Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 77727 - 79340


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
77727  CTGCCATATTGATCCCATTTCATTTATTTTTGTCCCCGTTTCCGTTACAAAGATTTCCTTTTATTTGTTTCCATTCAATA  chr1.fa
77727  CTGCCATATTGATCCCATTTCANNNNNNTTTGTCNCCGTTTCCGTTACAAAGATTRCNRTTNNTTTGTTTCCATTCAATN  bay-0.fa
77727  CTGCCATATTGATNNNNNNNNNNNNNNNTTTGTCCCCGTTTCCGTTACNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
77727  CTGCCATATTGATCNNNNNNNNNNNNNNNTTGTCCCCGTTTCCGTTACAANGNNNRNNRNNNNNNNNNNNNNNNNNNNNN  br-0.fa
77727  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAAAGATNRNNRNNNNTTTGTTTCCATTCAATA  bur-0.fa
77727  CTGCCATATTGATCCCATTTCNNNNNTTTTTGTCCCCGTTTCCGTTACAAAGATTRNNRNNNNTTTGTTTCCATTCAATA  c24.fa
77727  CTGCCATATTGNTNNNNNNNNNNNNNNNTTTGTCNCCGTTTCCGTTACAAAGNNNRNNRNNNNNNNNNNNNNNNNCANNN  col-0.fa
77727  CTGCCATATTGATCCCATTTCNNNNNNNNNNNNNNNANNNNNNGTTACAAAGNTNRNNRNNNNNNNNNNNNCATTCAATN  cvi-0.fa
77727  CTGCCATATTGATNNNNNNNNNNNNNNNNNNGTCCCCGTTTCCGTTACAAANNNNRNNRNNNNNNNNNNNNNNNNNNNNN  est-1.fa
77727  CTGCCATATTGATCCCATTTCATTTNTTTTTGTCCCCGTTTCCGTTACAAAGATTRNNRNNNNNNNNTTTCCATTCAATA  fei-0.fa
77727  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNN  got-7.fa
77727  CTGCCATATTGATCCNNNNNNNNNNNNNTTTGTCCCCGTTTCCGTTACAAANNNNRNNRNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
77727  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
77727  CTGCCATATTGATCCCATTTNNNNNNTTTTTGTCCCCGTTTCCGTTACAAAGNTNRNNRNNNNNNNNNNTCCATTCAATA  nfa-8.fa
77727  CTGCCATATTGATNNNNNNNNNNNNNNNNTTGTCCCCGTTTCCGTTACNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
77727  CTGCCATATTGATCNNNNNNNNNNNNNNNTTGTCCCCGTTTCCGTTACAAAGNNNRNNRNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
77727  CTGCCATATTGATCCCATTTCNNNNNTTTTTGTCCCCGTTTCCGTTACAAAGNTNRNNRNNNNNNNNTTTCCATTCAATA  sha.fa
77727  CTGCCATATTGANCNNNNNNNNNNNNNNNTNGTCCCCGTTTCCGTTACAAANNNNRNNRNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
77727  CTGCCATATTGATCNNNNNNNNNNNNTTTTTGTCCCCGTTTCCGTTACAAAGNNNRNNRNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
77727  CTGCCATATTGATNNNNNNNNNNNNNNNNNNGTCCCCGTTTCCGNTNNNNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
77727  CTGCCATATTGATCNNNNNNNNNNNNNNNTTGTCCCCGTTTCCGTTACAAAGNNNRNNRNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
77807  TTGTTTGTGTCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGAGACCTAATCGATCGAAATTCCCTCAATTTG  chr1.fa
77807  TTGTTTGTGNCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGRRRRRRRRTCNATCGAAATTCCCTCAATTTG  bay-0.fa
77807  NNNNNNNNNNCTTTGTGATACATAGTGAGNCGTGTTTATAACCCCANANRRRRRRRRTCNATCGAAATTCCCTCAATTTG  bor-4.fa
77807  NNNNNNNNNNNTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGRRRRRRRRTCGATCGAAATTCCCTCAATTTG  br-0.fa
77807  TTGTTTGTGNCTTTGTGATACATAGTGAGACGTGTTTATAANNNNNNNNRRRRRRRRTCGATCGAAANNNNNNNNNNNNN  bur-0.fa
77807  TTGTTTGTGNCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGRRRRRRRRTCGATCGAAATTCCCTCAATTTG  c24.fa
77807  NNNNNTNNNNCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGNGRRRRRRRRTCGATCGAAATTCCCTCAATTTG  col-0.fa
77807  TTGTTTGTGTCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGRRRRRRRRTCGATCGAAATTCNNNNNCNNNN  cvi-0.fa
77807  NNNNNNNNNNNNTTGTGATACATAGTGAGACGTGTTTATAACCCCANNGRRRRRRRRTCGATCGAAATTCCCTCAATTTG  est-1.fa
77807  TTGTTTGTGTCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGRRRRRRRRTCGATCGAAATTCCCTCAATTTG  fei-0.fa
77807  NNNNNNNNNNNNNNNNNATACATAGTGAGACGTGTTTATAACCCCANANRRRRRRRRTCGATCGAAANNNNNNNNNNNNN  got-7.fa
77807  NNNNNNNNNNNTTTGTGATACATAGTGAGACGTGTTTATAACCCCANNGRRRRRRRRTCGATCGAAATTCCCTCAATTTG  ler-1.fa
77807  NNNNNNNNNNNNNNNNNNNNCATAGTGAGACGTGTTTATAACCCCANAGRRRRRRRRNCGATCGANNNNNNNNNNNNNNN  lov-5.fa
77807  TTGTTTGTGTCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGRRRRRRRRTCGATCGAAATTCCCTCAATTTG  nfa-8.fa
77807  NNNNNNGTGTCTTTGTGATACATAGTGAGACGTGTTTATAACCCCANAGRRRRRRRRTCGATCGAAATTCCCTCAATTTG  rrs-10.fa
77807  NNNNNNNNGTCTNTGTGATACATAGTGAGACGTGTTTATAACCCCAGNNRRRRRRRRTCGATCGAAATTCCCTCAATTTG  rrs-7.fa
77807  TTGTTTGTGTCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGRRRRRRRRTCGATCGAAATTCCCTCAATTTG  sha.fa
77807  NNNNNNNNNNCTTTGTGATACATAGTGAGACGTGTTTATAACCCCAGAGRRRRRRRRTCGATCGAAATTCCCTCAATNNN  tamm-2.fa
77807  NTGTTTNNNTCTTTGTGATACATAGTGAGACGTGTTTATAACCCCANNGRRRRRRRRNCGATCGAAATTNNNNNNNNNNN  ts-1.fa
77807  NNNNNNNNNNNNNNNNNNNNNATAGTGAGNCGTGTTTATAACCCCANANRRRRRRRRNCGNTCGAAATTCNNNNNNNNNN  tsu-1.fa
77807  NNNNNNNNNNNNNTGTGATACATAGTGAGACGTGTTTATAACCCCANAGRRRRRRRRTCGATCGAAATTCCCTCAATTTG  van-0.fa
 
