Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 75633 - 76556


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  chr1.fa
75633  ATGAAGGAGGNTCNTCNTCNTCNTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  bay-0.fa
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATNCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  bor-4.fa
75633  ATGAAGGNGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  br-0.fa
75633  ATGAAGGAGGNTCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  bur-0.fa
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTNNNNTNNNN  c24.fa
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  col-0.fa
75633  ATGAAGGAGGNTCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  cvi-0.fa
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  est-1.fa
75633  ATGAAGGAGGNTCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  fei-0.fa
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  got-7.fa
75633  NTGAAGGAGGNTCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  ler-1.fa
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  lov-5.fa
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  nfa-8.fa
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  rrs-10.fa
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  rrs-7.fa
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  sha.fa
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  tamm-2.fa
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAN  ts-1.fa
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  tsu-1.fa
75633  ATGAAGGAGGATCGTCGTCTTCCTCACAAACGCGACGCCTTCCAATTCTTGAAAACCAAGGCTGCGTACGTTATCGTCAT  van-0.fa
 
75713  AGTTCTAACCTACGCCTTTGGTTACTTCTCCGCCTACCACTATCATCAACCGCTGCAGCAGCAGCTGCCACCGTCTACGA  chr1.fa
75713  AGTTCTAACCTACGCCTTTNGTNRCTTCTCCGCCTACCACTATCATCAACNNNNNNNNNNNNNNNNNNNACCGTCTACGA  bay-0.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACTATCATCAACCGCNNNNNNNNNNNNNGCCACCGTCTACGA  bor-4.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACTATCATCAACCGCNNNNNNNNCNNCNGCCACCGTCTACGA  br-0.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACTATCATCAACCGCNNNNNNNNCAGCNGCCACCGTCTACGA  bur-0.fa
75713  NNNTCTAACCTACGCCTTTGGTTRCTTCTCCGCCNNNNNNNNNNATCAACNNNNNNNNNNNNNNNNNNNNCCGTCTACGA  c24.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACTATCATCAACCGCNNNNNNNNNNNNNNCCACCGTCTACGA  col-0.fa
75713  AGTTCTAATCTACGCCNTTGGTTRCTTCTCCGCCTACCACTATCATCAACCGCNNNNNNNNNNNNNNCCACCGTCTNNNN  cvi-0.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACTATCATCAACCGCNNNNNNNNNNNNNNCCACCGTCTACGA  est-1.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACTATCATCAACCGCNNNNNNNNCAGCNGCCACCGTCTACGA  fei-0.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACTATCATCAACCGCNNNNNNNNNNGCNGCCACCNNNNNNNN  got-7.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACNATCATCAACCNNNNNNNNNNNNNNNNNCACCGTCTACGA  ler-1.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACTATCATCAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACTATCATCAACCGCNNNNNNNNNNNNNNCCACCGTCTACGA  nfa-8.fa
75713  ANTTCTAACCTACGCCTTTGNTTRCTTCTCCGCCTACCACTATCATCAACCGCNNNNNNNNNNGCNGCCACCGTCTACGA  rrs-10.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACTATCATCAACCGNNNNNNNNNNNNNNNCCACCGTCTACGA  rrs-7.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACTATCATCAACCGCNNNNNNNNNNNNNNCCACCGTCTACGA  sha.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACTATCATCAACCGCNNNNNNNNNNNNNNCCACCGTCTACGA  tamm-2.fa
75713  NNNNNNNNTNNNNNNNNNTGNNNRCTNCTCCGCCTACCACTATCATCAACCGCNNNNNNNNNNNNNNCCACCNNNNNNNN  ts-1.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACTATCATCAACNNNNNNNNNNNNNNNNNNCACCGTCTACGA  tsu-1.fa
75713  AGTTCTAACCTACGCCTTTGGTTRCTTCTCCGCCTACCACTATCATCAACCGCNNNNNCAGCAGCNGCCACCGTCTACGA  van-0.fa
 
75793  CAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTCCG  chr1.fa
75793  CAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTNCG  bay-0.fa
75793  CAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTCCG  bor-4.fa
75793  CAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTCCG  br-0.fa
75793  GAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTCCG  bur-0.fa
75793  CAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTAACGACTCCATGCGGCAANCTTGTTCCG  c24.fa
75793  CAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTCCG  col-0.fa
75793  GAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAANCTTGTTCCG  cvi-0.fa
75793  CAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTCCG  est-1.fa
75793  CAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAANCTTGTTCCG  fei-0.fa
75793  GNNNNNTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCANGCGGCAATCTTGTTCCG  got-7.fa
75793  CAGCCGTGGAAACGACAAAACCNNNNNTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTCCG  ler-1.fa
75793  GNNNNNNNNAAACGACAAAACCNNNNNTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTCCG  lov-5.fa
75793  CAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTCCG  nfa-8.fa
75793  CAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTCCG  rrs-10.fa
75793  CAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAANCTTGTTCCG  rrs-7.fa
75793  CAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTCCG  sha.fa
75793  CAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTCCG  tamm-2.fa
75793  GNNNCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAANCTTGTTCCG  ts-1.fa
75793  CAGCCGTGGAAACGACAAAACCTCAANTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTCCG  tsu-1.fa
75793  CAGCCGTGGAAACGACAAAACCTCAAGTTTGTTCAATCGACAACTTCCGAGTTACGACTCCATGCGGCAATCTTGTTCCG  van-0.fa
 
