Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 76844 - 77500


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
76844  TCAAAAACTGTTGCGAAGATTAAAGAGGATGCCAATCAATGGTTCTTTGCTCAAGTTCTTGAGAATCAGGATTTGGTGAA  chr1.fa
76844  TCAAAAACTGTTGCGAAGATTAAAGAGGATGCCAATCAATGGTTCTTTGCTCAAGTTCTTGAGAATCAGGATTTGGTGAA  bay-0.fa
76844  TCAAAAACTGTTGCGAAGATTAAAGAGGATGCCAATCAATGGTTCTTTGCTCAAGTTCTTGAGAATCAGGATTTGGTGAA  bor-4.fa
76844  NNNNAAACTGTTGCGAAGATTAAAGAGGATGCCNNTCAATGGTTCTTTGCTCAAGTTCTTGAGAATCAGGATTTGGTGAN  br-0.fa
76844  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
76844  TCAAAAACTGTTGCGAAGATNAANNNNNNNNNNNNCNNNTGGTTCTTTGCTCAAGTTCTTGAGAATCAGGATTTGGTGAA  c24.fa
76844  TCAAAAACTGTTGCGAAGATTAAAGAGGATGCCAATCAATGGTTCTTTGCTCAAGTTCTTGAGAATCAGGATTTGGTGAA  col-0.fa
76844  TCAGAAACTGTTGCGAAGATTAAAGAGGATGCCAACCAATGGTTCTTTGCTCAAGTTCTTGAGAATCAGGNTTTGGTGAA  cvi-0.fa
76844  TCAAAAACTGTTGCGAAGATTAAAGAGGATGCCAATCAATGGTTCTTTGCTCAAGTTCTTGAGAATCAGGATTTGGTGAA  est-1.fa
76844  TCAAAAACTGTTGCGAAGATTAAAGANGATGCCAATCAATGGTTCTTTGCTCAAGTTCTTGAGAATCAGGATTTGGTGAA  fei-0.fa
76844  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
76844  TCAAAAACTGTTGCGAAGATTAAAGAGGATGCCAATCAATGGTTCTTTGCTCANNNNNTTGAGAATCAGGATTTGGTGAA  ler-1.fa
76844  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
76844  TCAAAAACTGTTGCGAAGATTAAAGANGANGCNNNCCAATGGTTNTTTGCTCNNNNNNNNNNANNNNNNNATTTGGTGAA  nfa-8.fa
76844  TCAAAAACTGTTGCGAAGATTAAAGAGGATGCCAATCAATGGTTCTTTGCTCNNGTTCTTGAGAATCAGGATTTGGTGAA  rrs-10.fa
76844  TCAAAAACTGTTGCGAAGATTAAAGAGGATGCCAATCAATGGTTCTTTGCTCANGTTCTTGAGAATCAGGATTTGGTGAA  rrs-7.fa
76844  TCAAAAACTGTTGCGAAGATTAAAGAGGNNNNNNNCCAATGGTTCTTTGCTCAAGTTCTTGAGAATCAGGATTTGGTNNN  sha.fa
76844  TCAAAAACTGTTGCGAAGATTAAANNNNNNNNNNNCNAATGGTTNTTTGCTCNNNNNNTTGAGAATCAGGATTTGGTGNN  tamm-2.fa
76844  NNNGNNNNNNNTGCGAAGATTAAAGANNNNNNNNNCNNNNNNNNNTTTGCTCAAGTTCTTGAGAATCAGGATTTGGTGAA  ts-1.fa
76844  TCAAAAACTGTTGCGAAGATTAAAGAGGATGCCAATCAATGGTTCTTTGCTNNNNNNNNNNAGAATCAGGATTTGGTGAA  tsu-1.fa
76844  TCAAAAACTGTTGCGAAGATTAAAGANGATGCCAACCAATGGTTNTTTGCTCNNNNNNNNNNANNNNNNNNTTTGGTGAA  van-0.fa
 
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTAAAATGCAATATTAGATCGT  chr1.fa
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTAAAATGCAATATTAGATCGT  bay-0.fa
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGNTTGGTNNNNNNNNNNNNNTAGANNNN  bor-4.fa
76924  NNNNNNNNNNNNTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTAANNNNNNNTATTAGATCGT  br-0.fa
76924  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTAAAATGCANNNNNGNNTCGT  c24.fa
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTAAANNNNNATATTAGATCGT  col-0.fa
