Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 77537 - 80345


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
77537  TTCAGTGAAAAAAAAAAAAAAAAGCACAACCTCTAAGCAAAGCAGAATTACAATTAAACATAATTGGGCCTAATACGAGA  chr1.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNNACCTCTAAGCAAAGCAGAATTACAATTAAACATAATTGGRRRRRRRRCGAGA  bay-0.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNCAACCTCTAAGCAAAGCAGANNNNNNNNNNNNNNNNNTNGGRRRRRRRRCGAGA  bor-4.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNNACCTCTAAGCAAAGCAGAANNNNNNNNNNACATAATTGGRRRRRRRRCGAGA  br-0.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNAACCTCTAAGCAAAGCAGAATTANNNNNNAACATAATTGGRRRRRRRRCGAGA  bur-0.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNCAACCTCNAAGCAAAGCAGAATTACNNNNNAACATANTTGGRRRRRRRRCGAGA  c24.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNNNNNTCNAAGCAAAGCAGAATNNNNNNNNNNNNNNNTNGGRRRRRRRRCGAGA  col-0.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNNNCCTCTAAGCAAAGCAGAATTACNNNNNNNNNNNNNNNNRRRRRRRRCGAGA  cvi-0.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNNNNNNCTAAGCAAAGCAGAANNNNNNNNNNNNNTNATNGGRRRRRRRRCNAGA  est-1.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNCAACCTCTAAGCAAAGCAGAATTACANNNNNNCATANTTGGRRRRRRRRCGAGA  fei-0.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNNNCCTCTAAGCAAANNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRNNNNN  got-7.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNCAACCTCNAAGCAAAGCAGAANNNNNNNNNNNNNNNNNNNGRRRRRRRRCGAGA  ler-1.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNNNNNTCTAAGCAAAGNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRNNNNN  lov-5.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNCAACCTCTAAGCAAAGCAGAATTACNNNNNNNNATAATTGGRRRRRRRRCGAGA  nfa-8.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNAACCTCTAAGCAAANNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRNGNGA  rrs-10.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNNACCTCTAAGCAAAGCNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRCGAGA  rrs-7.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNNACCTCTAAGCAAAGCAGAATTANNNNNNNNNNNNATTGGRRRRRRRRCGAGA  sha.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNNACCTCTAAGCAAAGCAGAATNNNNNNNNNNNNNNNNNNGRRRRRRRRCGAGA  tamm-2.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNNACCTCTAAGCAAAGCAGAATTANNNNNNNNNNNNNNNNGRRRRRRRRCGAGA  ts-1.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNNNNNNNNNAGCAAANNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRCGAGA  tsu-1.fa
77537  RRRRRRRRRRRRRRRRNRRRNNNNNNNAACCTCTAAGCAAAGCAGAATTNNNNNNNNNNNNNNTTGGRRRRRRRRCGAGA  van-0.fa
 
77617  TTGTAAGACAGATGGGCCATTGAAGAAGTCACATTGCAAAGTCAGTCTTATTTAGAAACGAACGATAACGGAAGCTTCTC  chr1.fa
77617  TTGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCAGTCTTATTTAGAAACGAACGATAACGGAAGCTTCTC  bay-0.fa
77617  TTGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCANNNNNNNNTAGAAACGAACGATAACGGAAGCTTCTN  bor-4.fa
77617  TTGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCAGTCTTATTTAGAAACGAACGATAACGGAAGCTTCTC  br-0.fa
77617  NNANNNNACAGATGGGCCATRGARGAAGTCACATTGCAAAGTNNNNNNNNNNNNNNNNNNNANNNNNNNGGAAGCTTCNN  bur-0.fa
77617  TTGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCAGTCTTATTTAGAAACGAACGATAACGGAAGCTTCTN  c24.fa
77617  TTGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCAGTCTTATTTAGAAACGAACGATAACGGAAGCTNCTN  col-0.fa
77617  TTGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCAGTCTTATTTAGAAACGAACGATAACGGAAGCTTCTN  cvi-0.fa
77617  TTGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCAGTCTTNTTTAGAAACGAACGATAACGGAAGCTTCTN  est-1.fa
77617  TTGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCAGTCTTATTTAGAAACGAACGATAACGGAAGCTTCTC  fei-0.fa
77617  NNNNNNNNNNNNTGGGCCATRGARGAAGTCACATTGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
77617  TTGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCAGTCTTNTTTAGAAACGAACGATAACGGANNNNNNNN  ler-1.fa
77617  NNNNNNNNNNNNNNNGCNNTRGARGANGTCACATTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
77617  TTGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCAGTCTTATTTAGAAACGAACGATAACGGAAGCTTCTC  nfa-8.fa
77617  TNGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCANNNNNNNNNNNNNACGAACGATAACGGAAGCTTCTN  rrs-10.fa
77617  TTGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCAGTCTTATTTAGAAACGAACGATAACGGAAGCTTCTC  rrs-7.fa
77617  TTGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCAGTCTTATTTAGAAACGAACGATAACGGAAGCTTCTN  sha.fa
77617  TTGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCAGNCNNANTTAGAAACGAACGATAACGGAAGCTNNNN  tamm-2.fa
77617  TTGTAAGACAGATGGGCCNTRGARGANGTCACATTGCAAAGTCAGTCTTATTTAGAAACGAACGATAACGGAAGCTNNNN  ts-1.fa
77617  TTGTAAGACAGATGGGCCATRGARGNAGTCACATTGCAAAGTCANTNNNNNNNNNNNNNGAACGATAACGGAAGNNNNNN  tsu-1.fa
77617  TTGTAAGACAGATGGGCCATRGARGAAGTCACATTGCAAAGTCAGTCTTATTTAGAAACGAACGATAACGGAAGCTTCTC  van-0.fa
 