75873  CCGGAATTGATTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  chr1.fa
75873  CCGGAATTGATTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTNNNNNNCACCGCACGC  bay-0.fa
75873  CCGGAATTGATTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  bor-4.fa
75873  CCGGAATTGATTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTNCATCGATTTNCCACCACCGCACGC  br-0.fa
75873  CCGGAATTGATTCGCCAGACTGTTATCGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCNCACCACCGCACGC  bur-0.fa
75873  CCGGAATTGATTCGCCAGACTGTTATCGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  c24.fa
75873  CCGGAATTGATTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  col-0.fa
75873  CCGGAATTGATTCGCCAGACTGTTATCGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  cvi-0.fa
75873  CCGGAATTGATTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  est-1.fa
75873  CCGGAATTGATTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  fei-0.fa
75873  CCGGAATTGATTCGCCAGACTGTTANCNNNNNNATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  got-7.fa
75873  CCGGAATTGATTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  ler-1.fa
75873  CCGGAATTGATTCGCCAGACTNNNNNCNNNNNNNNCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  lov-5.fa
75873  CCGGAATTGATTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  nfa-8.fa
75873  CCGGAATTGATTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  rrs-10.fa
75873  CCGGAATTGATTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  rrs-7.fa
75873  CCGGAATTGATTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  sha.fa
75873  CCGGAATTGATTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  tamm-2.fa
75873  CCGGAATTGATTCGCCAGACTGTTNNCNNNNNGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  ts-1.fa
75873  CCGGAATTGANTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTNNCACCACCGCACGC  tsu-1.fa
75873  CCGGAATTGATTCGCCAGACTGTTATTGACCGGATCTTTAACGGAACTTCTCCGTACATCGATTTCCCACCACCGCACGC  van-0.fa
 
75953  CAAGAAGTTTCTCCGGCCAAAAAGAATCAAAGGTTGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  chr1.fa
75953  CAAGAAGTTTCTCCGGCRAAAAANAATCAAAGGTTNGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  bay-0.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAATCNNNNNNNGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  bor-4.fa
75953  CAAGNAGTTTCTCCGGCRAAAAAGAATCANNNNNNGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  br-0.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAATCAAAGGTTGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  bur-0.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAATNNNNNNNNNNNNATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  c24.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAATNNNNNNNNNGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  col-0.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAATCAAAGGTTGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  cvi-0.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAATCANNNNNNNNGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  est-1.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAATCAAAGGTTGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGNCA  fei-0.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGNNNNNNNNNNNNGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  got-7.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAANCAAAGGTTGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  ler-1.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAANCNNNNNNNGGGGATCANACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  lov-5.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAATCAAAGGTTGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  nfa-8.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAATCAAAGGTNNGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  rrs-10.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAATCAANNGTTGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  rrs-7.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAATCAAAGGTTGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  sha.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAANCNNNNNTNNNNNNNNATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  tamm-2.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAANNNNNGGTTGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  ts-1.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGANNNNNNNNNNNNGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  tsu-1.fa
75953  CAAGAAGTTTCTCCGGCRAAAAAGAATCAAAGGTTGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCA  van-0.fa
 
76033  AACCTAAGACGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  chr1.fa
76033  AACCTAAGNCGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  bay-0.fa
76033  AACCTAAGACGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  bor-4.fa
76033  AACCTAAGACGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  br-0.fa
76033  AACCTAAGACGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACNTGGCGAATCTCACGCGCCGNCTTGGG  bur-0.fa
76033  AACCTAAGACGNNNNNNNAAGTNGGGAGTTTTCTCGGCGCGTCGGCGATANACATGACGAATCTCACGCGCCGNCTTGGG  c24.fa
76033  AACCTAAGACGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  col-0.fa
76033  AACCTAAGACGATCGNCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGNCTTGGG  cvi-0.fa
76033  AACCTAAGACGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  est-1.fa
76033  AACCTAAGACGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  fei-0.fa
76033  AACCTAAGACGATCGNCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGNCTTGGG  got-7.fa
76033  AACCTAAGACGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  ler-1.fa
76033  AACCTAAGACGNNCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGCCTTGGG  lov-5.fa
76033  AACCTAAGACGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  nfa-8.fa
76033  AACCTAAGACGNTCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  rrs-10.fa
76033  AACCTAAGNCGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  rrs-7.fa
76033  AACCTAAGNCGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  sha.fa
76033  AACCTAAGNCGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  tamm-2.fa
76033  AACCNAAGACGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGNNNNNNNNGG  ts-1.fa
76033  AACCTAAGACGANNNNCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  tsu-1.fa
76033  AACCTAAGACGATCGTCGAAGTCGGGAGTTTTCTCGGCGCGTCGGCGATACACATGGCGAATCTCACGCGCCGACTTGGG  van-0.fa
 
