts-1.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGNTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGAACAGGAG  tsu-1.fa
53822  TAGTAGAGCTTCGGTTGACCAAAGGGTTTCAGTTAAAACCGTTGAAATCGACACTTCTCAGCCTTACTCAAGNNNNNNNA  van-0.fa
 
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  chr1.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATNACCAATCCCGCAATAATTTCTCA  bay-0.fa
53902  NNNNNAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  bor-4.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  br-0.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  bur-0.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATNACCAATCCCGCAATAATTTCTCA  c24.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  col-0.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  cvi-0.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  est-1.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  fei-0.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  got-7.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCNCGCAATAATTTCTCA  ler-1.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCANCAAGAACTAGCCACCATNACCAATCCCGCAATAATTTCTCA  lov-5.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  nfa-8.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  rrs-10.fa
53902  NNNGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  rrs-7.fa
53902  NNNNAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  sha.fa
53902  NNNGAAGCCCGAGTCGTGGCCAAAGACCNAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  tamm-2.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATNACCAATCCCGCAATAATTTCTCA  ts-1.fa
53902  CAGGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  tsu-1.fa
53902  NNNGAAGCCCGAGTCGTGGCCAAAGACCTAGTTCCCCATCAAGAACTAGCCACCATTACCAATCCCGCAATAATTTCTCA  van-0.fa
 
53982  GCCACTCCATCTCCGGCTAAGTCTAGACCAATACTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  chr1.fa
53982  GCCACTCCATCTCCGGCTAARTCTAGACCAANACTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  bay-0.fa
53982  GCCACTCCATCTCCGGCTAARTCTAGANNNNNNCTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  bor-4.fa
53982  GCCACTCCATCTCCGGCTAARTCTAGACCAATACTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  br-0.fa
53982  GCCACTCCATCTCCGGCTAARTCNAGACCAATACTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAANA  bur-0.fa
53982  GCCACTCCATCTCCGGCTAARTCNAGACCAATACTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  c24.fa
53982  GCCACTCCATCTCCGGCTAARTCTAGACCNATACTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  col-0.fa
53982  GCCACTCCATCTCCGGCTAARTCTAGACCAATACTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  cvi-0.fa
53982  GCCACTCCATCTCCGGCTAARTCTAGACCAATACTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  est-1.fa
53982  GCCACTCCNTCTCCGGCNAARTCTAGACCAATACTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  fei-0.fa
53982  GCCACTCCATCTCCGGCTAARTCTANNNNNNNNNNTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  got-7.fa
53982  GCCACTCCATCTCCGGCNAARTCNAGNNNNNNNCTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  ler-1.fa
53982  GCCACTCCATCTCCGGCNAARTCNNNNNNNNNNNNNATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  lov-5.fa
53982  GCCACTCCATCTCCGGCTAARTCTAGACCAATACTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  nfa-8.fa
53982  GCCACTCCATCTCCGGCTAARTCTAGANNNNNNNNTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  rrs-10.fa
53982  GCCACTCCATCTCCGGCTAARTCTAGANNNNNNNTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  rrs-7.fa
53982  GCCACTCCATCTCCGGCTAARTCNAGACCNATACTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  sha.fa
53982  GCCACNCCATCTCCGGCNAARNCNAGNNNNNNNNNTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  tamm-2.fa
53982  GCCACTCCATCTCCGGCNNARNCNAGACCNNNNNNTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  ts-1.fa
53982  GCCACTCCATCTCCGGCTAARNCNNNNNNNNNNNTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  tsu-1.fa
53982  GCCACTCCATCTCCGGCTAARTCTAGACCAATACTTATTCGGTCAGCTAGTCCACGGTGCCAGAGAGACCCGAGGGAAGA  van-0.fa
 