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTAAANNNNNNNNNNGNNNCGT  cvi-0.fa
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTNNNNNNNNATATTAGATCGT  est-1.fa
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTAAAATGCAATATTAGATCGT  fei-0.fa
76924  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTAAAANNNNATATTAGATCGT  ler-1.fa
76924  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTAAANNNNNNNNNNGNNNNNT  nfa-8.fa
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGANNNNNNNNNNNNNNNNNNNNGATCGT  rrs-10.fa
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTANNNNNNNNTNTTAGATCGT  rrs-7.fa
76924  NANNNNNNNTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTAAAANGNNNNNNNGNNNNNT  sha.fa
76924  NANNNNNNNNGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTNNNNNNNNNNNNNGNNNNNN  tamm-2.fa
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTNNNNNNNNNNNNNGNNNNNN  ts-1.fa
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCNCCATGATTGGTNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
76924  TGAGCAAGCTGTTCACATTTCGGTTAAGGTTAAGTGGTCTCCTCCTCCCCATGATTGGTTNNNNNNNNNNNNNGNNNNNN  van-0.fa
 
77004  CATGGGATAGATTTGGTGAGATTGGAGGTGCTGCGCGGGTTTTTGAGAGATGAACACGGTAAGGTCCTAATTCATGCTAG  chr1.fa
77004  CATGGGATAGATTTGGTGAGATTGGNGGTGCTGCGCGGGTTTTTGAGAGATGAACACGGTAAGGTCCTAATTCATGCTAG  bay-0.fa
77004  NNNGGGATAGATTTGGTGAGATTGGAGGTGCTGCGCGGGTTTTTGAGAGATGAACACGGTAAGGTCCTAATTCATGCNAG  bor-4.fa
77004  CATGGGATAGATTTGGTGAGATTGGNGGTGCTGCGCGGGTTTTTGAGAGATGAACACGGTAAGGTCCTAATTCATGCTAG  br-0.fa
77004  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
77004  CATGGGATAGATTTGGTGAGATTGGNNNNNNNNNNTNNNTTTTTGAGAGATGAACACGGTAAGGTCCTAATTCATGCTAG  c24.fa
77004  CATGGGATAGATTTGGTGAGATTGGNGGTGCTGCGCGGGTTTTTGAGAGATGAACACGGTAAGGTCCTAATTCATGCTAG  col-0.fa
77004  CATGGGATAGATTTGGTGAGATTNNNNNNNNNNNNTNNGTTTTTGAGAGATGAACACGGTAAGGTCCTAATTCATGCTAG  cvi-0.fa
77004  CATGGGATAGATTTGGTGAGATTGGNGGTGCTGCGCGGGTTTTTGAGAGATGAACACGGTAAGGTCCTAATTCATGCTAG  est-1.fa
77004  CATGGGATAGATTTGGTGAGATNGGAGGTGCTGCGCGGGTTTTTGAGAGATGAACACGGTAAGGTCCTAATTCATGCTAG  fei-0.fa
77004  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
77004  CATGGGATAGATTTGGTGAGATTGGNGGTGCTGCGCGGGTTTTTGAGAGATGAACACGGTAAGGTCCTAATTCATGCNNN  ler-1.fa
77004  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
77004  CATGGGATAGATTTGGTGAGATTGGNGNNNNNNNNTNGGTTTTTGAGAGATGAACACGGTAAGGTCCTAATNNNNNNNNN  nfa-8.fa
77004  CATGGGATAGATTTGGTGAGATTGGNGGTGCTGCGCGGGTTTTTGAGAGATGAACACGGTAAGGTCCTAATTCATGCTAG  rrs-10.fa
77004  CATGGGATAGATTTGGTGAGATTGGNGGTGCTGCGCGGGTTTTTGAGAGATGAACACGGTAAGGTCCTAATTCATGCTNG  rrs-7.fa
