Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 92583 - 95552


<
Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
92583  ATGACTGGAGACGTCCTTCCTTGTTTTGATGCTTTTAAAATGACTCTCCCTGAAGACGCAGCTTCCATAGTTACTGTGCC  chr1.fa
92583  ATGACTGGAGACNTCRRRRRRRRRRRRRRRRRRRNNNAAATGACTCNCCCTGANGACGCAGCTTRRRRRRRRACTGTGCC  bay-0.fa
92583  NNNNCTGGAGACGTCRRRRRRRRRRRRRRRRRRRNNNNNNNNACTCNCCCTGAAGACGCAGCTTRRRRRRRRACNGTGCC  bor-4.fa
92583  NNNACTGGAGACGTCRRRRRRRRRRRRRRRRRRRNNNNNNNNANTCNCCCTGAAGACGCAGCTTRRRRRRRRACTGTGCC  br-0.fa
92583  ATGACTGGAGACGTCRRRRRRRRRRRRRRRRRRRNTNAAATGACTCTCCCTGAAGACGCAGCTTRRRRRRRRACTGTGCC  bur-0.fa
92583  ATGACTGGAGACGTCRRRRRRRRRRRRRRRRRRRNNNAAATGACTCNCCCTGANGACGCAGCTTRRRRRRRRACTGTGCC  c24.fa
92583  NTGACTGGAGACGTCRRRRRRRRRRRRRRRRRRRNNNNNNTGACTCTCCCTGAAGACGCAGCTTRRRRRRRRACTGTGCC  col-0.fa
92583  ATGACTGGAGACGTCRRRRRRRRRRRRRRRRRRRNNNAAATGACTCTCCCTGANGACGCAGCTTRRRRRRRRACTGTGCC  cvi-0.fa
92583  NNNNCTGGAGACGTCRRRRRRRRRRRRRRRRRRRNNNNNNNNANTCTCCCTGAAGACGCAGCTTRRRRRRRRNCNGTGCC  est-1.fa
92583  ATGACTGGAGACGTCRRRRRRRRRRRRRRRRRRRNNNAAATGACTCTCCCTGAAGACGCAGCTTRRRRRRRRACTGTGCC  fei-0.fa
92583  NNNNNNGGAGACGTCRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNTCCCTGAAGACGCAGCNTRRRRRRRRANNNNNNC  got-7.fa
92583  NNNNNNNNAGACNNCRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNCCCTGAAGACGCAGNNNRRRRRRRRACNGTGCN  ler-1.fa
92583  NNNNNNNNNNACNNNRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNCCCTGANGACGCAGCNNRRRRRRRRNNNGTGCN  lov-5.fa
92583  ATGACTGGAGACGTCRRRRRRRRRRRRRRRRRRRNNNAAATGACTCTCCCTGAAGACGCAGCTTRRRRRRRRACTGTGCC  nfa-8.fa
92583  NNNACTGGAGACGTCRRRRRRRRRRRRRRRRRRRNNNNNNNGACTCTCCCTGAAGACGCAGCTTRRRRRRRRNCNGTGCC  rrs-10.fa
92583  NNNACTGGAGACGTCRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNCCCTGAAGACGCAGCTTRRRRRRRRACTGTGCC  rrs-7.fa
92583  ATGACTGGAGACGTCRRRRRRRRRRRRRRRRRRRNNNAAATGACTCTCCCTGAAGACGCAGCTTRRRRRRRRACTGTGCC  sha.fa
92583  NNNNNNGGAGACGTCRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNCTCCCTGAAGACGCAGCNTRRRRRRRRACTGTGCC  tamm-2.fa
92583  NNNACTGGAGACGNCRRRRRRRRRRRRRRRRRRRNNNNNNNNACTCTCCCTGAAGACGCAGCNTRRRRRRRRACNGTGCC  ts-1.fa
92583  NNNNNNNNNNACNTCRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNCCCTGAAGACGCAGCNNRRRRRRRRNNNNNNCN  tsu-1.fa
92583  NNNACTGGAGACGTCRRRRRRRRRRRRRRRRRRRNNNNNNTGACTCTCCCTGAAGACGCAGCTTRRRRRRRRACTGTGCC  van-0.fa
 
92663  TATTACTCTCGATATTGCCTCCAACCATGGTGTTATTGTCACATCAAAATCTGAGTCACTTGCTGAAAGCTATACAGTTA  chr1.fa
92663  TARRACTCTCGATNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAAATCTGAGTCACTTRCNGAAAGCTATACARTRA  bay-0.fa
92663  TARRACTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAAATCTGAGTCACTTRCNGAAAGCTANNNNRNRN  bor-4.fa
92663  TNRRACTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAAATCTGAGTCACTTRCTGAAAGCTNTNNNRNRN  br-0.fa
92663  TARRACTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAAATCTGAGTCACTTRCTGAAAGCTATACARTRA  bur-0.fa
92663  TARRACTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAAATCTGAGTCACTTRCNGAAAGCTATACARTRA  c24.fa
92663  TARRNCTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAAATCTGAGTCACTTRCTGAAAGCTNNNNNRNRN  col-0.fa
92663  TARRACTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAAATCTGAGTCACTTRCTGAAAGCTATNCNRNRN  cvi-0.fa