77887  AAGATCGTTAGTTTGTTATCTCTTTCTCTTCTAATTCTTTTTTTACTTAGATGATCTTGATTTCCACTCTTCAAATCAAG  chr1.fa
77887  AAGATCGTTAGTTTGTTATCTCTNNNNNNNCNANNTNTTTTTTTANTTRGNTGATCTTGATTTCCACTCTTCARRTCAAG  bay-0.fa
77887  AAGATCNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNGNTTTCCACTCTNNNRRNNNNN  bor-4.fa
77887  AAGATCGTTNGTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNTGATTTCCACTCTTCNRRTNNAG  br-0.fa
77887  NNNNNNNNNNNNNTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNGATTTCCACTCTTCARRTNNNN  bur-0.fa
77887  AAGATCGTTAGTTTGTTNTNNNNNNNNNNNNNNNNNNNNTTTTTNNNNRNNNGATCTTGATTTCCACTCTTCARRTCAAG  c24.fa
77887  AAGATCGTTNGNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNTTGATTTCCACTCTTNNRRNNNAG  col-0.fa
77887  NNNNTCGTTAGTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNCTTGATTTCCACTCTTCARRTCNAG  cvi-0.fa
77887  AAGATCGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNGATTTCCACTCTNNNRRNNNAG  est-1.fa
77887  AAGATCGTTAGTTTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNGATCTTGATTTCCACTCTTCARRTCNAG  fei-0.fa
77887  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNN  got-7.fa
77887  AAGATCGTTNGTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNTTGATTTCCACTCTNNNRRNNNNN  ler-1.fa
77887  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNCCACTCNNNNRRNNNNN  lov-5.fa
77887  AAGATCGTTAGTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNTTTNNNNRNNNNNTCTTGATTTCCACTCTTCARRNNNAG  nfa-8.fa
77887  AAGATCGTTAGTTTNNNNNNNNNNNNNNNNNNNNNNNTTTTNNNNNNNRNNNNNNNNTGATTTCCACTCTTNNRRNNNNN  rrs-10.fa
77887  AAGATCGTTAGTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNTGATTTCCACTCTTCARRNNNNN  rrs-7.fa
77887  AAGATCGTTAGTTTGTNNNNNNNNNNNNNNNNNNNNNNTTTTTTNNNNRNNNNNTCTTGATTTCCACTCTTCARRNNNNN  sha.fa
77887  NAGATCGTTNGNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNTGATTTCCACTCTNNNRRNNNNN  tamm-2.fa
77887  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNTGATTTCCACTCTTCNRRNNNAG  ts-1.fa
77887  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNATTTCCACNNNNNNRRNNNNN  tsu-1.fa
77887  AAGATCGTTNGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNTCTTGATTTCCACTCTTNNRRTNNAG  van-0.fa
 
77967  TAATCTAGTCGAGTGTTTGTGTGTGTGTTCGATTTCTGAAGAAAAACAACAAAATTGAATTCGTTGTTTGGGGGGATAAC  chr1.fa
77967  TAATCTAGTCGAGTNNNNNNNNNNNNNNNCGANTTRTGAAGNNNNNNNNCAAAATTGAATTCGTTGTTTGGGGGGATAAC  bay-0.fa
77967  NNATCTAGTCGAGTGTTNNNNNNNNNNTTCGATNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTGGGGGGATAAC  bor-4.fa
77967  TAATCTAGTCGAGTGTTNNNNNNNNNNTTCGANTTRTNNANNNNNNNNNNNNAATNNNNNNNGTTGTTTGGGGGGATAAC  br-0.fa
77967  NNNNGNNNNNNNNNNNNNNNNNNNNNNNTCGATTTRTGAAGAAAAACAACAAAATTGAATTCNNNNNNNNNNNNNNNNNN  bur-0.fa
77967  TAATCTAGTCNNNNNNNNNNNNNNNNNNTCGATTTRTGAAGAAAAANNNNAAAATTNNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
77967  TAATCTAGTCGAGTGTNNNNNNNNNNNNNCGNNNNRNNNNNNNNNNNNNNNANNNNNNNNNNGTTGTTTGGGGGGATAAC  col-0.fa
77967  TAATCTAGTCGNNNNNNNNNNNNNNNNNNNGANNNRNGANNNNNNNNNNNAANANNNNNNNNNNNNNNNNNNNNNNNNNC  cvi-0.fa
77967  TAATCTAGTCGAGTGTTTNNNNNNNNNNTCGANNNRNNANNNNNNNNNNNNNNANNNNNNNNNNNGTTTGGGGNNNNNAC  est-1.fa
77967  TAATCTAGTCGAGTGTNNNNNNNNNTGTTCGATTNRTGAAGAAAAANNNNAAAATNGAATTCGTNGTTTGGGGGGATAAC  fei-0.fa
77967  NNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGATNTRNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
77967  NNNTCTAGTCGAGTGTNNNNNNNNNNNNNCGANNNRNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGTTTGGGGGGATAAC  ler-1.fa
77967  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
77967  TAATCTAGTNNNNNNNNNNNNNNNNNNNTCGATTTRTGANNNNNNANNNNAANATNGAATTCGTTGTTTGGGGGGATAAC  nfa-8.fa
77967  NAATCTAGTCGAGTGTTNNNNNNNNNGTTCGANNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTTTGGGGGGATAAC  rrs-10.fa
77967  NNATCTAGTCGAGTGNNNNNNNNNNNNTTCGATTNRNNANNNNNNNNNNNNNNNNNNNNNNNNNTGTTTGGGGGGATAAC  rrs-7.fa
77967  NNNNGNNNNNNNNNNNNNNNNNNNNNNNTCGATTTRTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
77967  NNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGATTNRNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
77967  TAATCTAGNNNNNNNNNNNNNNNNNNNNTCGANNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
77967  NNNNNNNNTCGAGTGNNNNNNNNNNNNNNCGANNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGGGGATAAC  tsu-1.fa
77967  TAATCTAGTCNNNNNNNNNNNNNNNNGTTCGANNNRTGNNNNNNNNNNNNNNAATTGAATNNGTTGTTTGGGGGGATAAC  van-0.fa
 