77004  CATGGGATAGATTTGGTGAGATTGGNGNNNNNNNNTGGGTTTTTGAGAGATGAACACGGTAAGGTCCTAATTCATGCTAG  sha.fa
77004  NNTGGGATAGATTTGGTGAGATTGGAGNNNNNNNNTNNGTTTTTGAGAGATGAACACGGTAAGGTCCTAATTCATGCTAG  tamm-2.fa
77004  NNNNGGATAGATTTGGTGNGATTNNNNNNNNNNNNTNNGTTTTTGAGAGATGAACACGGTAAGGTCCNAATTCATGCTAG  ts-1.fa
77004  NATGGGATAGATTTGNNNNGATTGGNGGTGCTGCGCGGGTTTTTGAGAGATGAACACGGTAAGGTCCTAATNNNNNNNNN  tsu-1.fa
77004  NATGGGATAGATTTGGTGAGATTGGNNNNNCTNCGTGGGTTTTTGAGAGATGAACACGGTAAGGTCCTAATNNNNNNNNN  van-0.fa
 
77084  AAGATCTTTTGCATCTGTTCATAGCAAGCTTGATGCTACTTTTCTTTGTTGGCAATGGGCCATGGAGAGTATGAAAAGTC  chr1.fa
77084  AAGATCTTTTGCATCTGTTCATAGCAAGCTTGATGCTACTTTTCTTTGTTGGCAATGGGCCATGGAGAGTATGAAAAGTC  bay-0.fa
77084  AAGATCTTTTGCATCTGTTCATAGCAAGCTTGATGCTNCTTTTCTTTGTTGGCAATGGGCCATGGAGAGTATGAAAAGTC  bor-4.fa
77084  AAGATCTTTTGCATCTGTTCATAGCAAGCTTGATNNNNNNNNNTNNNNNNGGCAATGGGCCATGGAGAGTATGAAAAGTC  br-0.fa
77084  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
77084  AAGATCTTTTGCATCTGTTCATAGCAAGCTNGANNNNNGNNNNNTTTGTTGGCAATGGGCCATGGAGAGTATGAAAAGTC  c24.fa
77084  AAGATCTTTTGCATCTGTTCATAGCAAGCTTGATGCTACTTTTCTTTGTTGGCAATGGGCCATGGAGAGTATGAAAAGTC  col-0.fa
77084  AAGATCTTTTGCATCTGTTCATAGCAAGCTTGATGCTANTTTTCTTTGTTGGCAATGGGCCATGGAGAGTATGAAAAGTC  cvi-0.fa
77084  AAGATCTTNTGCATCTGTTCATAGCAAGCTTGATGCTACTTTTCTTTGTTGGCAATGGGCCATGGAGAGTATGAAAAGTC  est-1.fa
77084  AAGATCTTTTGCATCTGTTCATAGCAAGCTTGATNNNNNNNNNTNNTGTTGGCAATGGGCCATGGAGAGTATGAAAAGTC  fei-0.fa
77084  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
77084  NNNNNNNNNTGCATCTGTTCATAGCNAGCTTGATGCTNCTTTTCTTTGTTGGCAATGGGCCATGGAGAGTATGAAAAGTC  ler-1.fa
77084  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
77084  NNNNNNNNNTGCATCTGTTCATAGCAAGCTTGATGCTACTTTTCTTTGTTGGCAATANNNNATGGAGAGTATGAAAAGTC  nfa-8.fa
77084  NNGATCTTTTGCATCTGTTCATAGCAAGCTTGATNNNNNTTTTCTTTGTTGGCAATGGGCCATGGAGAGTATGAAAAGTC  rrs-10.fa
77084  AAGATCTTTTGCATCTGTTCATAGCAAGCTTGATGCTNCTTTTCTTTGTTGGCAATGGGCCATGGAGAGTATGAAAAGTC  rrs-7.fa
77084  AAGATCNNNNNNNNNNTNNNNNNNNNNNNTTGATGCTACTTTTCTTTGTTGGCAATGGGCCATGGAGAGTATGAAAAGGN  sha.fa
77084  AAGNNNNNNNNNNNNNTNNNNNNNNNNNNTTGATGCTACTTTTCTTTGTTGGCAATGGGCCATGGAGANNNNNNNNNNGN  tamm-2.fa
77084  AAGATCTTTNGCATCTGTTCATAGCAAGCTTGATGCTNCTTTTCTTTGTTGGCAATGGGCCATGGAGAGTATGAAAAGTC  ts-1.fa
77084  NNNNNNNNNNNNNTCNGTTCATAGNNNNNNNNNNNNNNNNTTTCTTTGTTGGCAATGGGCCATGGAGAGTATGAANANNN  tsu-1.fa
77084  NNNNNNNNNNGCATCTGTTCATAGCAAGCTTGATGCTACTTTTCTTTNTTGGCAATANNNNATGGAGAGTATGAAAAGTC  van-0.fa
 
77164  TCAGAGTTGATAAAATCATCTTTGCCTCTGAAGACAATGATCTAATTGGAGCTGTTACGCGACTGCCGTCTTGGCCTTCG  chr1.fa
77164  TCAGAGTTGATAAAATCATCTTTGCCTCTGAAGACAATGATCTAATTGGAGCTGTTACGCGACTGCCGTCTTGGCCTTCG  bay-0.fa