76113  CTCGAGGAGACTCAGATTCTATGCGTCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  chr1.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  bay-0.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  bor-4.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  br-0.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  bur-0.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  c24.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  col-0.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGANNNNCNNTT  cvi-0.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  est-1.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGNCCGGTTTAAGGACATGGCTTT  fei-0.fa
76113  CTCGAGGAGACTCAGATTCTATGCGTCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  got-7.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  ler-1.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  lov-5.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  nfa-8.fa
76113  CTCGAGGAGACTCAGATTCTATGCGTCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  rrs-10.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  rrs-7.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  sha.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  tamm-2.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGNNNNNNCNNNT  ts-1.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  tsu-1.fa
76113  CTCGAGGAGACTCAGATTCTATGCGNCGACGACTTCCGTGGCTGGCCCGGTTTTCGAGACCGGTTTAAGGACATGGCTTT  van-0.fa
 
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  chr1.fa
76193  GGTTANCGGTGACGNTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGNTTTTTCCGGTTCGATNTTGCCGG  bay-0.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  bor-4.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  br-0.fa
76193  GGTTAACGGTGACGTTCTGCTTATTTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  bur-0.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  c24.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  col-0.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATNNNACCGG  cvi-0.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  est-1.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  fei-0.fa
76193  GGTTAACGGTGACGTTCNNNNNNNNNNNNNNNNNNTGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  got-7.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTNNNNCNAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  ler-1.fa
76193  GGTTAACGGTGACGNNNNNNNNNNTNNNNNNNNNNNNCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  lov-5.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  nfa-8.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  rrs-10.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATNTTGCCGG  rrs-7.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  sha.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  tamm-2.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGNNNNNNNNNNNNNNNNNCGGTTCGATATTGCCGG  ts-1.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCANNNNNTGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  tsu-1.fa
76193  GGTTAACGGTGACGTTCTGCTTATGTACCAGTTTATGCAAAACGTGGTTATCTCGGATTTTTCCGGTTCGATATTGCCGG  van-0.fa
 
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAAGCTGTGTGAGTGGGGAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  chr1.fa
76273  TTCCTTTCTCGACCGGTTCGGNTTTGGAGAAGCTNNNNNNNTGGNNAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  bay-0.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAAGCTNNNNNAGTGGNGAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  bor-4.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAAGCTGTGTGANTGGGNAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  br-0.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAAGNNNNNNNNNNNNNNNNTGACGGCGGACCTGGTGGAGATAGACGCGGGT  bur-0.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAAGCTGTGTGAGTGGGNAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  c24.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAAGCTNTGTGAGTGGGGAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  col-0.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAAGCTGTGTGAGTGGNGAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  cvi-0.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAAGCNGTGTGAGTGGGGAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  est-1.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAAGCTGTGTGAGTNNNNNNTGACGGCGGACCTGGTGGAGATAGACGCGGGT  fei-0.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGANNNNNNNNNNNNNNNNNNTGACGGCGGACCTGGTGGAGATAGACGCGGGT  got-7.fa
76273  TTCCTNTCTCGACCGGTTCGGCTTTGGAGNNNNNNNNNNNNTGGGGAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  ler-1.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGNNNNNNNNNNNNNNNNNNNTGACGGCGGACCTGGTGGAGATAGACGCGGGT  lov-5.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAAGCTGTGTGAGTGGGGAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  nfa-8.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAAGCTNNNNNNNTGGGNAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  rrs-10.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGANNNNNNNNNAGTGGGNANTGACGGCGGACCTGGTGGAGATAGACGCGGGT  rrs-7.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAAGCTGTGTGAGTGGGGAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  sha.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAAGCTGTGTGAGTGGGGAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  tamm-2.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAANNNNNNNNNNNNNNNNNNGACGGCGGACCTGGTGGAGATAGACGCGGGT  ts-1.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGANNNNNNNNNNNNNNGGAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  tsu-1.fa
76273  TTCCTTTCTCGACCGGTTCGGCTTTGGAGAAGCTGTGTGAGTGGGNAGTGACGGCGGACCTGGTGGAGATAGACGCGGGT  van-0.fa
 