77697  TATAATCTTGGGGTACTTTAGGAATTTCGTCTGCCATATTGATCCCATTTCATTTATTTTTGTCCCCGTTTCCGTTACAA  chr1.fa
77697  TATAATCTTGGGGTACTTTAGGAATTTCGTCTGCCATATTGATCCCATTTCANNNNNNTTTGTCNCCGTTTCCGTTACAA  bay-0.fa
77697  NNNNNNNNNNNNNNNNNTTAGGAATTTCGTCTGCCATATTGATNNNNNNNNNNNNNNNTTTGTCCCCGTTTCCGTTACNN  bor-4.fa
77697  TANNATNTTGGGGTNCTTTAGGAATTTCGTCTGCCATATTGATCNNNNNNNNNNNNNNNTTGTCCCCGTTTCCGTTACAA  br-0.fa
77697  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAA  bur-0.fa
77697  NNNNNNNNNNNGGTACTTTAGGAATTTCGTCTGCCATATTGATCCCATTTCNNNNNTTTTTGTCCCCGTTTCCGTTACAA  c24.fa
77697  NNNNNNNTTGGGGTACTTTAGGAATTTCGTCTGCCATATTGNTNNNNNNNNNNNNNNNTTTGTCNCCGTTTCCGTTACAA  col-0.fa
77697  NNNNNNNNNNNNNNNCTTTAGGAATTTCGTCTGCCATATTGATCCCATTTCNNNNNNNNNNNNNNNANNNNNNGTTACAA  cvi-0.fa
77697  NNNNNNNNNNNNNTACTTTAGGAATTTCGTCTGCCATATTGATNNNNNNNNNNNNNNNNNNGTCCCCGTTTCCGTTACAA  est-1.fa
77697  TATAATCTTGGGGTACTTTAGGAATTTCGTCTGCCATATTGATCCCATTTCATTTNTTTTTGTCCCCGTTTCCGTTACAA  fei-0.fa
77697  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
77697  TANAATCTTGGGGTACTTTNGGAATTTCGTCTGCCATATTGATCCNNNNNNNNNNNNNTTTGTCCCCGTTTCCGTTACAA  ler-1.fa
77697  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
77697  TANAATCTTGGGGTACTTTAGGAATTTCGTCTGCCATATTGATCCCATTTNNNNNNTTTTTGTCCCCGTTTCCGTTACAA  nfa-8.fa
77697  NNNNNNNNNNNNNNNNNTTAGGAATTTCGTCTGCCATATTGATNNNNNNNNNNNNNNNNTTGTCCCCGTTTCCGTTACNN  rrs-10.fa
77697  TANAANCTNGGGGTACTTTNGGAATTTCGTCTGCCATATTGATCNNNNNNNNNNNNNNNTTGTCCCCGTTTCCGTTACAA  rrs-7.fa
77697  NNNNNNNNNNNGGTACTTTAGGAATTTCGTCTGCCATATTGATCCCATTTCNNNNNTTTTTGTCCCCGTTTCCGTTACAA  sha.fa
77697  NNNNNNNNNNNNNNNNNTTAGGAATTTCGTCTGCCATATTGANCNNNNNNNNNNNNNNNTNGTCCCCGTTTCCGTTACAA  tamm-2.fa
77697  NNNNNNNNNNNNNNNNNTTAGGAATTTCGTCTGCCATATTGATCNNNNNNNNNNNNTTTTTGTCCCCGTTTCCGTTACAA  ts-1.fa
77697  NNNNNNNNNNNNNNNNNTTAGGAATTTCGTCTGCCATATTGATNNNNNNNNNNNNNNNNNNGTCCCCGTTTCCGNTNNNN  tsu-1.fa
77697  TANNNNNNNNGGGTACTTTAGGAATTTCGTCTGCCATATTGATCNNNNNNNNNNNNNNNTTGTCCCCGTTTCCGTTACAA  van-0.fa
 
77777  AGATTTCCTTTTATTTGTTTCCATTCAATATTGTTTGTGTCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGA  chr1.fa
77777  AGATTRCNRTTNNTTTGTTTCCATTCAATNTTGTTTGTGNCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGR  bay-0.fa
77777  NNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGTGATACATAGTGAGNCGTGTTTATAACCCCANANR  bor-4.fa
77777  NGNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGR  br-0.fa
77777  AGATNRNNRNNNNTTTGTTTCCATTCAATATTGTTTGTGNCTTTGTGATACATAGTGAGACGTGTTTATAANNNNNNNNR  bur-0.fa
77777  AGATTRNNRNNNNTTTGTTTCCATTCAATATTGTTTGTGNCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGR  c24.fa
77777  AGNNNRNNRNNNNNNNNNNNNNNNNCANNNNNNNNTNNNNCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGNGR  col-0.fa
77777  AGNTNRNNRNNNNNNNNNNNNCATTCAATNTTGTTTGTGTCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGR  cvi-0.fa
77777  ANNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTGATACATAGTGAGACGTGTTTATAACCCCANNGR  est-1.fa
77777  AGATTRNNRNNNNNNNNTTTCCATTCAATATTGTTTGTGTCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGR  fei-0.fa
77777  NNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATACATAGTGAGACGTGTTTATAACCCCANANR  got-7.fa
77777  ANNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGTGATACATAGTGAGACGTGTTTATAACCCCANNGR  ler-1.fa
77777  NNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATAGTGAGACGTGTTTATAACCCCANAGR  lov-5.fa
77777  AGNTNRNNRNNNNNNNNNNTCCATTCAATATTGTTTGTGTCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGR  nfa-8.fa
77777  NNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTCTTTGTGATACATAGTGAGACGTGTTTATAACCCCANAGR  rrs-10.fa
77777  AGNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTNTGTGATACATAGTGAGACGTGTTTATAACCCCAGNNR  rrs-7.fa
77777  AGNTNRNNRNNNNNNNNTTTCCATTCAATATTGTTTGTGTCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGR  sha.fa
77777  ANNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGR  tamm-2.fa
77777  AGNNNRNNRNNNNNNNNNNNNNNNNNNNNNNTGTTTNNNTCTTTGTGATACATAGTGAGACGTGTTTATAACCCCANNGR  ts-1.fa
77777  NNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGTGAGNCGTGTTTATAACCCCANANR  tsu-1.fa
77777  AGNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGATACATAGTGAGACGTGTTTATAACCCCANAGR  van-0.fa
 
77857  GACCTAATCGATCGAAATTCCCTCAATTTGAAGATCGTTAGTTTGTTATCTCTTTCTCTTCTAATTCTTTTTTTACTTAG  chr1.fa
77857  RRRRRRRTCNATCGAAATTCCCTCAATTTGAAGATCGTTAGTTTGTTATCTCTNNNNNNNCNANNTNTTTTTTTANTTRG  bay-0.fa
77857  RRRRRRRTCNATCGAAATTCCCTCAATTTGAAGATCNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  bor-4.fa
77857  RRRRRRRTCGATCGAAATTCCCTCAATTTGAAGATCGTTNGTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  br-0.fa
77857  RRRRRRRTCGATCGAAANNNNNNNNNNNNNNNNNNNNNNNNNNTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  bur-0.fa
77857  RRRRRRRTCGATCGAAATTCCCTCAATTTGAAGATCGTTAGTTTGTTNTNNNNNNNNNNNNNNNNNNNNTTTTTNNNNRN  c24.fa
77857  RRRRRRRTCGATCGAAATTCCCTCAATTTGAAGATCGTTNGNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  col-0.fa
77857  RRRRRRRTCGATCGAAATTCNNNNNCNNNNNNNNTCGTTAGTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  cvi-0.fa
77857  RRRRRRRTCGATCGAAATTCCCTCAATTTGAAGATCGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  est-1.fa
77857  RRRRRRRTCGATCGAAATTCCCTCAATTTGAAGATCGTTAGTTTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  fei-0.fa
77857  RRRRRRRTCGATCGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  got-7.fa
77857  RRRRRRRTCGATCGAAATTCCCTCAATTTGAAGATCGTTNGTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  ler-1.fa
77857  RRRRRRRNCGATCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  lov-5.fa
77857  RRRRRRRTCGATCGAAATTCCCTCAATTTGAAGATCGTTAGTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNTTTNNNNRN  nfa-8.fa
77857  RRRRRRRTCGATCGAAATTCCCTCAATTTGAAGATCGTTAGTTTNNNNNNNNNNNNNNNNNNNNNNNTTTTNNNNNNNRN  rrs-10.fa
77857  RRRRRRRTCGATCGAAATTCCCTCAATTTGAAGATCGTTAGTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  rrs-7.fa
77857  RRRRRRRTCGATCGAAATTCCCTCAATTTGAAGATCGTTAGTTTGTNNNNNNNNNNNNNNNNNNNNNNTTTTTTNNNNRN  sha.fa
77857  RRRRRRRTCGATCGAAATTCCCTCAATNNNNAGATCGTTNGNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  tamm-2.fa
77857  RRRRRRRNCGATCGAAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  ts-1.fa
77857  RRRRRRRNCGNTCGAAATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  tsu-1.fa
77857  RRRRRRRTCGATCGAAATTCCCTCAATTTGAAGATCGTTNGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRN  van-0.fa
 