78047  GATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTTCAAAAGGTATCTTTCTTTCTTTATTTGTTTCAGTTGTAAATTA  chr1.fa
78047  GATGATCAGAAAGCNAAAAGGGAAGGCTCTCTGATTRCRAAAGGTATCTTTNNNNNNNNNNNTGTTTCAGTTGTAAATTA  bay-0.fa
78047  GANGATCAGAANNNNNAAAGGGAAGGCTCTCTGNNNRNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
78047  GATGATCAGAAAGCNAAAAGGGAAGGCTCTCTGATTRCRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
78047  NATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRCRAAAGGTATCNNNNNNNNNNNNNNTGTTTCAGTTGTAAATTA  bur-0.fa
78047  GATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRCRAAAGGNNNNNNNNNNNNNNNNNNNNTTTCAGTTGTAAATTA  c24.fa
78047  GATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNAANNNN  col-0.fa
78047  GATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRCRAAAGGNNNNNNNNNNNNNNNNNNNNNNNNAGTTGTAAATTA  cvi-0.fa
78047  GATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
78047  GATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRCRAAAGGNNNNNNNNNNNNNNNNNNNNNNTCAGTTGTAAATTA  fei-0.fa
78047  NNNNNNNNNNAAGCTAAAAGGGAAGGCTCTCTGNTNRNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
78047  GATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGNNNRNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAATNN  ler-1.fa
78047  NNNNNNNNNAAAGCNAAAAGGGAAGGCTCTCTGNNNRNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
78047  GATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRCRANNGGTNNNNNNNNNNNNNNNNNNGNNNNNGTTGTAAATTA  nfa-8.fa
78047  GATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
78047  GATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
78047  GATGATCAGAAAGCTAAAAGGGAAGGCTCTCTGNTTRCRAAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
78047  NNNNATCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
78047  NNNNNNCAGAAAGCTAAAAGGGAAGGCTCTCTGATTRCRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGTAANNNN  ts-1.fa
78047  GATGATCAGAAAGCNAAAAGGGAAGGCTCTCTGNNNRNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
78047  GATGATCAGAANGCTAAAAGGGAAGGCTCTCTGATTRCRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
78127  CTTCCAAAAGATTCCGAATCTAGTTTCTCTCTTCCTTATGTAGTAGATTTGCCATCATATCTTCTCCGGCTTTTCGCCGT  chr1.fa
78127  CTTCCAAAAGATTCCGAATCTAGTTTCTCTCTTCCTTATGTARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGNCGT  bay-0.fa
78127  NNNNNAAAAGATTCCGAATCNNNNNNNNNNNNNNNNNNTNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGCCGT  bor-4.fa
78127  NTTCCAAAAGATTCCGAATCTAGTTTNNNNNTNNCNTATNTNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGNCGT  br-0.fa
78127  CTTCCAAAAGATTCCGAATCTAGTTTCTCTCTTCCTTATGTARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGNCGT  bur-0.fa
78127  CTTCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGCCGT  c24.fa
78127  NTTCCAAAAGATTCCGAATCNAGTTNNNNNNNNNNNNNNNTARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGCCGT  col-0.fa
78127  CTTCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGCCGT  cvi-0.fa
78127  NTTCCAAAAGATTCCGAATCTAGTTNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGCCGT  est-1.fa
78127  CTTCCAAAAGATTCCGAATCTAGTTTCTCTCTTCCTTATGTARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGNCGT  fei-0.fa
78127  NNNNNNNNAGATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGCCGT  got-7.fa
78127  NNNNNAAAAGATTCNNNNNNNNNNNNNNNNNNNNNNNNNNTNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGCCGT  ler-1.fa
78127  NNNNCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGCCGT  lov-5.fa
78127  CTTCCAAAAGATTCCGAATCTAGTTTCTCTCTTCCTTATGTARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGCCGT  nfa-8.fa
78127  NTTCCAAAAGATTCCGAATCTAGTTTCTNNNNNNNNNNNNTNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGCCGT  rrs-10.fa
78127  NTTCCAAAAGATTCCGANNNNNNNNNNNNNNNNNNNNNNNTNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGCCGT  rrs-7.fa
78127  NNNNCAAAAGATTCCGAATCTAGTTTCTCTCTTCCTTATGTARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGNCGT  sha.fa
78127  NNNNNAAAAGATTCCGAATCTAGTTTCTNNNNNNNNNNTNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGCCGT  tamm-2.fa
78127  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGCCGT  ts-1.fa
78127  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCGT  tsu-1.fa
78127  NNNCCAAAAGATTCCGAATCTAGTTTCTCTNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCGCCGT  van-0.fa
 
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAATAAAGCCCATAACGATAATTATCTTACATTCCGCA  chr1.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAGCCCANAANGANAATTATCTTACATTCCGCA  bay-0.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAGCCCANNNNNNNNNNNNNNTTACATTCCGCA  bor-4.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAGCCCANAANNNNNNNNNNCTTACATTCCGCA  br-0.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAGCNNNNNNNNNNNNNNNNNNNNNATTCCGCA  bur-0.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAGCCCATAACGATANNNNTCTTACATTCCGCA  c24.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAGCCCANAANNNNNNNNNNNTTACATTCCGCA  col-0.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAATAAAGCNNNNNNNNNNNNNNNNNNNNNNTTCCGCA  cvi-0.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAGCCCANNNNNNNNNNNNNNTTACATTCCGCA  est-1.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAGCCCATAACGATANTTATCTTACATTCCGCA  fei-0.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCA  got-7.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAGCCCATAANNNNNNNNNNNNTACATTCCGCA  ler-1.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCA  lov-5.fa
78207  TGTCGTGAACACAATTACATTCCGCTNTCACCGCCACAACAAGAANAAAGCCCATAACGATNNNNNTCTTACATTCCGCA  nfa-8.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAGCCCATANNNNNNNNNNTCTTACATTCCGCA  rrs-10.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAGCCCATAANNNNNNNNNNNNTACATTCCGCA  rrs-7.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAGNNNNNNNNNNNNNNNNNNNNNNNTTCCGCA  sha.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAGCNNNNNNNNNNNNNNNNNNNNNNNNCCGCA  tamm-2.fa
78207  TGTCGTGAACACAATTACATTCCGCTCTCACCGCCACAACAAGAANAAAGNNNNNNNNNNNNNNNNNNNNNNNNTCCGCA  ts-1.fa
78207  TGTCGTGAACACAATTACATNCNNNNNNNNNNNCCACAACAAGAANANNNNNNNNNNNNNNNNNNNNNNTACATTCCGCA  tsu-1.fa
78207  TGTCGTGAACACAATTACATTCCGCTNTCACCGCCACAACAAGAANAAAGCCCANAANNNNNNNNNNCTTACATTCCGCA  van-0.fa
 