77164  TCANNNNNNNNNNNNTCATCTTTGCCTCTGAAGACAATGATCTAATTGGAGCTGTTACGCGACTGCCGTCTTGGCCTTCG  bor-4.fa
77164  TCAGAGTTGANAAAATCATCTTTGCCTCTGAAGACAATGATCTAATTGGAGCTGTTACGCGACTGNCGTCTTNGCCTTCG  br-0.fa
77164  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
77164  TCAGAGTTGATAAAANNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNGGAGCTGTTACGCGACCGCCGTCTTGGCCTTCG  c24.fa
77164  TCAGAGTTGANAAAATCATCTTTGCCTCTGAAGACAATGATCTAATTGGAGCTGTTACGCGACTGCCGTCTTGGCCTTCG  col-0.fa
77164  TCAGAGTTGATAAAATCATCTTTGCCTNNNNGNNNNNNNNNCTAATTGGAGCTGTTACGCGACCGCCGTCTTGGCCTTCG  cvi-0.fa
77164  TCAGAGTTGATAAAATCATCTTTGCCTCTGAAGNCANNNNNNTAATTGGAGCTGTTACGCGACTGCCGTCTTGGCCTTCG  est-1.fa
77164  TCAGAGTTGATAAAATCATCTTTGCCTCTGAAGACAATGATCTAATTGGAGCTGTTACGCGACTGCCGTCTTGGCCTTCG  fei-0.fa
77164  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
77164  TCAGAGTNNNNNNNNNCATCTTTGCCTCTGAAGACAANGATCTAATTGGAGCTGTTACGCGACTGCCGTCTTGGCCTTCG  ler-1.fa
77164  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
77164  TCAGAGTTGATAAAATCATCTTTGCCTCTGAAGACAATGATCTAATTGGAGCTGTTACGCGACTGCCGTCTTGGCCTTCG  nfa-8.fa
77164  TCAGAGNNNNNNNNNNCATCTTTGCCTCTGAAGACAATGATCTAATTGGAGCTGTTACGCGACTGCCGTCTTGGCCTTCG  rrs-10.fa
77164  TCAGAGNNNNNNNAATCANCTTTGCCTCTGAAGANNNNNNTCTAATTGGAGCTGTTACGCGACTGCCGTCTTGGCCTTCG  rrs-7.fa
77164  NNNGAGNNGATAAAATCATCTTTGCCTCTGAAGACAATGATCTAATTGGAGCTGTTACGCGACTGCCGTCTTNGCCTNNA  sha.fa
77164  NNNNNNNNNNNNNNATCATCTTTGCCTCTGAAGACAATGATCTAATTGGAGCTGTTACGCGACTGCCGTCNNNNNNNNNA  tamm-2.fa
77164  TCAGAGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATTGGAGCTGTNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
77164  NNNNNNNNNNNNNNNTCNTCTTTGCNTCTGAANNNNNNNNNNNNNNNGGAGCTGTTACGCGACTGCCGTCTTGGCCTTCG  tsu-1.fa
77164  TCAGAGTTGANAAAATCATCTTNNNNNNNNNNNNNNNNNNNCTAATTGGAGCTGTTACGCGACTGCCGTCTTGGCCTTCG  van-0.fa
 
77244  TATAAATTTCAGATTCACTTTTTGTTGGGAGAATTAAGTAATTTTTTGGATTGGAATTGTGTGGTGAAGTAAGAAGCTCT  chr1.fa
77244  TATAAATTTCAGATTCACTTTTTGTTGGGAGANTTAAGTAATTTTTTGGNNNNGAATTGTGTGGRRRRRRRRRRRRRRRR  bay-0.fa
77244  TATAAATNNNNNNNNNNNNTTTTGTTNNNNNNNNNNNNNNNNNNNTTGGNTTGGAATTGTGTGGRRRRRRRRRRRRRRRR  bor-4.fa
77244  TATAAATNNNNNNNNNNNNNTTTGTTNNNNNNNNNNNNNNNNNNNNTGGNTTGGAATTGTGTGGRRRRRRRRRRRRRRRR  br-0.fa
77244  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGRRRRRRRRRRRRRRRR  bur-0.fa
77244  TATAAATTNNNNGNNNNNNNNNNNNNNCNNNNNNNNNNNNATTTTTTGGNNNNNNNNNNNGNGGRRRRRRRRRRRRRRRR  c24.fa
77244  TATAAATTNNNNANNCNCTTTTTGTTGGNNNNNNNNNNNNNNNNNTTGGNTTGGAATTGTGTGGRRRRRRRRRRRRRRRR  col-0.fa
77244  TATAANNNNNNNGNNNNNNNTTTGTTGGGAGAATTAAGTAANTTTTTGGNNNNNNNNNNNNCGGRRRRRRRRRRRRRRRR  cvi-0.fa
77244  TATAAANNNNNNNNNNNNNNNNNGTTNNNNNNNNNNNNNNNNNNNNNNNNTTGGAATTGTGTGGRRRRRRRRRRRRRRRR  est-1.fa