92663  TARRACTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAAATCTGAGTCACTTRCTGAAAGCTANNNNRNRN  est-1.fa
92663  TARRACTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAAATCTGAGTCACTTRCNGAAAGCTATACNRTRN  fei-0.fa
92663  TNRRNCTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAANTCTGAGTCANNNRNNNANNNNNNNNNNRNRN  got-7.fa
92663  TARRACTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAANTCTGAGTCANNNRCNNAAANNNNNNNNRNRN  ler-1.fa
92663  NARRNCNCTCGNTNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNTCNGAGTCANNNRNNNNNNNNNNNNNNRNRN  lov-5.fa
92663  TARRACTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAAATCTGAGTCACTTRCTGAAAGCTATACNRNRN  nfa-8.fa
92663  NARRNNTCTCGATNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAANTCTGAGTCANNTRNNNAAAGCNNNNNNRNRN  rrs-10.fa
92663  TARRACTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAAATCTGAGTCACNNRNNGAANNNNNNNNNRNRN  rrs-7.fa
92663  TARRACTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAAATCNNNNNNNNNNRNNNNNNNNNNNNNNRNRN  sha.fa
92663  NARRNCTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNTCNNNNNNNNNNRNNNNNNNNNNNNNNRNRN  tamm-2.fa
92663  TARRNCTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRAAATCTGAGTCACNNRNNNAAAGCTNNNNNRNRN  ts-1.fa
92663  NNRRNCNCTCGNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNATCTGAGTCACTNRNNGNNNNNNNNNNNRNRN  tsu-1.fa
92663  TARRACTCTCGATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNAATCTGAGTCACTTRCTGAAAGCTATNNNRNRN  van-0.fa
 
92743  GTTTAGTCAATGATCTTCTGCAGAAGCCTACAGTAGAGGATCTTGTCAAGAAAGATGCAATTTTACATGATGGACGGACA  chr1.fa
92743  GTTTAGTCAATGATNNNNNNNNNNNGCCTACAGTAGAGGATCTTGTCAAGAAAGATGCRATRTTNCATGATRRRRGNACA  bay-0.fa
92743  NNNNNNNNAATGATCTTCNNNNNAAGCCTACAGTAGAGGNNNNNNNNNNNNNNNNNNNRNNRNTNCATGATRRRRGGACA  bor-4.fa
92743  NNNNAGTCAATGATCTTCTGCNGAAGCCTACAGTAGAGGATCTTGTCAAGAAAGANGNRNNRTTACATGATRRRRGGACA  br-0.fa
92743  GTTTAGTCAATGATCTTCTGNAGAAGCCTACAGTAGAGGATCTTGTCAAGAAAGANGNRNNRNTGCATGATRRRRGGACA  bur-0.fa
92743  GTTTAGTCAATGATCTTCNGNNGNAGCCTACAGTAGAGGATCTTGTCAAGAAAGATGCRATRTTACATGATRRRRGGACA  c24.fa
92743  NNTTNGNCAATGATCTTCTGCAGAAGCCTACAGTAGAGGANNNNNNNNNNNANGANGCRNTRTTACATGATRRRRGGACA  col-0.fa
92743  NTTTAGTCAATGATCTTCTGCAGAAGCCTACAGTAGAGGATCTTGTCAAGAAAGATGCRATRTTACATGATRRRRGGACA  cvi-0.fa
92743  NNNNNGTCAATGATCTTCTGCAGAAGCCTACAGTAGAGGATCTTNNNNNNNANNNNNNRNNRTTACATGATRRRRGGACA  est-1.fa
92743  GTTTAGTCAATGATCTTCTGCAGAAGCCTACAGTAGAGGATCTTGTCAAGAAAGANGCRATRTTNCATGATRRRRGGACA  fei-0.fa
92743  NNNNNNNNNNNNNNNNNNNNNNNNNGCCTACAGTAGAGNNNNNNNNNNNNNNNNNNNNRNNRNNNNNNNNNRRRRGGACA  got-7.fa
92743  NNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAGTAGANNNNNNNNNNNNNNNNNNNNNRNNRNTACATGATRRRRGGACA  ler-1.fa
92743  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNCATGANRRRRGGACA  lov-5.fa
92743  GNTTAGTCAATGATCTTCTGCAGAAGCCTACAGTAGAGGATCTTGTCAAGAAAGANGCRATRTTACATGATRRRRGGACA  nfa-8.fa
92743  NNNNNNNCAATGATNTTCTGCNGAAGCCTACAGTAGANNNNNNNNNNNNNNNNGANNNRNNRTNACATGATRRRRGGACA  rrs-10.fa
92743  NNNNNGTCAATGNNNNNNNNNNNNNNNCTACAGTAGAGGNNNNNNNNNNNNNNNNNNNRNNRNTNCATGATRRRRGGACA  rrs-7.fa
92743  NNNNNNNCAATGATCTNCNNNNNNNNNCTACAGTAGAGGATCTTGTCAAGANAGANGCRNNRTTNCATGATRRRRGGACA  sha.fa