78287  TACAACACAATTATACAATCTATTGGCCACGTCATTTTCTATCCTATATTTTCAGTTATTCTTTTTTTAATATTTTTTAG  chr1.fa
78287  TACAACACAATTATACAARCTATTGGCCACGTCATTTTCTATCCTRRRRRTTCNNNNRNNNTTNTTTNNNNNTTTTTTAG  bay-0.fa
78287  TACAACANNNNNNNNNNARCTATTGGCCACGTCATTTNNNNNNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
78287  TACAACANNNNNNNANNNRCTATTGGCCACGTCATTTTNNNNNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
78287  TACAACACAATTATACAARCTATTGGCCACGTCATTTTCTATCCTRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNTAG  bur-0.fa
78287  TACAACACAATTATACAARCTATTGGCCACGTCATTTTCTATNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  c24.fa
78287  TACAACACNNNNNNNCNNRCTATTGGCCACGTCATTTNNNNNNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
78287  TACAACACAATTATACAARCTATTGGCCACGTCATTTTCTATNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
78287  TACAACACNNNNNNNNNNRNNATTGGCCACGTCATTTTNNNNNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
78287  TACAACACAATTATACAARCTATTGGCCACGTCATTTTCTATCNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
78287  TACANNNNNNNNNNNNNNRNNNTTGGCCACGTCATTNNNNNNNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
78287  TACAACNNNNNNNNNNNNRNNNTTGGCCACGTCATTTTNNNNNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
78287  NACAACNNNNNNNNNNNNRNNNTTGGCCACGTCATTTNNNNNNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
78287  TACAACACAATTATACAARCNATTGGCCACGTCATTTTCTATNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
78287  TACAACACAANTATACNARCTATTGGCCACGTCATTTNNNNNNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
78287  TACAACACNNNNNNNNNNRNNNTTGGCCACGTCATTTTNNNNNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
78287  TACAACACAATNATACAARCTATTGGCCACGTCATTTTCTATNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  sha.fa
78287  TACAACACNNNNNNNNNARCTATTGGCCACGTCATTTTNNNNNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
78287  TACAACACNNNNNNNNNNRNNNNNNNCCACGTCATTTNNNNNNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
78287  TACAANANNNNNNNNNNNRNNNTTGGCCACGTCATTTNNNNNNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
78287  TACAACACNNNNNNNCNARCTATTGGCCACGTCATTTNNNNNNNNRRRRRNNNNNNNRNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
78367  CTCTAAACATAAATAGATTTTCAAAGTTTTTTATCGTTTTTATTTTCAAATTCCTATAATCGTTTTTGTTTTATTTAGAT  chr1.fa
78367  CTCTNANRANRAANAGATTTTCAAAGTTTTTNNNNNNNNNNATTTTCAAATTCCTATAATCGTTTTTGTNNNRNNNNNNN  bay-0.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNN  bor-4.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNN  br-0.fa
78367  CTNNNNNRNNRNNNAGATTTTCAAAGTTTNNNNNNNTTTTTATTTTCAANTTCCTATAATCGTTNNNNNNNNRNNNNNNN  bur-0.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNAGTTTNNNNNNNNNNNTNTTNNNNNNNNNCTATAATCGTTTNNNNNNNRNNNNNNN  c24.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNN  col-0.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNN  cvi-0.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNN  est-1.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNNNNNNNNNNNTATANNNNNNNTTNNNNNRNNNNNNN  fei-0.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNN  got-7.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNN  ler-1.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNN  lov-5.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNN  nfa-8.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNN  rrs-10.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNN  rrs-7.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNAGTTTNNNNNNNNNNTTNTTNNNNNNNNNNTATANNNNTTNNNNNNNNRNNNNNNN  sha.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNN  tamm-2.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNRNNNNNNN  ts-1.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNN  tsu-1.fa
78367  NNNNNNNRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNN  van-0.fa
 
78447  TTATTTTATTTTTAATTATATTTTTATATACTACTATTAAAACGTATTATAAGGTTTTTTATAAGTGCTAAAATTTTTAA  chr1.fa
78447  NNNTNNNNNRTNRRRRRRTNTTTTTANNNRRTNNTATTAAAACGTATNNTRAGGTTTTTTATAAGTGRNNAAANTTRNNN  bay-0.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  bor-4.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  br-0.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNACGTATNNTRANNTTTTTNNNNNNNNRNNNNNNNNRNNN  bur-0.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNTTTATNNNNNRNNNNNNNNRNNN  c24.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  col-0.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  cvi-0.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  est-1.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNAANNNRNNNNNNNNRNNN  fei-0.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  got-7.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  ler-1.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  lov-5.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNATAANNNRNNNNNNNNRNNN  nfa-8.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  rrs-10.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  rrs-7.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  sha.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  tamm-2.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  ts-1.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  tsu-1.fa
78447  NNNNNNNNNRNNRRRRRRNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNRNNNNNNNNRNNN  van-0.fa
 
78527  TTTTTTTAAACTAATCAGATACAATATCCAAAATACTAAAAAGTGTCTCTATCTTTTTCTATTCAAAATATTGAGTTGTC  chr1.fa
78527  NNTTTTTAAACTAATCAGATACAANATCCAANNNNNNAAAAAGTGTCTCTATCTTTTTCTATTCAAAATATTGAGTNNNN  bay-0.fa
78527  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
78527  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGNNNNN  br-0.fa
78527  NNNNNNNNNNNNNNNNNNATACAATATCCAAAATACTAAAAAGTGTCTCTATCTTTTTCTATTCAAAATATTGAGTTGTC  bur-0.fa
78527  NNNNNNNNNNNNNNNNNNATACAANATCCAAAATACTAAAAAGTGNCTCTATCTNNNNNNNNNCNAAATATTGAGTNNNN  c24.fa
78527  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
78527  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNTGAGTTGNN  cvi-0.fa
78527  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
78527  NNNNNNNNNNNNNNNNNNNTACAATATCCNAAATACTAAAAAGTGTCTCTATCTTNTTNNNNNNNNNNTATTGAGTTGTC  fei-0.fa
78527  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
78527  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
78527  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
78527  NNNNNNNNNNNNNNNNNGATACNNNNNNNNNNNNNNNNNNNNNNNNNNCTNNNNNNNNNNNNNNNNNNNNNNGAGTNNNN  nfa-8.fa
78527  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
78527  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
78527  NNNNNNNNNNNNNNNNNNATACANNNNNCAAANNNNNANAANNNNNNNNTNTNNTNTNNNNNNNNNNNNNNNGNNNNNNN  sha.fa
78527  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
78527  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
78527  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
78527  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
78607  TTTGACAATATTTTAAACTAGTTGTAAATCACAGAGATAAACACCACATAAATCAATAAATAACTGTAATCTTTACCTTG  chr1.fa
78607  NNTGACAATATTTTAAACTAGTTGTAAATCACAGAGATAAACACCACANAAATCAANAAATAACTGTAATCTTTRCCTTG  bay-0.fa
78607  NNNNNNNNNNNNNNNNNNNNNNNGTAAATCACAGAGATAAACACCACANNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  bor-4.fa
78607  NNNNNNNNNNNNNNNNNNNNNNTGTAAATCACAGAGATAAACACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  br-0.fa
78607  TTTGNCAATATTTTAANCTAGTTGTAAATCACAGAGATAAACACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNTTG  bur-0.fa
78607  NNNGNNNNTATTTTAANCTAGTTGTAAATCACAGAGATAAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTG  c24.fa
78607  NNNNNNNNNNNNNNNNNNNNGTTGTAAATCACAGAGATAAACACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  col-0.fa
78607  TTTGACANNNNNNNNNNNNNNTTGTAAATCACAGAGATAAACACCACANNNNNNNNNNNNNNNNNNNNNNCNNNRCCNTG  cvi-0.fa
78607  NNNNNNNNNNNNNNNNNNNNNNTGTAAATCACAGAGATAAACACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  est-1.fa
78607  TTTGNNNNTATTTNNNNNNNNNTGTAAATCACAGAGATAAACACCACANAAATCNNNNNNNNNNNNNNNTCNTTRNNNTG  fei-0.fa
78607  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  got-7.fa
78607  NNNNNNNNNNNNNNNNNNNNNNNGTAAATCACAGAGATAAANACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  ler-1.fa
78607  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGAGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  lov-5.fa
78607  NNNGNCNNNNNNNNNNNNNNNNTGTAAATCACAGAGATAAACACCACANNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTG  nfa-8.fa
78607  NNNNNNNNNNNNNNNNNNNNNNNGTAAATCACAGAGATAAACACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  rrs-10.fa
78607  NNNNNNNNNNNNNNNNNNNNNNNNTAAATCACAGAGATAAACACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  rrs-7.fa
78607  NNTGACANNNNNNNNNNNNNNNNNNNNNNCACAGAGATAAACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  sha.fa
78607  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  tamm-2.fa
78607  NNNNNNNNNNNNNNNNNNNNNNNGTAAATCACAGAGATAAACACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  ts-1.fa
78607  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGAGATAAACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  tsu-1.fa
78607  NNNNNNNNNNNNNNNNNNNNNNNGTAAATCACAGAGATAAACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNN  van-0.fa
 