77244  TATAAATTTCAGATTCACTTTTTGTNGGGAGAATTAAGTNATTTTTTGGATTGGAATTGTGTGGRRRRRRRRRRRRRRRR  fei-0.fa
77244  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNRRRRRRRRRRRRRRRR  got-7.fa
77244  TATANNNNNNNNNNNNNCTTTTTGTTGGNNNNNNNNNNNNNNNNNNNGGATTGGAATTGTGTGGRRRRRRRRRRRRRRRR  ler-1.fa
77244  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRR  lov-5.fa
77244  TATAAATTTCAGATTCACTTTTTGTTGNNNNNNTTAANNNNNNNTTTGGATTGGAATTGTGTGGRRRRRRRRRRRRRRRR  nfa-8.fa
77244  TATAAATNNNNNNNNNNNTTTTTGTTGNNNNNNNNNNNNNNNNNNTTGGATTGGAATTGTGTGGRRRRRRRRRRRRRRRR  rrs-10.fa
77244  TATAANNNNNNNNNNNNNNNNTTGTTNNNNNNNNNNNNNNNNNNNNNGGATTGGANTTGTGTGGRRRRRRRRRRRRRRRR  rrs-7.fa
77244  NNNNNNNNNNNNATTCACTTTTTGTTGGGAGAATTAAGNNNNNNTTTGGATTGGAATTGTGTGGRRRRRRRRRRRRRRRR  sha.fa
77244  NNNNNNNNNNNNNNNNNNNNTTTGTNNNNNNNNNNNNNNNNNNNNNNGGATTGGAATTGTGTGGRRRRRRRRRRRRRRRR  tamm-2.fa
77244  NNNNNNNNNNNNNNTCACTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNGNRRRRRRRRRRRRRRRR  ts-1.fa
77244  TANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAATTGTGAGGRRRRRRRRRRRRRRRR  tsu-1.fa
77244  TATAANNNNNNNNNTNACTTTTTGTTNNNNNNNNNNNNNNNNNNNTTGGATTGGAATTGTGTGGRRRRRRRRRRRRRRRR  van-0.fa
 
77324  AATCTTGGAGCTCATCTTATTGCCAAGAGCGTGACAATGGAGGATCGCCGCCAATCGTATGTAGCAACCGGGTTTCCTTT  chr1.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  bay-0.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  bor-4.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  br-0.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  bur-0.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  c24.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  col-0.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  cvi-0.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  est-1.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  fei-0.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  got-7.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  ler-1.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  lov-5.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  nfa-8.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  rrs-10.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  rrs-7.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  sha.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  tamm-2.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  ts-1.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  tsu-1.fa
77324  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  van-0.fa
 