92743  NNNNNNNNNNNNATNTTCTGNNNNNNCCTACAGTAGAGGNNNNNNNNNNNNNNNNNNNRNNRNTNCATGATRRRRGGACA  tamm-2.fa
92743  NNNNAGTCAATGATCTNCNNNNNNNNCCTACAGTAGAGGNNNNNNNNNNNNNNNANNNRNNRNTACATGATRRRRGGACA  ts-1.fa
92743  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGNANNNNNNNNNNNNNNNNNNNNNNNRNNRNNNCATGATRRRRGGACA  tsu-1.fa
92743  NNNNNGTCAATGATCTTCTGCAGAAGCCTACAGTAGAGGATCTTGTCAAGAAAGANGCRNTRTTACATGATRRRRGGACA  van-0.fa
 
92823  CTCCTTGACACTGGGATAATATCTGCTAGGGGCAGAGCATGGTCGGACCTGGTCGCTCTTGGATGCTCGTGCCAACCCAT  chr1.fa
92823  CTCNTTGACACTGGGATAATATCTGCTAGGGGCAGAGCATGGTCGGNCCTGGTCGCTCTTGGATRRRRRRRRRRRRRRRR  bay-0.fa
92823  CTCCTTGACACTGGGATAATATCTGCTAGGGGCAGAGCATGGTCGGACCTGGTCGCTCTTGGATRRRRRRRRRRRRRRRR  bor-4.fa
92823  CTCNTTGACACTGGGATAATATCTGCTAGGGGCAGAGCATGGTCGGACCTGGTCGCTCNTGGATRRRRRRRRRRRRRRRR  br-0.fa
92823  CTCCTTGACACTGGGATAATATCTGCTAGGGGCAGAGCATGGTCGGACCTGGTCGCTCTTGGATRRRRRRRRRRRRRRRR  bur-0.fa
92823  CTCCTTGACACTGGGATAATATCTGCTAGGGGCAGAGCATGGTCGGACCTGGTCGCTCTTGGATRRRRRRRRRRRRRRRR  c24.fa
92823  CTCCTTGACACTGGGATAATATCTGCTAGGGGCAGAGCATGGTCGGACCTGGTCGCTCTTGGATRRRRRRRRRRRRRRRR  col-0.fa
92823  CTCCTTGACACTGGGATAATATCTGCTAGGGGCAGAGCATGGTCGGACCTGGTCGCTCTTGGATRRRRRRRRRRRRRRRR  cvi-0.fa
92823  CTCCTTGACACTGGGATAATATCTGCTAGGGGCAGAGCATGGTCGGACCTGGTCGCTCTTGGATRRRRRRRRRRRRRRRR  est-1.fa
92823  CTCCTTGACACTGGGATAANNNNNNNTAGGGGCAGAGCATGGTCGGACCTGNTCGCTCTTGGNTRRRRRRRRRRRRRRRR  fei-0.fa
92823  CTCCTTGACACTGGGATAATANCTGNTAGGGGCAGAGCATGGTCGGACCTGGTCGCTCTTGNATRRRRRRRRRRRRRRRR  got-7.fa
92823  CTCCTTGACACTGGGATAATATNNNNNNNNGGCAGAGCATGGTCGGACCTGGTCGCTCTTGGATRRRRRRRRRRRRRRRR  ler-1.fa
92823  CTCCTTGACACTGGGNNNNNNNNNNNNNNNNNCAGAGCATGGTCGGACCTGGTCGCTCTTGGNNRRRRRRRRRRRRRRRR  lov-5.fa
92823  CTCCTTGACACTGGGATAATATCTGCTAGGGGCAGAGCATGGTCGGACCTGGTCGCTCTTGGATRRRRRRRRRRRRRRRR  nfa-8.fa
92823  CTCCTTGACACTGGGATANNNNNNNNNNGGGGCAGAGCATGGTCGGACCTGGTCGCTCTTGGATRRRRRRRRRRRRRRRR  rrs-10.fa
92823  CTCCTTGACACTGGGATAATATCTGCNAGGGGCAGAGCATGGTCGGACCTGGTCGCTCTTGGATRRRRRRRRRRRRRRRR  rrs-7.fa
92823  CTCCTTGACACTGGGATAATATCTGCTAGGGGCAGAGCATGGTTNNNNNNNNNNNNNCTTGNATRRRRRRRRRRRRRRRR  sha.fa
92823  CTCCTTGACACTGGGANAATATCTGCNAGGGNCNNNNNNNNNNTNNNNNNNNNNNNCCTTGGATRRRRRRRRRRRRRRRR  tamm-2.fa
92823  CTCCTTGACACTGGGATAATATCTGCTAGGGGCAGAGCATGGTCGGACCTGGTCGCTCNTGGATRRRRRRRRRRRRRRRR  ts-1.fa
92823  CTCCTTGACACNGGGATAATANCNNCNNNNNGCAGAGCATGGTCGGACCTGGTCGCTCNTGGATRRRRRRRRRRRRRRRR  tsu-1.fa
92823  CTCCTTGACACTGGGATAATATCTGCTAGGGGCAGAGCATGGTCGGACCTGGTCGCTCTTGGATRRRRRRRRRRRRRRRR  van-0.fa
 
92903  GATCTTAGAGCTTATAGGTAGTAAGAAAGAGGTAAGTTTCTCATATTATGCAGCTTATTCCTAAAGAATGATATTGTACT  chr1.fa
92903  RRRRRTAGAGCTTATAGGTAGTAAGAAAGAGGTAAGTTTCTCATATTNTGCAGCTTATTCCTARRRAATGATATTGTACT  bay-0.fa
92903  RRRRRTNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNN  bor-4.fa
92903  RRRRRTAGAGCTNNNNNNNNNNNNNNNNGNGGNNNNNNNCTCATATTANGNNNNNNATTCNNNRRRNNNNNNNNNNNNNN  br-0.fa
92903  RRRRRTAGAGCTTATAGGTAGTAAGAAAGAGGTAAGTTTCTCATATTATGCAGCTTATTCCTARRRNNTGATATTGTACT  bur-0.fa
92903  RRRRRTAGAGCTTATAGGTAGTAAGAAAGAGGTAAGTTTCTCATATTATGCAGCTTATTCCTNRRRNNNNNTATTGTACT  c24.fa
92903  RRRRRTNNAGCTNNNNNNNNNNNNNAAAGAGGTAAGTTTCTCATATTNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNN  col-0.fa