78687  AAGATTTTATTCATATGAAATATCTTATAGAAAATACTTCGTTAGCTTGAAAATGCATATTTAGTTTAAATACAAATAAA  chr1.fa
78687  AAGATTTTATTCNNNNNNNNNNNCTTATAGAAAATACTTCGTTARCTTGAAAATGCATATTTAGTTTNAATACANNNNNN  bay-0.fa
78687  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNARCTTGAAAATNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
78687  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCGTTARCTTGAAAATGNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
78687  AAGATTTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNARCTTGAAAATGCATANNNNNNNNNNNNNCAAANANN  bur-0.fa
78687  AAGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTNRCTTGAAAATGCATNNNNNNNNNNNNNNNNNNNNNN  c24.fa
78687  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGNTARCTTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
78687  AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTTCGTTARCTTGAAAATGCNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
78687  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTANTTCGNTARCTTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
78687  AAGATTNNNNNNNNNNNNNNNNNNNNNNNNNAAATACTTCGTTARCTTGAAAATGCNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
78687  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
78687  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGNNARCTTGAAAANNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
78687  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
78687  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTCGTNARCTTGAAAATGNNNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
78687  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNARNNNGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
78687  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCGNNARCTTGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
78687  NNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNGAAAATGNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
78687  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
78687  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNRNNTGAAAANNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
78687  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRCNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
78687  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGTTARCTTGAAAATGNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
78767  CGAAACAAAAAGCAAAAAGCATAGACGGATCCGTAAATCTACTCTTAAGAAGCCATGCAAGAAAGATTCAAAGTCATCAC  chr1.fa
78767  CGAAACNNNNNNNNAAAANCATAGACGGATCCGTAAATCTACTCTTAAGAAGCCATGCAAGAAAGATTCAAAGTCANCAC  bay-0.fa
78767  NNNNNNNNNNNNCAAAAAGCATAGACGGATCCGTAAATCNACTCTTAAGAAGCCATGCAAGAAAGATTCAAAGTCANCAC  bor-4.fa
78767  NNNNNNNNNNNNNNNAAAGCATAGACGGNNNNNNNNTNNNNNNNNNNAGAAGCCATGCAAGAAAGATTCAAAGNNNNCAC  br-0.fa
78767  NNNNNNNNNNNNNNAAAAGCATAGACGGNTCCGTAATNNNNNNCNTAAGAAGCCATGCAAGAAAGATTCAAAGTCATCAC  bur-0.fa
78767  NNNNNNNNNNNNNNAAAAGCATAGACGGATCCGTAAATCTACTCTTAAGAAGCCATGCAAGAAAGATTCAAAGTCANCAC  c24.fa
78767  NNNNANANNNNNNNAAAAGCATAGACGGATCCGTAAATCTACTCTTAAGAAGCCATGCAAGAAAGATTCAAAGTCANCAC  col-0.fa
78767  NNNNNNNANNANCAAAAAGCATAGACGGATCCGTNNTNNNNNNNTTAAGAAGCCATGCAAGAAAGATTCAAAGTCATCAC  cvi-0.fa
78767  NNNNNNNNNNNNNNNAAAGCATAGACGGATCCGTAAATCTNCTCTTAAGAAGCCATGCAAGAAAGATTCAAAGNNNNCAC  est-1.fa
78767  CGANNNNNNNNNCAAAAAGCATAGACGGATCCGTNNTNNNNNNNNTAAGAAGCCATGCAAGAAAGATTCAAAGTCATCAC  fei-0.fa
78767  NNNNNNNNNNNNNNNNNNNNNTAGANNNNNNNNNNNNNNNNNNNNNNAGAAGCCATGCAAGAAANATTCANNNNNNNNNC  got-7.fa
78767  NGAAANNNNNNNNNNAANGCATAGACGGATCCGTAAATCTNCTCTTAAGAAGCCATGCAAGAAAGATTCAAAGTCANCAC  ler-1.fa
78767  NNNNNNNNNNNNNNAAAAGCATAGNNNNNNNNNNNNNNNNNNNNNNNAGAAGCCATGCANGANANNNNNAAAGTCANCAC  lov-5.fa
78767  NNNAACAANAANCAAAAAGCATAGACGGNNNNNNNNTNNNNNNNNNAAGAAGCCATGCAAGAAAGATTCAAAGTCATCAC  nfa-8.fa
78767  NNNNNNNNNNNNNNNAAAGCATAGACGGATCCGTAAATCNACTCTTAAGAAGCCATGCAAGAAAGATTCAAAGTCATCAC  rrs-10.fa
78767  CGNNNNNNNNNNNNAAAAGCATAGACGGATCCGTAAATCTNCTCTTAAGAAGCCATGCAAGAAAGATTCAAAGTCANCAC  rrs-7.fa
78767  NNNNNNNNNNNNNNNAAAGCATNNNNNGATCCGTAAATCTACTCTTAAGAAGCCATGCAAGAAAGATTCAAAGTCANCAC  sha.fa
78767  NNNNNNNNNNNNNNNNNNNNNNNNNCGNATCCGTAAATCTACTCTTAAGAAGCCATGCAAGAAAGATTCAANGNNANCAC  tamm-2.fa
78767  CNNNNNNNNNNNNNNAAAGCATAGANNNNNNNNNNNTNNNNNNNNNNAGAAGCCATGCAAGAAAGANTCAAAGNNNNCAC  ts-1.fa
78767  NNNNNNNNNNNNNNNNAANNNNNGNNNNNNNNNNNNNNNNNNNNNNNNGAAGCCANGCAAGAAANNNNNNNNNNNNNCAC  tsu-1.fa
78767  NNNNNNNNNNANCAAAAAGCATAGACGGNNNNNNNNTNNNNNNNNTAAGAAGCCATGCAAGAAAGATTCAAAGTCNNCAC  van-0.fa
 