77404  TTGGCTGAAACATCTTTTTGAGAAAGAAAGAAGTATTGCTTAGTGTAATACTCATTGTGGTTGATCTAGAATGATTGTCC  chr1.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGTGTAATACTRARTGTGGTTGATRRRRRRRRRRRRRRR  bay-0.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNAATNNNRARNGTGGTTGATRRRRRRRRRRRRRRR  bor-4.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNRNANGNGGTTGATRRRRRRRRRRRRRRR  br-0.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNTAATNNNRNRNNNNNNNNNNRRRRRRRRRRRRRRR  bur-0.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNANNNNNRNANGNGGTTGNTRRRRRRRRRRRRRRR  c24.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNAATACTRARTGTGGTTGATRRRRRRRRRRRRRRR  col-0.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNNNNNNNNNRNANNNNNNNNNNRRRRRRRRRRRRRRR  cvi-0.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNATNCNRARTNTGGTTGATRRRRRRRRRRRRRRR  est-1.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNGTANNNNNRNANNNGGTTGNTRRRRRRRRRRRRRRR  fei-0.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNRNRNNNNNNNNNNRRRRRRRRRRRRRRR  got-7.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNAATNNNRARNGTGGTTGNTRRRRRRRRRRRRRRR  ler-1.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNRNRNNNNNNNNNNRRRRRRRRRRRRRRR  lov-5.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNRNANNNGGTTGATRRRRRRRRRRRRRRR  nfa-8.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNRARTGTGGTTGATRRRRRRRRRRRRRRR  rrs-10.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNTAATANNRARTGTGGTTGATRRRRRRRRRRRRRRR  rrs-7.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNRNRNNNNNNTGATRRRRRRRRRRRRRRR  sha.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNRNRNNNGGTTGATRRRRRRRRRRRRRRR  tamm-2.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNRNRNNNNNNNNNNRRRRRRRRRRRRRRR  ts-1.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNRNRNNNNNNNNNNRRRRRRRRRRRRRRR  tsu-1.fa
77404  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNRNRNNNGGTTGNTRRRRRRRRRRRRRRR  van-0.fa
 
77484  TTGATCCTAACTTTTTG   chr1.fa
77484  RRRRRRRRRRRRRRRRR   bay-0.fa
77484  RRRRRRRRRRRRRRRRR   bor-4.fa
77484  RRRRRRRRRRRRRRRRR   br-0.fa
77484  RRRRRRRRRRRRRRRRR   bur-0.fa
77484  RRRRRRRRRRRRRRRRR   c24.fa
77484  RRRRRRRRRRRRRRRRR   col-0.fa
77484  RRRRRRRRRRRRRRRRR   cvi-0.fa
77484  RRRRRRRRRRRRRRRRR   est-1.fa
77484  RRRRRRRRRRRRRRRRR   fei-0.fa
77484  RRRRRRRRRRRRRRRRR   got-7.fa
77484  RRRRRRRRRRRRRRRRR   ler-1.fa
77484  RRRRRRRRRRRRRRRRR   lov-5.fa
77484  RRRRRRRRRRRRRRRRR   nfa-8.fa
77484  RRRRRRRRRRRRRRRRR   rrs-10.fa
77484  RRRRRRRRRRRRRRRRR   rrs-7.fa
77484  RRRRRRRRRRRRRRRRR   sha.fa
77484  RRRRRRRRRRRRRRRRR   tamm-2.fa
77484  RRRRRRRRRRRRRRRRR   ts-1.fa
77484  RRRRRRRRRRRRRRRRR   tsu-1.fa
77484  RRRRRRRRRRRRRRRRR   van-0.fa
 
visited.