92903  RRRRRTAGAGCTTATAGGTAGTAAGAAAGAGGTAAGTTTCTCATATTATGCAGCTTATTCCNNRRRNNNNNNANNGTACT  cvi-0.fa
92903  RRRRRTNNAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCANNNNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNN  est-1.fa
92903  RRRRRTAGAGCTTATAGGTAGTAAGAAAGAGGTAAGTTTCTCATATTATGCAGCTTATTCCNNRRRNNNNNTATTGTACT  fei-0.fa
92903  RRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNN  got-7.fa
92903  RRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNN  ler-1.fa
92903  RRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNN  lov-5.fa
92903  RRRRRTAGAGCTTANAGGTAGTAAGAAAGAGGTAAGTTTCTCATATTATGCAGCTTATTCNNNRRRNNNNNNNNNGTACT  nfa-8.fa
92903  RRRRRNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNN  rrs-10.fa
92903  RRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNN  rrs-7.fa
92903  RRRRRTNGAGCTTATAGGTNNNNNNAAAGAGGNAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNN  sha.fa
92903  RRRRRTNNAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNN  tamm-2.fa
92903  RRRRRTNNAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNANNCNNNRRRNNNNNNNNNNNNNN  ts-1.fa
92903  RRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNN  tsu-1.fa
92903  RRRRRTNNAGCTNNNNNNNNNNNNNNNNNNNNTNNGNNNNTCATATTATGCAGCTTNTTNNNNRRRNNNNNNNNNNNNNN  van-0.fa
 
92983  TCTTCAACAGACTTTGACCTCTTATACATGTTTTGTAATTGAATGGGTTTTTGACTTTGCAGATGAGTTTGTATGAAGAT  chr1.fa
92983  TCTTCAACAGACTTTGACCTCTTATACATGTTTTGTNANNNNNNNNGTTTTNNNNNNNNNNNNTGAGTTNNNNNNAAGAN  bay-0.fa
92983  NNNNNAACAGACTTTGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGANNNNNNNGATGNNNNNNNNNNNNNNN  bor-4.fa
92983  NNNTCAACAGACTTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTNNNNNNNGCNGATGAGTTNNNNNNNNNNN  br-0.fa
92983  TCTTCAACAGACTTTGACCTCTTATACATGTTTTGTNNNNNNNNNNGTTTNNNNNNNNGCNGNTGAGTTNNNNNNAAGAT  bur-0.fa
92983  TCTTCAACAGACTTTGACCTCTTATACATGTTTTGTANNNNNNNNNGTTTTTGNCTTTGCNGATGAGTNNNNNNNNNNNN  c24.fa
92983  TCTTCAACAGACTTTGACCTNTNNNNNNNNNNNNNNNNNNNNNNNNGTTTTTGANTTTGCNGATGNNNNNNNNNNNNGAT  col-0.fa
92983  TCTTCAACAGACTTTGACCTCTTATNNNNNNNNNNNNNNNNNNNNNNNTTTTGACTTTGCNGATGAGTNNNNNNNAAGAT  cvi-0.fa
92983  NNNTCAACAGACTTTGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGNNTTTGCNGATGNGNNNNNNNNNNNNN  est-1.fa
92983  TCTTCAACAGACTTTGACCTCTTATACANNNNNNNTNNNNNNNNNNGTTTTTGANTTNGCNGATGAGTTNNNNNNAAGAT  fei-0.fa
92983  NNNNNNNNNGACTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT  got-7.fa
92983  NNNTCAACAGACTTTGACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTGANNNNNNNGNNNNNNNNNNNNNNNNNT  ler-1.fa
92983  NNNNNNNNNNNCTTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
92983  TCTTCAACAGACTTTGACCTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGAGTTNNNNNNAAGAT  nfa-8.fa
92983  NNNNNAACAGACTTTGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNNNGCNGNNGNNNNNNNNNNNAGAT  rrs-10.fa
92983  NCTTCAACAGACTTTGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGANTTNGCNGNNGNGTNNNNNNNNNGAN  rrs-7.fa
92983  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTGANTTNGCNGNNGNGTNNNNNNNNNGAT  sha.fa
92983  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNNNGCNGATGANNNNNNNNNNNNNT  tamm-2.fa
92983  NNNTCAACAGACTTTGACCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGANNNNNNNNNNNNNT  ts-1.fa
92983  NNNNNNNNNGACTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
92983  NNNTCAACAGACTTTGACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNGNNNNNNNNAAGAT  van-0.fa
 
93063  TTGGTGGCTGCTTGGGTTCCTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGGGTGAACTTCTTGTTAACAGTCTGGG  chr1.fa
93063  NNNGTGGCTGCTTNGGNTCNTTCAAGGCATGATTGGCTGCGAACCAGACCTTTNRNTGAACTTCTTGTTAACAGTCTGGG  bay-0.fa
93063  TTGGTGGCTGCTTGGGTTCCTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGRGTGAACTTCTTNNNNNNNGTCTGGG  bor-4.fa
93063  TTGGTGGCTGCTTGGGTTCNTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGRGTGAACTTCTTNNNNNNAGTCTGGG  br-0.fa
93063  TTGGTGGCTGCTNNNNNTCCTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGRGTGAACTTCTTGTTAACAGTCTGGG  bur-0.fa
93063  TTGGTGGCTGCTTGGGTTCNTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGRGTGAACTTCTTGTTAACAGTCTGGG  c24.fa
93063  TTGGTGGCTGNNTGGGTTCNTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGRGNNAACTTCTTNNNNNNAGTCTGGG  col-0.fa
93063  TTGGTGGCTGCTTGGGTTCNTTCAAGGCATGATTGGCNGCGAACCAGACCTTTGRGNGAACTTCTTGTTAACAGTCTGGG  cvi-0.fa
93063  TTGGTGGCTGCTTGGGTTCCTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGRGTGAACTTCTTGNNNNNAGTCTGGG  est-1.fa
93063  TTGGTGGCTGCTTNGGNTCNTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGRGTGAACTTCTTGTTAACAGTCTGGG  fei-0.fa
93063  TTGGTGGCTGCTTGGGTTCCTTCAAGGCATGATTGGCTGCGAACCAGACCTTTNRGTGANNNNNNNNNNNNNNNTCTGGG  got-7.fa
93063  TTGGTGGCTGNNNNNGNTCNTTCAAGGCATGATTGGCTGCGAACCAGACCTTTNRGTGAACTTCTNNNNNNNNGTCTGGG  ler-1.fa
93063  NNGGTGGCTGCTTGGGTTCNTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGRGNNAACNNNNNNNNNNNNGTCTGGG  lov-5.fa
93063  TTGGTGGCTGCTTGGGTTCCTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGRGTGAACTTCTTGTTAACAGTCTGGG  nfa-8.fa
93063  TTGGTGGCTGCTTGGGTTCCTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGRGTGAACTTCTNNNNNNNAGTCTGGG  rrs-10.fa
93063  TTGGTGGCTGCTTNGNTTCCTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGRGNGAACTTCTNNNNNNNAGTCTGGG  rrs-7.fa
93063  TTGGTGGCTGCTTGGGTTCNTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGRGTGAACTTCTTGTTAACAGTCTGGG  sha.fa
93063  TTGGTGGCTGCTTGGGTTCNTTCAAGGCATGATTGGCTGCGAACCAGACCTTNNRGNNAACTTCTTNNNNNNNGTCTGGG  tamm-2.fa
93063  TTGGTGGCTGCTTGGGTTCNTTCAAGGCNTGATTGGCTGCGAACCAGACCTTTGRNNGANNNNNNNNNNNNNNGTNTGGG  ts-1.fa
93063  TTGGTGGNTGCTTGGGTTCCTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGRNNNNANNNNNNNNNNNNNGTCTGGG  tsu-1.fa
93063  TTGGTGGCTGCTTGGGTTCCTTCAAGGCATGATTGGCTGCGAACCAGACCTTTGRGTGAACTTCTTGTTAACAGTCTGGG  van-0.fa
 
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTTTGTACTGATTTCAAGACTAGCTAAACTTAAAAAAAAAGAAATCG  chr1.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTTTGRACTGATTTCAAGACTAGCNANNNNNNNNNNNNNNNNNNNCG  bay-0.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTTNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTTNNRNNNGATTTCAAGACNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTNNNRNCTGATTTCAAGACTNNNNNNNNNNNNNNNNNNNNNNNNCG  bur-0.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTTTGRNCTGATTTCAAGACTAGCNANNNNNNNNNNNNNNNNNNNNN  c24.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTTTNRNNNNNTTTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTTTGRNCNGATTTCAAGACNNNNNNNNNNNNNNNNNNNNNNNNNCG  cvi-0.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTTNNRNNNGATTTCAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTTTGRNCNGATTTCAAGACTAGCNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTTNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