77937  ATGATCTTGATTTCCACTCTTCAAATCAAGTAATCTAGTCGAGTGTTTGTGTGTGTGTTCGATTTCTGAAGAAAAACAAC  chr1.fa
77937  NTGATCTTGATTTCCACTCTTCARRTCAAGTAATCTAGTCGAGTNNNNNNNNNNNNNNNCGANTTRTGAAGNNNNNNNNC  bay-0.fa
77937  NNNNNNNNGNTTTCCACTCTNNNRRNNNNNNNATCTAGTCGAGTGTTNNNNNNNNNNTTCGATNNRNNNNNNNNNNNNNN  bor-4.fa
77937  NNNNNNNTGATTTCCACTCTTCNRRTNNAGTAATCTAGTCGAGTGTTNNNNNNNNNNTTCGANTTRTNNANNNNNNNNNN  br-0.fa
77937  NNNNNNNNGATTTCCACTCTTCARRTNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNTCGATTTRTGAAGAAAAACAAC  bur-0.fa
77937  NNGATCTTGATTTCCACTCTTCARRTCAAGTAATCTAGTCNNNNNNNNNNNNNNNNNNTCGATTTRTGAAGAAAAANNNN  c24.fa
77937  NNNNNNTTGATTTCCACTCTTNNRRNNNAGTAATCTAGTCGAGTGTNNNNNNNNNNNNNCGNNNNRNNNNNNNNNNNNNN  col-0.fa
77937  NNNNNCTTGATTTCCACTCTTCARRTCNAGTAATCTAGTCGNNNNNNNNNNNNNNNNNNNGANNNRNGANNNNNNNNNNN  cvi-0.fa
77937  NNNNNNNNGATTTCCACTCTNNNRRNNNAGTAATCTAGTCGAGTGTTTNNNNNNNNNNTCGANNNRNNANNNNNNNNNNN  est-1.fa
77937  NNGATCTTGATTTCCACTCTTCARRTCNAGTAATCTAGTCGAGTGTNNNNNNNNNTGTTCGATTNRTGAAGAAAAANNNN  fei-0.fa
77937  NNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGATNTRNGNNNNNNNNNNNN  got-7.fa
77937  NNNNNNTTGATTTCCACTCTNNNRRNNNNNNNNTCTAGTCGAGTGTNNNNNNNNNNNNNCGANNNRNNNNNNNNNNNNNN  ler-1.fa
77937  NNNNNNNNNNNNNCCACTCNNNNRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNN  lov-5.fa
77937  NNNNTCTTGATTTCCACTCTTCARRNNNAGTAATCTAGTNNNNNNNNNNNNNNNNNNNTCGATTTRTGANNNNNNANNNN  nfa-8.fa
77937  NNNNNNNTGATTTCCACTCTTNNRRNNNNNNAATCTAGTCGAGTGTTNNNNNNNNNGTTCGANNNRNNNNNNNNNNNNNN  rrs-10.fa
77937  NNNNNNNTGATTTCCACTCTTCARRNNNNNNNATCTAGTCGAGTGNNNNNNNNNNNNTTCGATTNRNNANNNNNNNNNNN  rrs-7.fa
77937  NNNNTCTTGATTTCCACTCTTCARRNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNTCGATTTRTGANNNNNNNNNNN  sha.fa
77937  NNNNNNNTGATTTCCACTCTNNNRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGATTNRNGNNNNNNNNNNNN  tamm-2.fa
77937  NNNNNNNTGATTTCCACTCTTCNRRNNNAGTAATCTAGNNNNNNNNNNNNNNNNNNNNTCGANNNRNNNNNNNNNNNNNN  ts-1.fa
77937  NNNNNNNNNATTTCCACNNNNNNRRNNNNNNNNNNNNNTCGAGTGNNNNNNNNNNNNNNCGANNNRNNNNNNNNNNNNNN  tsu-1.fa
77937  NNNNTCTTGATTTCCACTCTTNNRRTNNAGTAATCTAGTCNNNNNNNNNNNNNNNNGTTCGANNNRTGNNNNNNNNNNNN  van-0.fa
 
78017  AAAATTGAATTCGTTGTTTGGGGGGATAACGATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTTCAAAAGGTATCTT  chr1.fa
78017  AAAATTGAATTCGTTGTTTGGGGGGATAACGATGATCAGAAAGCNAAAAGGGAAGGCTCTCTGATTRCRAAAGGTATCTT  bay-0.fa
78017  NNNNNNNNNNNNNNNGTTTGGGGGGATAACGANGATCAGAANNNNNAAAGGGAAGGCTCTCTGNNNRNRNNNNNNNNNNN  bor-4.fa
78017  NNAATNNNNNNNGTTGTTTGGGGGGATAACGATGATCAGAAAGCNAAAAGGGAAGGCTCTCTGATTRCRNNNNNNNNNNN  br-0.fa
78017  AAAATTGAATTCNNNNNNNNNNNNNNNNNNNATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRCRAAAGGTATCNN  bur-0.fa
78017  AAAATTNNNNNNNNNNNNNNNNNNNNNNNNGATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRCRAAAGGNNNNNN  c24.fa
78017  NANNNNNNNNNNGTTGTTTGGGGGGATAACGATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRNRNNNNNNNNNNN  col-0.fa
78017  AANANNNNNNNNNNNNNNNNNNNNNNNNNCGATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRCRAAAGGNNNNNN  cvi-0.fa
78017  NNNANNNNNNNNNNNGTTTGGGGNNNNNACGATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRNRNNNNNNNNNNN  est-1.fa
78017  AAAATNGAATTCGTNGTTTGGGGGGATAACGATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRCRAAAGGNNNNNN  fei-0.fa
78017  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTAAAAGGGAAGGCTCTCTGNTNRNRNNNNNNNNNNN  got-7.fa
78017  NNNNNNNNNNNNGTTGTTTGGGGGGATAACGATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGNNNRNRNNNNNNNNNNN  ler-1.fa
78017  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGCNAAAAGGGAAGGCTCTCTGNNNRNRNNNNNNNNNNN  lov-5.fa
78017  AANATNGAATTCGTTGTTTGGGGGGATAACGATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRCRANNGGTNNNNN  nfa-8.fa
78017  NNNNNNNNNNNNNTTGTTTGGGGGGATAACGATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRNRNNNNNNNNNNN  rrs-10.fa
78017  NNNNNNNNNNNNNNTGTTTGGGGGGATAACGATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRNRNNNNNNNNNNN  rrs-7.fa
78017  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGNTTRCRAAAGGNNNNNN  sha.fa
78017  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRNRNNNNNNNNNNN  tamm-2.fa
78017  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRCRNNNNNNNNNNN  ts-1.fa
78017  NNNNNNNNNNNNNNNNNNTGGGGGGATAACGATGATCAGAAAGCNAAAAGGGAAGGCTCTCTGNNNRNRNNNNNNNNNNN  tsu-1.fa
78017  NNAATTGAATNNGTTGTTTGGGGGGATAACGATGATCAGAANGCTAAAAGGGAAGGCTCTCTGATTRCRNNNNNNNNNNN  van-0.fa
 