54062  CCGTGACCGAGCAGCTTATAGTTATACATCAAACACACCAAGCTTGAGATCCAATTATAGTTTCACAGCTAGGAGTGGAT  chr1.fa
54062  CCGTGACCGAGCAGCTTATAGTTATACATCAAACACARRRANCTTGAGATCCAARTATAGTTTCACAGCTAGGAGTGGAT  bay-0.fa
54062  CCGTGACCGAGCAGCTTATANNNNNNNNNCAAACNNARRRAGCTTGAGATCNNNRNNNAGTTTCACAGCTAGGAGTGGAT  bor-4.fa
54062  CCGTGACCGAGCAGCTTATAGTTATACANCAAACACARRRAGCTTGAGATCNNARTATAGTTTCACAGCTAGGAGTGGAT  br-0.fa
54062  CCGTGACCGAGCAGCTTATAGTTATACATCAAACACARRRAGCTTGAGATCCAARTATAGTTTCACAGCTAGGAGTGGAT  bur-0.fa
54062  CCGTGACCGAGCAGCTTATAGTTATACATCAAACACARRRAGCTTGAGATCCAARTATAGTTTCACAGCTAGGAGTGGAT  c24.fa
54062  CCGTGACCGAGCAGCTTATAGTTANACATCAAACACARRRAGCTTGAGATCCNARNATAGTTTCACAGCTAGGAGTGGAT  col-0.fa
54062  CCGTGACCGAGCAGCTTATAGTTATACATCAAACACARRRAGCTTGAGATCCAARTATAGTTTCACAGCTAGGAGTGGAT  cvi-0.fa
54062  CCGTGACCGAGCAGCTTATAGNNNNNNNNNNAACNCARRRAGNTTGAGATCNNNRNATAGTTTCACAGCTAGGAGTGGAT  est-1.fa
54062  CCGTGACCGAGCAGCTTATAGTTATACATCAAACACARRRANCTTGAGATCCAARTATAGTTTCACAGCTAGGAGTGGAT  fei-0.fa
54062  CCGTGACCGAGCAGCTTATANNNNNNNATCAAACACARRRNGCTTGAGANCNNNRNNNAGTTTCACAGCTAGGAGTGGAT  got-7.fa
54062  CCGTGACCGAGCAGCTTATAGTNNNNCATCAANCNNNRRRNNCTTGAGATCNNNRNNNAGTTTCACAGCTAGGAGTGGAT  ler-1.fa
54062  CCGTGACCGAGCAGCTTATANNNNNNNNNNAAACNNNRRRNNNTTGAGNNNNNNRNNNAGTTTCACAGCTAGGAGTGGAT  lov-5.fa
54062  CCGTGACCGAGCAGCTTATAGTTATACATCAAACACARRRAGCTTGAGATCCAARTATAGTTTCACAGCTAGGAGTGGAT  nfa-8.fa
54062  CCGTGACCGAGCAGCTTANNNNNNNNNNTCAANCACARRRAGCTTGAGATCNNNRNNNAGTTTCACAGCTAGGAGTGGAT  rrs-10.fa
54062  CCGTGACCGAGCAGCTTATAGNNNNNNATCAAACNCARRRNGCTTGAGATCCNARNNNNGTTTCACAGCTAGGAGTGGAT  rrs-7.fa
54062  CCGTGACCGAGCAGCTTATAGTTATACATCAAACNCARRRNNCTTGAGATCCAARTATAGTTTCACAGCTAGGAGTGGAT  sha.fa
54062  CCGTGACCGAGCAGCTTATAGTTATANATCAAACNCARRRNNNTTGAGNNNNNNRNNNAGTTTCACAGCTAGGAGTGGAT  tamm-2.fa
54062  CCGTGACCGAGCAGCTTATAGTTATACANCAAACACNRRRANCTTGAGATCNNARNANAGTTTCACAGCTAGGAGTGGAT  ts-1.fa
54062  CCGTGACCGAGCAGCTTANNNNNNNNNNNCAAACNNARRRNGNNNNNNNNNNNNRNNNNNNTTCACAGCTAGGAGTGGAT  tsu-1.fa
54062  CCGTGACCGAGCAGCTTATAGTTATACATCAAACACARRRAGCTTGAGATCNNARNATAGTTTCACAGCTAGGAGTGGAT  van-0.fa
 
54142  GTAGCATTAGTACCACAATGGTTAATAATGCATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  chr1.fa
54142  GTAGCATTAGTACCACAATGGTTAATAATGCATCATTGTTGCCTAATTACATGGCGAGTACAGAGNCAGCTAAAGCGAGG  bay-0.fa
54142  GTAGCATTAGTACNNNNNNNNNNNNNNNNGCATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  bor-4.fa
54142  GTAGCATTAGTACCACAATGGTTAATAATNCATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  br-0.fa
54142  GTAGCATTAGTACCACAATGGTTAATAATGCATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  bur-0.fa
54142  GTAGCATTAGTACCACAATGGTTAATAATGCATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  c24.fa
54142  GTAGCATTAGTACCACAATGGTTAANNNNNNATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  col-0.fa
54142  GTAGCATTAGTACCACAATGGTTAATAATGCATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  cvi-0.fa
54142  GTAGCATTAGTACCACANTGGTTANNNNNNCATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  est-1.fa
54142  GTAGCATTAGTACCACAATGGTTAATAATGCATCATTGTTGCCTAATTNCATGGCGAGTACAGAGTCAGCTAAAGCGAGG  fei-0.fa
54142  GTAGCATTAGTACCANNNNNNNNNNNNATGCATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  got-7.fa
54142  GTAGCATTAGTACCACNATNNTNNNNNNNNNNNNATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  ler-1.fa
54142  GTAGCATTAGTACCANNNNNNNNNNNNNNNNNNNATNGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  lov-5.fa
54142  GTAGCATTAGTACCACAATGGTTAATAATGCATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  nfa-8.fa
54142  GTAGCATTAGTACCACNATGGTTAATAANGCATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  rrs-10.fa
54142  GTAGCATTAGTACCACAANNNNNANNNNNNNATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  rrs-7.fa
54142  GTAGCATTAGTACCACAATGGTTAATAATGCATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  sha.fa
54142  GTAGCATTAGTACCACAATNNNNNNNNNNNNATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  tamm-2.fa
54142  GTAGCATTAGTACCACAATGGTTAANNNNNCATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  ts-1.fa
54142  GTAGCATTAGTANNNNNNNNNNNNNNNNNNNNNNNNNNTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  tsu-1.fa
54142  GTAGCATTAGTACCACAATGGTTAATAATGCATCATTGTTGCCTAATTACATGGCGAGTACAGAGTCAGCTAAAGCGAGG  van-0.fa
 