93143  GAGGNAAAAGNNNNACNNNNNNNGCACCTGTANNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTTTGRNCTGATTTCAAGACNNNNNNNNNNNNNNNNNNNNNNNNNCG  nfa-8.fa
93143  GAGNCAAAAGATGTACAGCTACTGCACCTGTATGTTTNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTTNNRNNNGATTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
93143  GAGGCAAAAGATGTACANNNNNNNNNNNNNNNTGTNNNRNCNGATTTCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
93143  GAGGCAAAAGATGTACANNNNNNNNNNNNNNNNNNNNNRNNNGATTTCAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTTTGRNNNGATTTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
93143  GAGGCAAAAGNNNNACAGCTACTGCACCTGTATGTNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
93143  GAGGCAAAAGATGTACAGCTACTGCACCTGTATGTTTNRNNTGATTTCAAGANNNNNNNNNNNNNNNNNNNNNNNNNNCG  van-0.fa
 
93223  AGATTGCTATGCTTACTTTTCTAATCTCTTTGTATCATCTTGTGTCAGATGATTTGCAGTTTTTGCATTTTGGAACATCA  chr1.fa
93223  AGATTGCTATGCTTACTTTTCTAATCTCTTTGTNTCATCTTGTNNNNGATGATTTGCNGTTTTNNNNNNTTGGAACATCA  bay-0.fa
93223  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGATGNTTNGCNGTTTTTGCATTTTGGAACATCN  bor-4.fa
93223  NNNNNNCTNTGNTTNNNNNNNNNNNNNNNNNNNNTCATNNNNNNNNAGATGNTTNGCNGTTTTTGCATTTTGGAACATCA  br-0.fa
93223  AGATTGCTATGCTTACTTTTCTAATCTCTTTGTATCATCTTGNGTCAGATGATTTGCNGTTTTTGCATTTTGGAACATCA  bur-0.fa
93223  NNNNNNNNNCNNNNNNNTTTCTAATCTCTTTGTATCATCTTGNGTCAGATGATTTGCNGTTTTTGCATTTTGGAACATCA  c24.fa
93223  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNTCAGATGNTTNGCNGTTTTTGCATTTTGGAACATCA  col-0.fa
93223  AGATTGCTATGCTTACTTTTCNNNNNNNNTNGTNTCATCTTGTGTCAGATGATTTGCNGTTTTTGCATTTTGGAACATCA  cvi-0.fa
93223  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGATTTGCNGTTTTTGCNTTTTGGAACATCA  est-1.fa
93223  NNATTGCTATGCTTACTTTTCTNATCTCTTTGTATCATCTTGTNTCAGATGATTTGCNGTTTTTGCATTTTGGAACATCA  fei-0.fa
93223  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATTTGCNGTTTTTGCATTNTGGAACATCN  got-7.fa
93223  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNTTNGCNGTTTTTGCATTTTGGAACATCA  ler-1.fa
93223  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTTTGCATTTTGGAACATCA  lov-5.fa
93223  AGATTGCTATGCTTNCTTTNNNNNNNNNNNNNTATCATCTTGNGTCAGATGATTTGCNGTTTTTGCATTTTGGAACATCA  nfa-8.fa
93223  NNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATGATTTGCNGTTTTTGNATTTTGGAACATCA  rrs-10.fa
93223  NNNNNNNNNNGNTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNGATGATTTGCNGTTTTTGCATTTTGGAACATCA  rrs-7.fa
93223  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGATTTGCNGTTTTTGCATTTTGGAACATCA  sha.fa
93223  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNTNNGCNGTTTTTGCNTTTTGGAACATCA  tamm-2.fa
93223  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTTTGCATTTTGGAACATCA  ts-1.fa
93223  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGCNGTTTTTGCATTTTGGAACATCA  tsu-1.fa