78097  TCTTTCTTTATTTGTTTCAGTTGTAAATTACTTCCAAAAGATTCCGAATCTAGTTTCTCTCTTCCTTATGTAGTAGATTT  chr1.fa
78097  TNNNNNNNNNNNTGTTTCAGTTGTAAATTACTTCCAAAAGATTCCGAATCTAGTTTCTCTCTTCCTTATGTARRRRRRRR  bay-0.fa
78097  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGATTCCGAATCNNNNNNNNNNNNNNNNNNTNNNRRRRRRRR  bor-4.fa
78097  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCAAAAGATTCCGAATCTAGTTTNNNNNTNNCNTATNTNRRRRRRRR  br-0.fa
78097  NNNNNNNNNNNNTGTTTCAGTTGTAAATTACTTCCAAAAGATTCCGAATCTAGTTTCTCTCTTCCTTATGTARRRRRRRR  bur-0.fa
78097  NNNNNNNNNNNNNNTTTCAGTTGTAAATTACTTCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTARRRRRRRR  c24.fa
78097  NNNNNNNNNNNNNNNNNNNNNNGNAANNNNNTTCCAAAAGATTCCGAATCNAGTTNNNNNNNNNNNNNNNTARRRRRRRR  col-0.fa
78097  NNNNNNNNNNNNNNNNNNAGTTGTAAATTACTTCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRR  cvi-0.fa
78097  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCAAAAGATTCCGAATCTAGTTNNNNNNNNNNNNNNNNNRRRRRRRR  est-1.fa
78097  NNNNNNNNNNNNNNNNTCAGTTGTAAATTACTTCCAAAAGATTCCGAATCTAGTTTCTCTCTTCCTTATGTARRRRRRRR  fei-0.fa
78097  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRR  got-7.fa
78097  NNNNNNNNNNNNNNNNNNNNNNGTAAATNNNNNNNAAAAGATTCNNNNNNNNNNNNNNNNNNNNNNNNNNTNRRRRRRRR  ler-1.fa
78097  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRR  lov-5.fa
78097  NNNNNNNNNNNNNGNNNNNGTTGTAAATTACTTCCAAAAGATTCCGAATCTAGTTTCTCTCTTCCTTATGTARRRRRRRR  nfa-8.fa
78097  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCAAAAGATTCCGAATCTAGTTTCTNNNNNNNNNNNNTNRRRRRRRR  rrs-10.fa
78097  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCAAAAGATTCCGANNNNNNNNNNNNNNNNNNNNNNNTNRRRRRRRR  rrs-7.fa
78097  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAAGATTCCGAATCTAGTTTCTCTCTTCCTTATGTARRRRRRRR  sha.fa
78097  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGATTCCGAATCTAGTTTCTNNNNNNNNNNTNNNRRRRRRRR  tamm-2.fa
78097  NNNNNNNNNNNNNNNNNNNGTTGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRR  ts-1.fa
78097  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRR  tsu-1.fa
78097  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAAAGATTCCGAATCTAGTTTCTCTNNNNNNNNNNNNRRRRRRRR  van-0.fa
 
78177  GCCATCATATCTTCTCCGGCTTTTCGCCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAATAAAG  chr1.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGNCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAG  bay-0.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGCCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAG  bor-4.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGNCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAG  br-0.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGNCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAG  bur-0.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGCCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAG  c24.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGCCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAG  col-0.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGCCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAATAAAG  cvi-0.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGCCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAG  est-1.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGNCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAG  fei-0.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGCCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANNNNN  got-7.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGCCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAG  ler-1.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGCCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAANNNNNNNN  lov-5.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGCCGTTGTCGTGAACACAATTACATTCCGCTNTCACCGCCACAACAAGAANAAAG  nfa-8.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGCCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAG  rrs-10.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGCCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAG  rrs-7.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGNCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAG  sha.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGCCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAG  tamm-2.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGCCGTTGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAG  ts-1.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRNNNCGTTGTCGTGAACACAATTACATNCNNNNNNNNNNNCCACAACAAGAANANNN  tsu-1.fa
78177  RRRRRRRRRRRRRRRRRRRRRRRRCGCCGTTGTCGTGAACACAATTACATTCCGCTNTCACCGCCACAACAAGAANAAAG  van-0.fa
 