78847  AAAAACCAAGCTTTTGTAATTTGCGCAAGTAATTAACAAAAAAAAATGTAACAATAAATGGTGATCAGAGGCAATAACAT  chr1.fa
78847  AAAAACCAAGCTTTTGTAATTTGCGCAAGTAATTAACAAAAAAANNNRNNNNAANAAATGGTGATCAGAGGCAATAACAT  bay-0.fa
78847  AAAAACCNNNNNTTTGTAATTTGCGCAANNNNNNNNNNNNAAANNNNRNNNNNNNNAATGGTGATCAGAGGCAATANNNN  bor-4.fa
78847  AAAAACCNNNNNNTTGTAATTTGCGCAAGNNNNNNNNAANNNNNNNNRNNNNNNNNAATGGTGATCAGAGGCAATAACNT  br-0.fa
78847  AAAAACCAAGCTTTTGTAATTTGCGCAAGTAATTAACAAAAAAAANNRNNNCAATAAATGGTGATCAGAGGCAATAACAT  bur-0.fa
78847  AAAAACCAAGCTTTTGTAATTTGCGCAAGTAATNAACAAAAAAANNNRNNNNNNNAAATGGTGATCAGAGGCAATAACAT  c24.fa
78847  AAAAACCNAGCTTTTGTAATTTGCGCAAGTNNNNNNNAAAAAAANNNRNNNNNNNNNNTGGTGATCAGAGGCAATAACAT  col-0.fa
78847  AAAAACCAAGCTTTTGTAATTTGCGCAAGTNNNNNNNAAAAAANNNNRNNNNNNNNAATGGTGATCAGAGGCAATAACAT  cvi-0.fa
78847  AAAAACCANGCTTTTGTAATTTGCGCAAGNNNNNNNNNNNNNNNNNNRNNNNNNNNNNTGGTGATCAGAGGCAATAANNN  est-1.fa
78847  AAAAACCAAGCTTTTGTAATTTGCGCAAGTAATTAANAAAAAAANNNRNNNNNANAAATGGTGATCAGAGGCAATAACAT  fei-0.fa
78847  AAAAACNNNNNNNTTGTAATTNNNNNNNNNNNNNNNNAAAAAAANNNRNNNNNNNNNNNNNTGATCAGAGGCAATAACAN  got-7.fa
78847  AAAAANNNNNNNNTTGTAATTTGCGCAANNNNNNNNNNAAAAAANNNRNNNNNNNNNNNNGTGATCAGAGGCAATAACAT  ler-1.fa
78847  AAAANNNNNNNNNNTGTAATNTNNNNNNNNNNNNNNNNNAAANNNNNRNNNNNNNNNNNNGTGATCAGAGGCAANANNNN  lov-5.fa
78847  AAAAACCAAGCTTTTGTAATTTGCGCAAGTNNNNNNNAAAAAAANNNRNNNNNNNNNATGGTGATCAGAGGCAATAACAT  nfa-8.fa
78847  AAAAACCAAGNTTTTGTAATTTGCGCAANNNNNNNNNNNNANNNNNNRNNNNNNNNNNNGGTGATCAGAGGCAATAACAT  rrs-10.fa
78847  AAAAACNNNNNNTTTGTAATTTGCGCAAGTAATNNNNAAAAAANNNNRNNNNNNNNAATGGTGATCAGAGGCAATAACAT  rrs-7.fa
78847  AAAAACCAAGCTTTTGTAATTTGCGCAAGTNNNNNNNAAAAAANNNNRNNNNNNNNAATGGTGATCAGAGGCAATAACAT  sha.fa
78847  AAAAACCANGCTTTTGTAATTTGCGCAANNNNNNNNNAAAAAAANNNRNNNNNNNNNATGGTGATCAGAGGCAATAACAT  tamm-2.fa
78847  AAAAACCNNNNNNTTGTAATTTGCGCAANNNNNNNNNAAAAAAANNNRNNNNNNNNAATGGTGATCAGAGGCAATAACAT  ts-1.fa
78847  AAAAANNNNNNNNTTGTAATTNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNGTGATCAGAGGCAATANNNN  tsu-1.fa
78847  AAAAACCAAGCTTTTGTAATTTGCGCAANNNNNNNNNAAAAANNNNNRNNNNNNNNAATGGTGATCAGAGGCAATAACAT  van-0.fa
 