93223  AGATTGCTATGNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTGTGTCAGATGNTTTGCAGTTTTTGCATTTTGGAACATCA  van-0.fa
 
93303  AGTGAGGTATTGGATCATTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  chr1.fa
93303  AGTGAGGTATTGGATCATTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  bay-0.fa
93303  AGTGAGGTATTNNNNNNTTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  bor-4.fa
93303  AGTGAGGTATTGGATCATTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  br-0.fa
93303  AGTGAGGTATTGGATCATTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  bur-0.fa
93303  AGTGAGGTATTGGATCATTTAAGCGGNGATGCTTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  c24.fa
93303  AGTGAGGTNTTGGATCATTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  col-0.fa
93303  AGTGAGGTATTGGATCATTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGAGNCACTTATGTTCCATCCCTGCAACTAC  cvi-0.fa
93303  AGTGAGGTATTGGATCATTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  est-1.fa
93303  AGTGAGGTATTGGATCATTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGAGNCACTTATGTTCCATCCCTGCAACTAC  fei-0.fa
93303  AGTGAGNNNNNNNNNNNTTTAAGCGGGGATGCTTCNGGAATTGTTGGTCGGAGACACTTATGTTCCATCNCTGCAACTAC  got-7.fa
93303  AGTGAGGTATTGGATCATTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGNGNNNNNNNNGTTCCATCCCTGCAACTAC  ler-1.fa
93303  NNNGNNNNNNNNNNNNATTTAAGCGGGGATGCTTCAGGAATTGTTGGTNNNNNNNNNNNNNGTTCCATCCCTGCAACTAC  lov-5.fa
93303  AGTGAGGTATTGGATCATTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  nfa-8.fa
93303  AGTGAGGTNTTGGATCATTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  rrs-10.fa
93303  AGTGAGGTNTTGGATCATTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  rrs-7.fa
93303  AGTGAGGTATTGGATCATTTAAGNNNNNNNNNTTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  sha.fa
93303  AGTGAGGNNNNNGATCNNNNNNNNNNNNNNNNNTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  tamm-2.fa
93303  AGNGANGTNTTGGATCATTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  ts-1.fa
93303  AGTGNNNNNNNNNNNNNNNTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGANNNNNTTATGTTCCATCCCNGCAACTAC  tsu-1.fa
93303  AGTGAGGTATTGGATCATTTAAGCGGGGATGCTTCAGGAATTGTTGGTCGGAGACACTTATGTTCCATCCCTGCAACTAC  van-0.fa
 
93383  GGTTTCTGATATTGCAGCATCTTCCGTTATTTTGTCTAGTGAAATTGCACCTGGTGTCTCCATTGGTGAAGATTCACTTA  chr1.fa
93383  GGTTTCTGATNTTGCAGCATCTTCCGTTATTTTGTCTAGTGAAATTGCACCTGGTGTCTCCATTGGTGAAGATTCACTTA  bay-0.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTNNNNNNNNNNGTGAAATTGCACCTGGTGTCTCCATTGGTGAANNNNNNNNNN  bor-4.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTNTTTTGTCTAGTGAAATTGCACCTGGTGTCTCCATTGGTGAAGANNNNNNNN  br-0.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTATTTTGTCTAGTGAAATTGCACCTGGTGTCTCCATTGGTGAAGATTCACTTA  bur-0.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTATTTTGTCTAGTGAAATTGCACCTGGTGTCTCCATTGGTGAAGATTCACTTA  c24.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTNTTTTGTNTAGTGAAATTGCACCTGGTGTCTCCATTGGTGAAGNNNNNNNNN  col-0.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTATTTTGTCTAGTGAAATTGCACCTGGTGTCTCCATTGGTGAAGATTCACTNN  cvi-0.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTATNNTGTCTAGTGAAATTGCACCTGGTGTCTCCATTGGTGAANNNNNNNNNN  est-1.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTATTTTGTCTAGTGAAATTGCACCTGGTGTCTCCATTGGTGAAGATTCACTTA  fei-0.fa