78257  CCCATAACGATAATTATCTTACATTCCGCATACAACACAATTATACAATCTATTGGCCACGTCATTTTCTATCCTATATT  chr1.fa
78257  CCCANAANGANAATTATCTTACATTCCGCATACAACACAATTATACAARCTATTGGCCACGTCATTTTCTATCCTRRRRR  bay-0.fa
78257  CCCANNNNNNNNNNNNNNTTACATTCCGCATACAACANNNNNNNNNNARCTATTGGCCACGTCATTTNNNNNNNNRRRRR  bor-4.fa
78257  CCCANAANNNNNNNNNNCTTACATTCCGCATACAACANNNNNNNANNNRCTATTGGCCACGTCATTTTNNNNNNNRRRRR  br-0.fa
78257  CNNNNNNNNNNNNNNNNNNNNNATTCCGCATACAACACAATTATACAARCTATTGGCCACGTCATTTTCTATCCTRRRRR  bur-0.fa
78257  CCCATAACGATANNNNTCTTACATTCCGCATACAACACAATTATACAARCTATTGGCCACGTCATTTTCTATNNNRRRRR  c24.fa
78257  CCCANAANNNNNNNNNNNTTACATTCCGCATACAACACNNNNNNNCNNRCTATTGGCCACGTCATTTNNNNNNNNRRRRR  col-0.fa
78257  CNNNNNNNNNNNNNNNNNNNNNNTTCCGCATACAACACAATTATACAARCTATTGGCCACGTCATTTTCTATNNNRRRRR  cvi-0.fa
78257  CCCANNNNNNNNNNNNNNTTACATTCCGCATACAACACNNNNNNNNNNRNNATTGGCCACGTCATTTTNNNNNNNRRRRR  est-1.fa
78257  CCCATAACGATANTTATCTTACATTCCGCATACAACACAATTATACAARCTATTGGCCACGTCATTTTCTATCNNRRRRR  fei-0.fa
78257  NNNNNNNNNNNNNNNNNNNNNNNNNNNGCATACANNNNNNNNNNNNNNRNNNTTGGCCACGTCATTNNNNNNNNNRRRRR  got-7.fa
78257  CCCATAANNNNNNNNNNNNTACATTCCGCATACAACNNNNNNNNNNNNRNNNTTGGCCACGTCATTTTNNNNNNNRRRRR  ler-1.fa
78257  NNNNNNNNNNNNNNNNNNNNNNNNNNCGCANACAACNNNNNNNNNNNNRNNNTTGGCCACGTCATTTNNNNNNNNRRRRR  lov-5.fa
78257  CCCATAACGATNNNNNTCTTACATTCCGCATACAACACAATTATACAARCNATTGGCCACGTCATTTTCTATNNNRRRRR  nfa-8.fa
78257  CCCATANNNNNNNNNNTCTTACATTCCGCATACAACACAANTATACNARCTATTGGCCACGTCATTTNNNNNNNNRRRRR  rrs-10.fa
78257  CCCATAANNNNNNNNNNNNTACATTCCGCATACAACACNNNNNNNNNNRNNNTTGGCCACGTCATTTTNNNNNNNRRRRR  rrs-7.fa
78257  NNNNNNNNNNNNNNNNNNNNNNNTTCCGCATACAACACAATNATACAARCTATTGGCCACGTCATTTTCTATNNNRRRRR  sha.fa
78257  CNNNNNNNNNNNNNNNNNNNNNNNNCCGCATACAACACNNNNNNNNNARCTATTGGCCACGTCATTTTNNNNNNNRRRRR  tamm-2.fa
78257  NNNNNNNNNNNNNNNNNNNNNNNNTCCGCATACAACACNNNNNNNNNNRNNNNNNNCCACGTCATTTNNNNNNNNRRRRR  ts-1.fa
78257  NNNNNNNNNNNNNNNNNNNTACATTCCGCATACAANANNNNNNNNNNNRNNNTTGGCCACGTCATTTNNNNNNNNRRRRR  tsu-1.fa
78257  CCCANAANNNNNNNNNNCTTACATTCCGCATACAACACNNNNNNNCNARCTATTGGCCACGTCATTTNNNNNNNNRRRRR  van-0.fa
 
78337  TTCAGTTATTCTTTTTTTAATATTTTTTAGCTCTAAACATAAATAGATTTTCAAAGTTTTTTATCGTTTTTATTTTCAAA  chr1.fa
78337  TTCNNNNRNNNTTNTTTNNNNNTTTTTTAGCTCTNANRANRAANAGATTTTCAAAGTTTTTNNNNNNNNNNATTTTCAAA  bay-0.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNTAGCTNNNNNRNNRNNNAGATTTTCAAAGTTTNNNNNNNTTTTTATTTTCAAN  bur-0.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNAGTTTNNNNNNNNNNNTNTTNNNNNN  c24.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNN  col-0.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNTNNNNNN  cvi-0.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNNNNNNN  fei-0.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNN  nfa-8.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNAGTTTNNNNNNNNNNTTNTTNNNNNN  sha.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
78337  NNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
78417  TTCCTATAATCGTTTTTGTTTTATTTAGATTTATTTTATTTTTAATTATATTTTTATATACTACTATTAAAACGTATTAT  chr1.fa
78417  TTCCTATAATCGTTTTTGTNNNRNNNNNNNNNNTNNNNNRTNRRRRRRTNTTTTTANNNRRTNNTATTAAAACGTATNNT  bay-0.fa
78417  NNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  bor-4.fa
78417  NNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  br-0.fa
78417  TTCCTATAATCGTTNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNACGTATNNT  bur-0.fa
78417  NNNCTATAATCGTTTNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  c24.fa
78417  NNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  col-0.fa
78417  NNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  cvi-0.fa
78417  NNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  est-1.fa
78417  NNNNTATANNNNNNNTTNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  fei-0.fa
78417  NNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  got-7.fa
78417  NNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  ler-1.fa
78417  NNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  lov-5.fa
78417  NNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  nfa-8.fa
78417  NNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  rrs-10.fa
78417  NNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  rrs-7.fa
78417  NNNNTATANNNNTTNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  sha.fa
78417  NNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  tamm-2.fa
78417  NNNNNNNNNNNNNNNTTNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  ts-1.fa
78417  NNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  tsu-1.fa
78417  NNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNN  van-0.fa
 
78497  AAGGTTTTTTATAAGTGCTAAAATTTTTAATTTTTTTAAACTAATCAGATACAATATCCAAAATACTAAAAAGTGTCTCT  chr1.fa
78497  RAGGTTTTTTATAAGTGRNNAAANTTRNNNNNTTTTTAAACTAATCAGATACAANATCCAANNNNNNAAAAAGTGTCTCT  bay-0.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
78497  RANNTTTTTNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNATACAATATCCAAAATACTAAAAAGTGTCTCT  bur-0.fa
78497  RNNNNNNTTTATNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNATACAANATCCAAAATACTAAAAAGTGNCTCT  c24.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNN  col-0.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
78497  RNNNNNNNNNNNAANNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNTACAATATCCNAAATACTAAAAAGTGTCTCT  fei-0.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNN  ler-1.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
78497  RNNNNNNNNNATAANNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNGATACNNNNNNNNNNNNNNNNNNNNNNNNNNCT  nfa-8.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNATACANNNNNCAAANNNNNANAANNNNNNNNT  sha.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNN  tamm-2.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNANNNNNNNNNNNN  ts-1.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
78497  RNNNNNNNNNNNNNNNNRNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
78577  ATCTTTTTCTATTCAAAATATTGAGTTGTCTTTGACAATATTTTAAACTAGTTGTAAATCACAGAGATAAACACCACATA  chr1.fa
78577  ATCTTTTTCTATTCAAAATATTGAGTNNNNNNTGACAATATTTTAAACTAGTTGTAAATCACAGAGATAAACACCACANA  bay-0.fa
78577  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAATCACAGAGATAAACACCACANN  bor-4.fa
78577  NNNNNNNNNNNNNNNNNNNNNTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTAAATCACAGAGATAAACACCANNNN  br-0.fa
78577  ATCTTTTTCTATTCAAAATATTGAGTTGTCTTTGNCAATATTTTAANCTAGTTGTAAATCACAGAGATAAACACCNNNNN  bur-0.fa
78577  ATCTNNNNNNNNNCNAAATATTGAGTNNNNNNNGNNNNTATTTTAANCTAGTTGTAAATCACAGAGATAAACANNNNNNN  c24.fa
78577  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGTAAATCACAGAGATAAACACCANNNN  col-0.fa
78577  NTNNNNNNNNNNNNNNNNNNNTGAGTTGNNTTTGACANNNNNNNNNNNNNNTTGTAAATCACAGAGATAAACACCACANN  cvi-0.fa
78577  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTAAATCACAGAGATAAACACCANNNN  est-1.fa
78577  ATCTTNTTNNNNNNNNNNTATTGAGTTGTCTTTGNNNNTATTTNNNNNNNNNTGTAAATCACAGAGATAAACACCACANA  fei-0.fa
78577  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGATANNNNNNNNNNN  got-7.fa
78577  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAATCACAGAGATAAANACCANNNN  ler-1.fa
78577  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGAGATANNNNNNNNNNN  lov-5.fa
78577  NNNNNNNNNNNNNNNNNNNNNNGAGTNNNNNNNGNCNNNNNNNNNNNNNNNNTGTAAATCACAGAGATAAACACCACANN  nfa-8.fa
78577  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAATCACAGAGATAAACACCANNNN  rrs-10.fa
78577  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAATCACAGAGATAAACACCANNNN  rrs-7.fa
78577  NTNNTNTNNNNNNNNNNNNNNNGNNNNNNNNNTGACANNNNNNNNNNNNNNNNNNNNNNCACAGAGATAAACACNNNNNN  sha.fa
78577  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGATAANNNNNNNNNN  tamm-2.fa
78577  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAATCACAGAGATAAACACCANNNN  ts-1.fa
78577  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGAGATAAACACNNNNNN  tsu-1.fa
78577  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAATCACAGAGATAAACACNNNNNN  van-0.fa
 