78927  GTTGGGGGGGATGAAGCCTGGTCCGAGGATACTCTCTATGATCACTTGAATCATTAACATACACATGTATATATCTATAA  chr1.fa
78927  GNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGATCACTTGAATCATTAACATACACATGNATATATCTATAA  bay-0.fa
78927  NNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTNTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
78927  GNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGATCACTTGAATCATTAACNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
78927  GTTNRNRRRRRRRRRRNRRRGTCCGAGGATACTCTCTATGATNNNNNNTNTCATTAACATACACANNNNNNNATCTATAA  bur-0.fa
78927  GNTNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAA  c24.fa
78927  GNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGATCACTTGAATCATTAACATNNNNNNNNNNNNNNNNNNNN  col-0.fa
78927  GTNGRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA  cvi-0.fa
78927  NNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGATNNNNNNNATCATTAACANNNNNNNNNNNNNNNNNNNNN  est-1.fa
78927  GNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGATCACTTGAATCATTAACATNNNNNNNNNNNNNNNNNNNA  fei-0.fa
78927  NNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
78927  GNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGANNNNNNNNATCATNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
78927  NNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
78927  GTNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
78927  GNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGATCACTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
78927  GNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATGATCNCTTGAATCATTAANNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
78927  GNNGRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
78927  GNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
78927  NNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
78927  NNNNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
78927  GNTNRNRRRRRRRRRRCRRRGTCCGAGGATACTCTCTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
79007  TATCCTCGATCCAGACAACATTCCCCTCAACTGAAATAGCTTAACCCTCATGATAATCGATCTTAGCAGATTCACAAATT  chr1.fa
79007  TATNCTCGANCRRRNNAACATTCNNNRCAACTGAAATAGCTTAACCCTCATGATAATCGATCTTAGCAGATTCACAAATT  bay-0.fa
79007  NNTCCTCGANCRRRACAACATTCNNNRNNNNNNNNNTAGCTTANNNNNNNNNATAATCGATCTTAGCAGATTCNCAAATT  bor-4.fa
79007  NATCCTCGANCRRRACAACATTCNNNRCANCTGAAATAGCTTAACCCTCATGATAATCGATCTTAGNNNNNTCACAAATT  br-0.fa
79007  TATCCTCGANCRRRACAACATTCNNNRCAACTGAAATAGCTTAACCCTCATGATAATCGATCTTAGCAGATTCACAAATT  bur-0.fa
79007  TATCCTCGANCRRRACAACATTCNNCRCAACTGAAATAGCTTAACCCTCATGATAATCGATCTTAGCAGATTCACAAATT  c24.fa
79007  NATCCTCGANCRRRACAACATTCNNNRCNNCTGAAATAGCTTAACCCTCATGATAATCGATCTTAGCAGATTCACAAATT  col-0.fa
79007  TATCCTCGANCRRRACAACATTCNNCRCAACTGAAATAGCTTAACCCTCATGATAATCGATCTTAGCAGATTCACAAATT  cvi-0.fa
79007  NATCCTCGANCRRRACAACATTCNCNRCNACTGAAATAGCTTAACCCTCATGATAATCGATCTTAGCAGNTTCACAAATT  est-1.fa
79007  TATCCTCGANCRRRACAACATTCCNCRCAACTGAAATAGCTTAACCCTCATGATAATCGATCTTAGCAGATTCACAAATT  fei-0.fa
79007  TATCCTCGANCRRRACAACATTCNNNRCNNCNNNNATAGCTTAANNNNNNNGNTAATCGATCTTANNNNNNNNACANNNN  got-7.fa
79007  NNTCCTCGANCRRRACAACATTCNNNRNAACTGAAATAGCTTAACCCTCATGATAATCGATCTTAGCAGATTCACAAATT  ler-1.fa
79007  NNNCCTCGANCRRRACAACATTCNNNRNNNCNNNNNNNNNNTAACCCNCATGATAATCNNNNNNNNNNNNNNNNCAAATT  lov-5.fa
79007  TATCCTCGANCRRRACAACATTCNNNRCAACTGAAATAGCTTAACCCTCATGATAATCGATCTNAGCAGATTCACAAATT  nfa-8.fa
79007  TATCCTCGANCRRRACAACATTCNNNRNNNNNNNNATAGCTTAACCCTCATGATAATCGATCTTAGCAGATTCNCAAATT  rrs-10.fa
79007  NNTCCTCGANCRRRACAACATTCNNNRNAACTGAAATAGCTTAACCCTCATGATAATCGATCTTAGCAGATTCACAAATT  rrs-7.fa
79007  TATCCTCGANCRRRACAACATTCNNNRCANCTGAAATAGCTTAACCCTCATGATAATCGATCTTAGCAGATTCACAAATT  sha.fa
79007  NATCCTCGANCRRRACAACATTCNNNRCNACTGAAATAGCTTAACCCTCATGATAATCGATCTTAGCAGATTCACAAATT  tamm-2.fa
79007  TATCCTCGANCRRRACAACATTCNCNRCNNCTGAAATAGCTTAACCCTCATGATAATCGATCTTAGCAGATTCACAAANT  ts-1.fa
79007  NNNNCTCGANCRRRACNACATTCNNNRNNNNNNNNNNNNNNTNACCCTCATGATAATNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
79007  TATCCTCGANCRRRACAACATTCNNNRCNACTGAAATAGCTTAACCCTCATGATAATCGATCTTAGCAGATTCACAAATT  van-0.fa
 
79087  TTTGTTGTAGAGAGTGATAGAGGAGAGAGAGAGAGAGGTTGGTGAATGGTGATGATGGTGTTATGATGAGGGAATGATGA  chr1.fa
79087  TTTGTTGTAGAGAGTGANNNNNNNNNRNNNNNNNNNNNNNGGTGANNNNNNANGNRRRRRRRRRRRRRRNGNAATGATGA  bay-0.fa
79087  TTTGTTGNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGTGNNGNRRRRRRRRRRRRRRNNNAATGATGA  bor-4.fa
79087  TTTGTTGTAGAGAGNNNNNNNNNNNNRNNNNNNNNNNNTTGGTGAATGNNNNNGNRRRRRRRRRRRRRRNGGAATGATGA  br-0.fa
79087  TTTGTTGTAGAGAGTGANNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGNGANGNRRRRRRRRRRRRRRGGGAATGATGA  bur-0.fa
79087  TTTGTTGTNGAGAGTGNNNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGNGANGNRRRRRRRRRRRRRRGGGAATGATGA  c24.fa
79087  TTTGTTGTNGANNNNNNNNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGTGNTGNRRRRRRRRRRRRRRGGGAATGATGA  col-0.fa
79087  TTTGTTGTAGAGAGTGNNNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGTGANGNRRRRRRRRRRRRRRGGGAATGATGA  cvi-0.fa
79087  TTTGTTGTNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGTGANGNRRRRRRRRRRRRRRNNNAATGATGA  est-1.fa
79087  TTTGTTGTAGAGAGTNNNNNNNNNNNRNNNNNNNNNNNTTGGTGAATGGTGANGNRRRRRRRRRRRRRRGGGAATGATGA  fei-0.fa
79087  NNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNTTGGTGAATGGTGANGNRRRRRRRRRRRRRRNNNAATGATGA  got-7.fa
79087  TTTGTTGNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNTGGTGANTGNTGNNNNRRRRRRRRRRRRRRNNNAATGATGA  ler-1.fa
79087  TTTGNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNTGNNNNNNNRRRRRRRRRRRRRRNNNAATGATGA  lov-5.fa
79087  TTTGTTGTNGANANNNNNNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGTGANGNRRRRRRRRRRRRRRGGGAATGATGA  nfa-8.fa
79087  TTTGTTGTNGAGAGNNNNNNNNNNNNRNNNNNNNNNNGTTGGTGAATGGTGANGNRRRRRRRRRRRRRRGGGAATGATGA  rrs-10.fa
79087  TTTGTTGNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNGGTGAATGGTGANGNRRRRRRRRRRRRRRNNNAATGATGA  rrs-7.fa
79087  TTTGTTGTNGANANNNNNNNNNNNNNRNNNNNNNNNNNNTGGTGAATGGTGANGNRRRRRRRRRRRRRRGNGAATGATGA  sha.fa
79087  TTTGTTGTNGAGANNNNNNNNNNNNNRNNNNNNNNNNNTTGGTGAATGGTGANGNRRRRRRRRRRRRRRNNNAATGATGA  tamm-2.fa
79087  TTTGTTGTNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNTGGTGANTGNTGNNGNRRRRRRRRRRRRRRGNNAATGATGA  ts-1.fa
79087  NNNNTTGNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNGANNNNTGNNNNRRRRRRRRRRRRRRNNNNNNGNTGA  tsu-1.fa
79087  TTTGTTGTAGAGAGTGNNNNNNNNNNRNNNNNNNNNNGTTGGTGAATGGTGANGNRRRRRRRRRRRRRRGNGAATGATGA  van-0.fa
 