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGATACTCCGACCCGGCGGTGTTATATTTGGTCACGA  chr1.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGATNCTCCGACCCGGCGGTGTTATATTTGGTCACGA  bay-0.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGATACTCCGACCCGGCGGTGTTATATTTGGTCACGA  bor-4.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGATACTCCGACCCGGCGGTGTTATATTTGGTCACGA  br-0.fa
76353  CACGATNNCNNNNCNNCTTGGGCGGATATAAACCGGGCGGTTCGGATACTCCGACCCGGCGGTGTTATATTTGGTCACGA  bur-0.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGATACTCCGACCCGGCGGTGTTATATTTGGTCACGA  c24.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGATACTCCGACCCGGCGGTGTTATATTTGGTCACGA  col-0.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGATACTCCGACCCGGCGGTGTTATATTTGGTCACGA  cvi-0.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGATACTCCGACCCGGCGGTGTTATATTTGGTCACGA  est-1.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGATACTCCGACCCGGCGGTGTTATATTTGGTCACGA  fei-0.fa
76353  CACGANNNNNNNNNNNNTNNNNCGGATATAAACCGGGCGGTTCGGANNCTCCGNGNNNGCGGTGTTATATTTGNTCACGA  got-7.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGNNNNNNNCGACCCGGCGGTGTTATATTTGGTCACGA  ler-1.fa
76353  CACGANNNCNNNNNNNNTNNNNCGGATATAAACCGGGCGGTTCGGNNNNNNNGACCCGGCGGTGTTATATTTGGTCACGA  lov-5.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGATACTCCGACCCGGCGGTGTTATATTTGGTCACGA  nfa-8.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGATACTCCGACCCGGCGGTGTTATATTTGGTCACGA  rrs-10.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGANACTCCGACCCGGCGGTGTTATATTTGGTCACGA  rrs-7.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGATACTCCGACCCGGCGGTGTTATATTTGGTCACGA  sha.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGANACTCCGACCCGGCGGTGTTATATTTGGTCACGA  tamm-2.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGNCGGTTCGGNNNNNCCGACCCGGCGGTGTTATATTTGGTCACGA  ts-1.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGANNNNNCGACCCGGCGGTGTTATATTNNNNNACGA  tsu-1.fa
76353  CACGATTTTAATTCGGCATGGGCGGATATAAACCGGGCGGTTCGGATACTCCGACCCGGCGGTGTTATATTTGGTCACGA  van-0.fa
 
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  chr1.fa
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  bay-0.fa
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  bor-4.fa
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGNGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  br-0.fa
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  bur-0.fa
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  c24.fa
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  col-0.fa
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  cvi-0.fa
76433  TTATTTCACGGCGGCGGATAATAGAGNAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  est-1.fa
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  fei-0.fa
76433  TTATTTCACGGCGGCGGATAATNNNNNNNNGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  got-7.fa
76433  TTATTTCACGGCGGCGGATAATAGANNNNNNAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  ler-1.fa
76433  TTATTTCACGGCGGCGGATAANNNNNNNNNGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  lov-5.fa
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  nfa-8.fa
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  rrs-10.fa
76433  TTATTTCACGGCGGCGGATAATAGNNNNNNGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  rrs-7.fa
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  sha.fa
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  tamm-2.fa
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGNTAAAGGTCAAAA  ts-1.fa
76433  TTATTTCACGGCGGCGGATAATNNNNNNNNNAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTNAAAGGTCAAAA  tsu-1.fa
76433  TTATTTCACGGCGGCGGATAATAGAGGAGTGAGGAGAGCCGTGAATCTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAA  van-0.fa
 
76513  CCGATGGTCAACATTGGGTTATTGATTCGGTCAAAGTAACCTGA   chr1.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCTGA   bay-0.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCTGA   bor-4.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCTGA   br-0.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAANNNNN   bur-0.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCTGA   c24.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCTGA   col-0.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCTGA   cvi-0.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCTGA   est-1.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCTGA   fei-0.fa
76513  CCGATGGTCAACATTGGNTNRNTGATTCNNNNNNNNNNNNNNNN   got-7.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCTGA   ler-1.fa
76513  CCGATGGTCAACATTGGGNNRTTGNTTCGGTCAAAGTAACCTGA   lov-5.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCTGA   nfa-8.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCNNN   rrs-10.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCTGA   rrs-7.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCTGA   sha.fa
76513  CCGATGGTCAACATTGGNTNRTTGATTCGGTCAAAGTAACCTGA   tamm-2.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCTGA   ts-1.fa
76513  CCGATGGTCAACANTGGNNNRTNGNTTCGGTCAAAGTAACCNNN   tsu-1.fa
76513  CCGATGGTCAACATTGGGTTRTTGATTCGGTCAAAGTAACCTGA   van-0.fa
 
visited.