78657  AATCAATAAATAACTGTAATCTTTACCTTGAAGATTTTATTCATATGAAATATCTTATAGAAAATACTTCGTTAGCTTGA  chr1.fa
78657  AATCAANAAATAACTGTAATCTTTRCCTTGAAGATTTTATTCNNNNNNNNNNNCTTATAGAAAATACTTCGTTARCTTGA  bay-0.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNARCTTGA  bor-4.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCGTTARCTTGA  br-0.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNTTGAAGATTTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNARCTTGA  bur-0.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNTGAAGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTNRCTTGA  c24.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGNTARCTTGA  col-0.fa
78657  NNNNNNNNNNNNNNNNNNNNCNNNRCCNTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTTCGTTARCTTGA  cvi-0.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTANTTCGNTARCTTGA  est-1.fa
78657  AATCNNNNNNNNNNNNNNNTCNTTRNNNTGAAGATTNNNNNNNNNNNNNNNNNNNNNNNNNAAATACTTCGTTARCTTGA  fei-0.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  got-7.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGNNARCTTGA  ler-1.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  lov-5.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTCGTNARCTTGA  nfa-8.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNARNNNGA  rrs-10.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCGNNARCTTGA  rrs-7.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNGA  sha.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  tamm-2.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNRNNTGA  ts-1.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRCNNGN  tsu-1.fa
78657  NNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGTTARCTTGA  van-0.fa
 
78737  AAATGCATATTTAGTTTAAATACAAATAAACGAAACAAAAAGCAAAAAGCATAGACGGATCCGTAAATCTACTCTTAAGA  chr1.fa
78737  AAATGCATATTTAGTTTNAATACANNNNNNCGAAACNNNNNNNNAAAANCATAGACGGATCCGTAAATCTACTCTTAAGA  bay-0.fa
78737  AAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAAAGCATAGACGGATCCGTAAATCNACTCTTAAGA  bor-4.fa
78737  AAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGCATAGACGGNNNNNNNNTNNNNNNNNNNAGA  br-0.fa
78737  AAATGCATANNNNNNNNNNNNNCAAANANNNNNNNNNNNNNNNNAAAAGCATAGACGGNTCCGTAATNNNNNNCNTAAGA  bur-0.fa
78737  AAATGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGCATAGACGGATCCGTAAATCTACTCTTAAGA  c24.fa
78737  ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANANNNNNNNAAAAGCATAGACGGATCCGTAAATCTACTCTTAAGA  col-0.fa
78737  AAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNANCAAAAAGCATAGACGGATCCGTNNTNNNNNNNTTAAGA  cvi-0.fa
78737  ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGCATAGACGGATCCGTAAATCTNCTCTTAAGA  est-1.fa
78737  AAATGCNNNNNNNNNNNNNNNNNNNNNNNNCGANNNNNNNNNCAAAAAGCATAGACGGATCCGTNNTNNNNNNNNTAAGA  fei-0.fa
78737  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGANNNNNNNNNNNNNNNNNNNNNNAGA  got-7.fa
78737  AAANNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAANNNNNNNNNNAANGCATAGACGGATCCGTAAATCTNCTCTTAAGA  ler-1.fa
78737  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGCATAGNNNNNNNNNNNNNNNNNNNNNNNAGA  lov-5.fa
78737  AAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAANAANCAAAAAGCATAGACGGNNNNNNNNTNNNNNNNNNAAGA  nfa-8.fa
78737  ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGCATAGACGGATCCGTAAATCNACTCTTAAGA  rrs-10.fa
78737  AANNNNNNNNNNNNNNNNNNNNNNNNNNNNCGNNNNNNNNNNNNAAAAGCATAGACGGATCCGTAAATCTNCTCTTAAGA  rrs-7.fa
78737  AAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGCATNNNNNGATCCGTAAATCTACTCTTAAGA  sha.fa
78737  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGNATCCGTAAATCTACTCTTAAGA  tamm-2.fa
78737  AAANNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNAAAGCATAGANNNNNNNNNNNTNNNNNNNNNNAGA  ts-1.fa
78737  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAANNNNNGNNNNNNNNNNNNNNNNNNNNNNNNGA  tsu-1.fa
78737  AAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANCAAAAAGCATAGACGGNNNNNNNNTNNNNNNNNTAAGA  van-0.fa
 