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCGTCATTCCTAAACCCTAGCTTTTTCAAAAAT  chr1.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCGTCATTCCRAAACCCTAGCTTTTTCAANNNN  bay-0.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATNNNNNNCAACAGAAACAGGTCGTCATTCCRAAACCCTANNNNNNNNNNNNNN  bor-4.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAAGANACAACAGAAACAGGTCGTCATTCCRAAACCCTNNNNNNNNNNNNNNN  br-0.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCGTCATTCCRAAACCCTAGCTTTTTNNNNNNN  bur-0.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCGTCATNNCRNNNCCCTAGCTTTTTCNNNNNN  c24.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCGTCATTCCRAAACCCTANNNNNNNNNNNNNN  col-0.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCGTCATTCCRAAACCCTAGCTTTTTNNNNNNN  cvi-0.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATANNNNNNAACAGAAACAGGTCGTCATTCCRAAACCCTNNNNNNNNNNNNNNN  est-1.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCGTCATTCCRAAACCCTAGCTTTTTNNNNNNN  fei-0.fa
79167  GTGGCGGAGACGAAGATGGGNNNNNNNNNNNNNNNNNCAGAAACAGGTCGTCATTCCRANNCNNNNNNNNNNNNNNNNNN  got-7.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATNNNNNNCAACAGAAACAGGTCGTCATTCCRAAACCCTAGCNNNNNNNNNNNN  ler-1.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTANNNNNNNNNAACAGAAACAGGTCGTCATTCCRNNNCCCNNNNNNNNNNNNNNNN  lov-5.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCGTCATTCCRAAACCCTAGCTTTTNNNNNNNN  nfa-8.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCGTCATTCCRAAACCCTAGNNNNNNNNNNNNN  rrs-10.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCGTCATTCCRAAACCCTAGCNNNNNNNNNNNN  rrs-7.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCGTCATTCCRANACCCTAGCTTTTTNNNNNNN  sha.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAAGACACAACAGAAACAGGTCGTCATTCCRAAACNNNNNNNNNNNNNNNNNN  tamm-2.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAAGACANAACAGAAACAGGTCGTCATNNNRNNNCNNNNNNNNNNNNNNNNNN  ts-1.fa
79167  GTGGCGGAGACGAAGATGGGNNNNNNNNNNNNNNNNNCAGAAACAGGTCGTCATTCCRANNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
79167  GTGGCGGAGACGAAGATGGGCTTTTAATAANANACAACAGAAACAGGTCGTCATTCCRAAACCCTAGCNNNNNNNNNNNN  van-0.fa
 
79247  ATATTTTATTTATTATAATATCAATGACGCAGTTACTGCTTATATTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  chr1.fa
79247  NNNNNNNRRNNNNNNNAATATCAATGACGCAGTTACTGCTTATATTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  bay-0.fa
79247  NNNNNNNRRNNNNNNNNNNNNNAATGACGCAGTTACTGCTNNNNNNTTCGAATGAGGTGACACGTCATACGTTTAACTTG  bor-4.fa
79247  NNNNNNNRRNNNNNNNNNNATCAATGACGCAGTTACTGCTTATATTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  br-0.fa
79247  NNNNNNNRRNNNNNNNNNNATCAATGACGCAGTTACTGCTTATATTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  bur-0.fa
79247  NNNNNNNRRNNNNNNNNNNATCAATGACGCAGTTACTGCTTATATTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  c24.fa
79247  NNNNNNNRRNNNNNNNNNNNNCAATGACGCAGTTACTGCTTNTATTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  col-0.fa
79247  NNNNNNNRRNNNNNNNNNNATCAATGACGCAGTTACTGCTTATATTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  cvi-0.fa
79247  NNNNNNNRRNNNNNNNNNNATCAATGACGCAGTTACTGCTTATNTTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  est-1.fa
79247  NNNNNNNRRNNNNNNNNNNATCAATGACGCAGTTACTGCTTATATTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  fei-0.fa
79247  NNNNNNNRRNNNNNNNNNNNNNNATGACGCANNNNNNNNNNNNNNNNTCGAATGAGGTGACACGTCATACGTTTAACTNG  got-7.fa
79247  NNNNNNNRRNNNNNNNNNNNNNAATGACGCNNNNNNNNNNNNNNTTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  ler-1.fa
79247  NNNNNNNRRNNNNNNNNNNNNNNNNGACNNNNNNNNNNNNNNNNNTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  lov-5.fa
79247  NNNNNNNRRNNNNNNNNNNATCAATGACGCAGTTACTGCTTATATTTTCGNNNNNNNNNNNNNNTCATACGTTTAACTTG  nfa-8.fa
79247  NNNNNNNRRNNNNNNNNNNNNCAATGACGCAGNNNNNNNNNNNNNNTTCGAATGAGGTGACACGTCATACGTTTAACTTG  rrs-10.fa
79247  NNNNNNNRRNNNNNNNNNNNTCAATGACGCAGTNNNNNCTTATATTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  rrs-7.fa
79247  NNNNNNNRRNNNNNNNNNNATCAATGACGCAGTTACTGCTTATATTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  sha.fa
79247  NNNNNNNRRNNNNNNNNNNNNNAATGACGCAGTNNNNNCTTATATTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  tamm-2.fa
79247  NNNNNNNRRNNNNNNNNNNNNNNATGACGCNNNNNNNGCTTATATTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  ts-1.fa
79247  NNNNNNNRRNNNNNNNNNNNNNNNNNACGCAGNNNNNNNNNNNNNTTTCGAATGAGGTGACACGTCATACGTTTAACTTG  tsu-1.fa
79247  NNNNNNNRRNNNNNNNNNNNTCAATGACGCAGTTACTGCTTATANNNNNGAANNNNNNNNNNNNNCATACGTTTAACTTG  van-0.fa
 
79327  GCAAGAAAAAAATT   chr1.fa
79327  GCAANAAAAAAANT   bay-0.fa
79327  GCAANANNNNNNNN   bor-4.fa
79327  GCAAGAAANNNNNN   br-0.fa
79327  GCAAGAAAAAAATT   bur-0.fa
79327  GNNNNNNNNNNNAN   c24.fa
79327  GCAAGAAAANNNNN   col-0.fa
79327  NNNNNNNNNNNNAN   cvi-0.fa
79327  GCAANAANANNNNN   est-1.fa
79327  GCAAGAAAAAAANN   fei-0.fa
79327  NNNNNNNNNNNNNN   got-7.fa
79327  GCAAGAANNNNNNN   ler-1.fa
79327  GCAANANNNNNNNN   lov-5.fa
79327  GCAAGAAAAAAANN   nfa-8.fa
79327  GCAANAAAAANNNN   rrs-10.fa
79327  GCAAGAAAAANNNN   rrs-7.fa
79327  GCANNNNNNNNNNN   sha.fa
79327  GNNNNNNNNNNNNN   tamm-2.fa
79327  NNNNNNNNNNNNNN   ts-1.fa
79327  NNNNNNNNNNNNNN   tsu-1.fa
79327  GCAAGAAAAAAANN   van-0.fa
 
visited.