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  chr1.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACTCCCGAGAGGGACCGTGCGGNTTTGGTCAAGAAACGGCTCTC  bay-0.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCNTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  bor-4.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCNTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  br-0.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  bur-0.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  c24.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACTCNCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  col-0.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCNCTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  cvi-0.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  est-1.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCNTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  fei-0.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  got-7.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  ler-1.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACNNNNNNGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  lov-5.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  nfa-8.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  rrs-10.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  rrs-7.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCNCTCAACNNNNNNGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  sha.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  tamm-2.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  ts-1.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACNNNNNNNAGNGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  tsu-1.fa
54222  ATCCGGTCTCATAGTGCACCGAGGCAACGGCCCTCAACTCCCGAGAGGGACCGTGCGGGTTTGGTCAAGAAACGGCTCTC  van-0.fa
 
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCCAAGCTTTAAGAGTGTGGCTGGTTCAC  chr1.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  bay-0.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGNNNNNNNNNNNNTNAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  bor-4.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  br-0.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  bur-0.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  c24.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  col-0.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  cvi-0.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  est-1.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  fei-0.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACANTAATAGCTTAAGGAGTCCNARCTTTAAGAGTGTGGCTGGTTCAC  got-7.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCNNNRCNNTAAGAGTGTGGCTGGTTCAC  ler-1.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATNNCTTAAGGAGTCCAARCTNNAAGAGTGTGGCTGGTTCAC  lov-5.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  nfa-8.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATNATAGCTTAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  rrs-10.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  rrs-7.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  sha.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  tamm-2.fa
54302  GTATCCGGNACCACCGCCAGCGGAGTATGAGGACAATAATAGCTTAAGGAGTCCAARCNTTAAGAGTGTGGCTGGTTCAC  ts-1.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGNNNNNNNNNNNNNNAGGAGTCNNARNNNTAAGAGTGTGGCTGGTTCAC  tsu-1.fa
54302  GTATCCGGTACCACCGCCAGCGGAGTATGAGGACAATAATAGCNTAAGGAGTCCAARCTTTAAGAGTGTGGCTGGTTCAC  van-0.fa
 
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  chr1.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTACTNTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  bay-0.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTNCTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  bor-4.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  br-0.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  bur-0.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  c24.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  col-0.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  cvi-0.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  est-1.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  fei-0.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATNACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  got-7.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATNNNNCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  ler-1.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATNACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  lov-5.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  nfa-8.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  rrs-10.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATNACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  rrs-7.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  sha.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATNACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  tamm-2.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  ts-1.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGANNNNNNNNTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  tsu-1.fa
54382  ATTTTGGTGGAATGTTAGAGCAGCAATCGAATTACTCTTCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCT  van-0.fa
 
54462  TCTACTAGTGACTTTAGGAATTGGCTTAGATGA   chr1.fa
54462  TCTACTAGTGACTTTAGGAATTGGCTTAGATGA   bay-0.fa
54462  TCTACTANNNNNNTTAGGAATTGGCTTAGATGA   bor-4.fa
54462  TCTACTAGTGACTTTAGGAATTGGCTTAGATGA   br-0.fa
54462  TCTACTAGTGACTTTAGGAATTGGCTTAGATGA   bur-0.fa
54462  TCTACTAGTGACTTTAGGAATTGGCTTAGATGA   c24.fa
54462  TCTACTAGTGACTTTAGGAATTGGCTTAGATGA   col-0.fa
54462  TCTACTAGTGACTTTAGGAATTGGCTTAGATGA   cvi-0.fa
54462  TCTACTAGTGANTTTAGGAATTGGCTTAGATGA   est-1.fa
54462  TCTACTAGTGACTTTAGGAATTGGCTTAGATGA   fei-0.fa
54462  TCTACTAGNNNNNNTAGGAATTGGCTTAGATGA   got-7.fa
54462  TCTNCNNNNNNNNNTAGGAATTGGCTTAGATGA   ler-1.fa
54462  TCTACTNNNGACTTTAGGAATTGGCTTAGATGA   lov-5.fa
54462  TCTACTAGTGACTTTAGGNATTGGCTTAGATGA   nfa-8.fa
54462  TCTACTAGTGACTTTAGGAATTGGCTTAGATGA   rrs-10.fa
54462  TCTACTAGTGACTTTAGGAATTGGCTTAGATGA   rrs-7.fa
54462  TCTACTAGTGACTTTAGGAATTGGCTTAGATGA   sha.fa
54462  TCTACTAGNNNNNNTAGGAATTGGCTTAGATGA   tamm-2.fa
54462  TCTACTAGTGACTTTAGGAATTGGCTTAGATGA   ts-1.fa
54462  TCNNNNNNNNNNNNTAGGANNNNNNNNNNATGA   tsu-1.fa
54462  TCTACTAGTGACTTTAGGAATTGGCTTAGATGA   van-0.fa
 
visited.