78817  AGCCATGCAAGAAAGATTCAAAGTCATCACAAAAACCAAGCTTTTGTAATTTGCGCAAGTAATTAACAAAAAAAAATGTA  chr1.fa
78817  AGCCATGCAAGAAAGATTCAAAGTCANCACAAAAACCAAGCTTTTGTAATTTGCGCAAGTAATTAACAAAAAAANNNRNN  bay-0.fa
78817  AGCCATGCAAGAAAGATTCAAAGTCANCACAAAAACCNNNNNTTTGTAATTTGCGCAANNNNNNNNNNNNAAANNNNRNN  bor-4.fa
78817  AGCCATGCAAGAAAGATTCAAAGNNNNCACAAAAACCNNNNNNTTGTAATTTGCGCAAGNNNNNNNNAANNNNNNNNRNN  br-0.fa
78817  AGCCATGCAAGAAAGATTCAAAGTCATCACAAAAACCAAGCTTTTGTAATTTGCGCAAGTAATTAACAAAAAAAANNRNN  bur-0.fa
78817  AGCCATGCAAGAAAGATTCAAAGTCANCACAAAAACCAAGCTTTTGTAATTTGCGCAAGTAATNAACAAAAAAANNNRNN  c24.fa
78817  AGCCATGCAAGAAAGATTCAAAGTCANCACAAAAACCNAGCTTTTGTAATTTGCGCAAGTNNNNNNNAAAAAAANNNRNN  col-0.fa
78817  AGCCATGCAAGAAAGATTCAAAGTCATCACAAAAACCAAGCTTTTGTAATTTGCGCAAGTNNNNNNNAAAAAANNNNRNN  cvi-0.fa
78817  AGCCATGCAAGAAAGATTCAAAGNNNNCACAAAAACCANGCTTTTGTAATTTGCGCAAGNNNNNNNNNNNNNNNNNNRNN  est-1.fa
78817  AGCCATGCAAGAAAGATTCAAAGTCATCACAAAAACCAAGCTTTTGTAATTTGCGCAAGTAATTAANAAAAAAANNNRNN  fei-0.fa
78817  AGCCATGCAAGAAANATTCANNNNNNNNNCAAAAACNNNNNNNTTGTAATTNNNNNNNNNNNNNNNNAAAAAAANNNRNN  got-7.fa
78817  AGCCATGCAAGAAAGATTCAAAGTCANCACAAAAANNNNNNNNTTGTAATTTGCGCAANNNNNNNNNNAAAAAANNNRNN  ler-1.fa
78817  AGCCATGCANGANANNNNNAAAGTCANCACAAAANNNNNNNNNNTGTAATNTNNNNNNNNNNNNNNNNNAAANNNNNRNN  lov-5.fa
78817  AGCCATGCAAGAAAGATTCAAAGTCATCACAAAAACCAAGCTTTTGTAATTTGCGCAAGTNNNNNNNAAAAAAANNNRNN  nfa-8.fa
78817  AGCCATGCAAGAAAGATTCAAAGTCATCACAAAAACCAAGNTTTTGTAATTTGCGCAANNNNNNNNNNNNANNNNNNRNN  rrs-10.fa
78817  AGCCATGCAAGAAAGATTCAAAGTCANCACAAAAACNNNNNNTTTGTAATTTGCGCAAGTAATNNNNAAAAAANNNNRNN  rrs-7.fa
78817  AGCCATGCAAGAAAGATTCAAAGTCANCACAAAAACCAAGCTTTTGTAATTTGCGCAAGTNNNNNNNAAAAAANNNNRNN  sha.fa
78817  AGCCATGCAAGAAAGATTCAANGNNANCACAAAAACCANGCTTTTGTAATTTGCGCAANNNNNNNNNAAAAAAANNNRNN  tamm-2.fa
78817  AGCCATGCAAGAAAGANTCAAAGNNNNCACAAAAACCNNNNNNTTGTAATTTGCGCAANNNNNNNNNAAAAAAANNNRNN  ts-1.fa
78817  AGCCANGCAAGAAANNNNNNNNNNNNNCACAAAAANNNNNNNNTTGTAATTNNNNNNNNNNNNNNNNNNNNNNNNNNRNN  tsu-1.fa
78817  AGCCATGCAAGAAAGATTCAAAGTCNNCACAAAAACCAAGCTTTTGTAATTTGCGCAANNNNNNNNNAAAAANNNNNRNN  van-0.fa
 
78897  ACAATAAATGGTGATCAGAGGCAATAACATGTTGGGGGGGATGAAGCCTGGTCCGAGGATACTCTCTATGATCACTTGAA  chr1.fa
78897  NNAANAAATGGTGATCAGAGGCAATAACATGNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGATCACTTGAA  bay-0.fa
78897  NNNNNNAATGGTGATCAGAGGCAATANNNNNNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTNTGNNNNNNNNNN  bor-4.fa
78897  NNNNNNAATGGTGATCAGAGGCAATAACNTGNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGATCACTTGAA  br-0.fa
78897  NCAATAAATGGTGATCAGAGGCAATAACATGTTNRNRRRRRRRRRRNRRRGTCCGAGGATACTCTCTATGATNNNNNNTN  bur-0.fa
78897  NNNNNAAATGGTGATCAGAGGCAATAACATGNTNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGNNNNNNNNTN  c24.fa
78897  NNNNNNNNTGGTGATCAGAGGCAATAACATGNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGATCACTTGAA  col-0.fa
78897  NNNNNNAATGGTGATCAGAGGCAATAACATGTNGRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATNNNNNNNNNNN  cvi-0.fa
78897  NNNNNNNNTGGTGATCAGAGGCAATAANNNNNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGATNNNNNNNA  est-1.fa
78897  NNNANAAATGGTGATCAGAGGCAATAACATGNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGATCACTTGAA  fei-0.fa
78897  NNNNNNNNNNNTGATCAGAGGCAATAACANNNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCNNNNNNNNNNNNNNNN  got-7.fa
78897  NNNNNNNNNNGTGATCAGAGGCAATAACATGNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGANNNNNNNNA  ler-1.fa
78897  NNNNNNNNNNGTGATCAGAGGCAANANNNNNNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCNNNNNNNNNNNNNNNN  lov-5.fa
78897  NNNNNNNATGGTGATCAGAGGCAATAACATGTNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATNNNNNNNNNTN  nfa-8.fa
78897  NNNNNNNNNGGTGATCAGAGGCAATAACATGNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGATCACTTGAN  rrs-10.fa
78897  NNNNNNAATGGTGATCAGAGGCAATAACATGNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGATCNCTTGAA  rrs-7.fa
78897  NNNNNNAATGGTGATCAGAGGCAATAACATGNNGRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATNNNNNNNNNTN  sha.fa
78897  NNNNNNNATGGTGATCAGAGGCAATAACATGNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTANNNNNNNNNNNN  tamm-2.fa
78897  NNNNNNAATGGTGATCAGAGGCAATAACATNNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTANNNNNNNNNNNN  ts-1.fa
78897  NNNNNNNNNNGTGATCAGAGGCAATANNNNNNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTNNNNNNNNNNNNN  tsu-1.fa
78897  NNNNNNAATGGTGATCAGAGGCAATAACATGNTNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATNNNNNNNNNNN  van-0.fa
 
78977  TCATTAACATACACATGTATATATCTATAATATCCTCGATCCAGACAACATTCCCCTCAACTGAAATAGCTTAACCCTCA  chr1.fa
78977  TCATTAACATACACATGNATATATCTATAATATNCTCGANCRRRNNAACATTCNNNRCAACTGAAATAGCTTAACCCTCA  bay-0.fa
78977  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTCGANCRRRACAACATTCNNNRNNNNNNNNNTAGCTTANNNNNNN  bor-4.fa
78977  TCATTAACNNNNNNNNNNNNNNNNNNNNNNNATCCTCGANCRRRACAACATTCNNNRCANCTGAAATAGCTTAACCCTCA  br-0.fa
78977  TCATTAACATACACANNNNNNNATCTATAATATCCTCGANCRRRACAACATTCNNNRCAACTGAAATAGCTTAACCCTCA  bur-0.fa
78977  NNNNNNNNNNNNNNNNNNNNNNNNNNNTAATATCCTCGANCRRRACAACATTCNNCRCAACTGAAATAGCTTAACCCTCA  c24.fa
78977  TCATTAACATNNNNNNNNNNNNNNNNNNNNNATCCTCGANCRRRACAACATTCNNNRCNNCTGAAATAGCTTAACCCTCA  col-0.fa
78977  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATCCTCGANCRRRACAACATTCNNCRCAACTGAAATAGCTTAACCCTCA  cvi-0.fa
78977  TCATTAACANNNNNNNNNNNNNNNNNNNNNNATCCTCGANCRRRACAACATTCNCNRCNACTGAAATAGCTTAACCCTCA  est-1.fa
78977  TCATTAACATNNNNNNNNNNNNNNNNNNNATATCCTCGANCRRRACAACATTCCNCRCAACTGAAATAGCTTAACCCTCA  fei-0.fa
78977  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCCTCGANCRRRACAACATTCNNNRCNNCNNNNATAGCTTAANNNNNN  got-7.fa
78977  TCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTCGANCRRRACAACATTCNNNRNAACTGAAATAGCTTAACCCTCA  ler-1.fa
78977  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCGANCRRRACAACATTCNNNRNNNCNNNNNNNNNNTAACCCNCA  lov-5.fa
78977  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCCTCGANCRRRACAACATTCNNNRCAACTGAAATAGCTTAACCCTCA  nfa-8.fa
78977  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCCTCGANCRRRACAACATTCNNNRNNNNNNNNATAGCTTAACCCTCA  rrs-10.fa
78977  TCATTAANNNNNNNNNNNNNNNNNNNNNNNNNTCCTCGANCRRRACAACATTCNNNRNAACTGAAATAGCTTAACCCTCA  rrs-7.fa
78977  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCCTCGANCRRRACAACATTCNNNRCANCTGAAATAGCTTAACCCTCA  sha.fa
78977  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCTCGANCRRRACAACATTCNNNRCNACTGAAATAGCTTAACCCTCA  tamm-2.fa
78977  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCCTCGANCRRRACAACATTCNCNRCNNCTGAAATAGCTTAACCCTCA  ts-1.fa
78977  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGANCRRRACNACATTCNNNRNNNNNNNNNNNNNNTNACCCTCA  tsu-1.fa
78977  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCCTCGANCRRRACAACATTCNNNRCNACTGAAATAGCTTAACCCTCA  van-0.fa
 
79057  TGATAATCGATCTTAGCAGATTCACAAATTTTTGTTGTAGAGAGTGATAGAGGAGAGAGAGAGAGAGGTTGGTGAATGGT  chr1.fa
79057  TGATAATCGATCTTAGCAGATTCACAAATTTTTGTTGTAGAGAGTGANNNNNNNNNRNNNNNNNNNNNNNGGTGANNNNN  bay-0.fa
79057  NNATAATCGATCTTAGCAGATTCNCAAATTTTTGTTGNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGT  bor-4.fa
79057  TGATAATCGATCTTAGNNNNNTCACAAATTTTTGTTGTAGAGAGNNNNNNNNNNNNRNNNNNNNNNNNTTGGTGAATGNN  br-0.fa
79057  TGATAATCGATCTTAGCAGATTCACAAATTTTTGTTGTAGAGAGTGANNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGN  bur-0.fa
79057  TGATAATCGATCTTAGCAGATTCACAAATTTTTGTTGTNGAGAGTGNNNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGN  c24.fa
79057  TGATAATCGATCTTAGCAGATTCACAAATTTTTGTTGTNGANNNNNNNNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGT  col-0.fa
79057  TGATAATCGATCTTAGCAGATTCACAAATTTTTGTTGTAGAGAGTGNNNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGT  cvi-0.fa
79057  TGATAATCGATCTTAGCAGNTTCACAAATTTTTGTTGTNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGT  est-1.fa
79057  TGATAATCGATCTTAGCAGATTCACAAATTTTTGTTGTAGAGAGTNNNNNNNNNNNRNNNNNNNNNNNTTGGTGAATGGT  fei-0.fa
79057  NGNTAATCGATCTTANNNNNNNNACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNTTGGTGAATGGT  got-7.fa
79057  TGATAATCGATCTTAGCAGATTCACAAATTTTTGTTGNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNTGGTGANTGNT  ler-1.fa
79057  TGATAATCNNNNNNNNNNNNNNNNCAAATTTTTGNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNTGNN  lov-5.fa
79057  TGATAATCGATCTNAGCAGATTCACAAATTTTTGTTGTNGANANNNNNNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGT  nfa-8.fa
79057  TGATAATCGATCTTAGCAGATTCNCAAATTTTTGTTGTNGAGAGNNNNNNNNNNNNRNNNNNNNNNNGTTGGTGAATGGT  rrs-10.fa
79057  TGATAATCGATCTTAGCAGATTCACAAATTTTTGTTGNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNGGTGAATGGT  rrs-7.fa
79057  TGATAATCGATCTTAGCAGATTCACAAATTTTTGTTGTNGANANNNNNNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGT  sha.fa
79057  TGATAATCGATCTTAGCAGATTCACAAATTTTTGTTGTNGAGANNNNNNNNNNNNNRNNNNNNNNNNNTTGGTGAATGGT  tamm-2.fa
79057  TGATAATCGATCTTAGCAGATTCACAAANTTTTGTTGTNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNTGGTGANTGNT  ts-1.fa
79057  TGATAATNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNGANNNNT  tsu-1.fa
79057  TGATAATCGATCTTAGCAGATTCACAAATTTTTGTTGTAGAGAGTGNNNNNNNNNNRNNNNNNNNNNGTTGGTGAATGGT  van-0.fa
 
79137  GATGATGGTGTTATGATGAGGGAATGATGAGTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCG  chr1.fa
79137  NANGNRRRRRRRRRRRRRRNGNAATGATGAGTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCG  bay-0.fa
79137  GNNGNRRRRRRRRRRRRRRNNNAATGATGAGTGGCGGAGACGAAGATGGGCTTTTAATNNNNNNCAACAGAAACAGGTCG  bor-4.fa
79137  NNNGNRRRRRRRRRRRRRRNGGAATGATGAGTGGCGGAGACGAAGATGGGCTTTTAATAAGANACAACAGAAACAGGTCG  br-0.fa
79137  GANGNRRRRRRRRRRRRRRGGGAATGATGAGTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCG  bur-0.fa
79137  GANGNRRRRRRRRRRRRRRGGGAATGATGAGTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCG  c24.fa
79137  GNTGNRRRRRRRRRRRRRRGGGAATGATGAGTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCG  col-0.fa
79137  GANGN