93383  GGTTTCTGATNTTGCAGCATCTTCCGTTATTTNNNNNNNNNAAATTGCACCTGGTGTCTCCATTGGTGAANNNNNNNNNN  got-7.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTATTTTGTCTNGTGAAATTGCACCTGGTGTCTCCATTGGTGAAGANNNNNNNN  ler-1.fa
93383  GGTTTCTGATNTTGCAGCATCTTCCNNNNNNNNNNNNNGTGAAATTGCACCTGGTGTCTCCATTGGTGNNNNNNNNNNNN  lov-5.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTATTTTGTCTAGTGAAATTGCACCTGGTGTCTCCATTGGTGAAGATTCACTNN  nfa-8.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTATTTTGTCTAGTGAAATTGCACCTGGTGTCTCCATTGGTGAANNNNNNNNNN  rrs-10.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTNTTTTGTCTAGTGAAATTGCACCTGGTGTCTCCATTGGTGAANNNNNNNNNN  rrs-7.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTATTTTGTCTAGTGAAATTGCACCTGGTGTCTCCATTGGTGAAGATTCACTTA  sha.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTATTTTGNNNNNNGAAATTGCACCTGGTGTCTCCATTGGTGAANNNNNNNNNN  tamm-2.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTNTTTTGTCTNGTGAAATTGCACCTGGTGTCTCCATTGGTGAAGNNNNNNNNN  ts-1.fa
93383  GGTTTCTGNTNTTGCAGCATCTTCCGTNNNNNNNNNNNNNGAAATTGCACCTGGTGTCTCCATTGGTGNNNNNNNNNNNN  tsu-1.fa
93383  GGTTTCTGATATTGCAGCATCTTCCGTTATTTTGTCNAGTGAAATTGCACCTGGTGTCTCCATTGGTGAANNNNNNNNNN  van-0.fa
 
93463  TATATGATTCAACAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  chr1.fa
93463  TATATGATTCANNNNNNTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  bay-0.fa
93463  NNNNNNNNNNNACAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  bor-4.fa
93463  NNNNNNNNNNNACAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  br-0.fa
93463  TANATGATTCAACNGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  bur-0.fa
93463  TATATGATTCAACAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  c24.fa
93463  NNNNNNNNNNNACAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  col-0.fa
93463  NNNNNNNNTCNACNGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  cvi-0.fa
93463  NNNNNNNNNNNNCAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  est-1.fa
93463  TNNNNNNNTCAACAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  fei-0.fa
93463  NNNNNNNNNNNNNAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  got-7.fa
93463  NNNNNNNNNNNACAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  ler-1.fa
93463  NNNNNNNNNNNNNNGTNTCNGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  lov-5.fa
93463  NNNNNNNTTCAACAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  nfa-8.fa
93463  NNNNNNNNNNNNCAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  rrs-10.fa
93463  NNNNNNNNNNNACAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  rrs-7.fa
93463  NNNNNNATTCAACAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  sha.fa
93463  NNNNNNNNNNNNCAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  tamm-2.fa
93463  NNNNNNNNNNNACAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  ts-1.fa
93463  NNNNNNNNNNNNNAGTTTCTGGTGCTGNACAAATTGGTTCTCAGTCCATAGTTGTTGNTATTCACATCCCGAGCGAAGAT  tsu-1.fa
93463  NNNNNNNNNNAACAGTTTCTGGTGCTGTACAAATTGGTTCTCAGTCCATAGTTGTTGGTATTCACATCCCGAGCGAAGAT  van-0.fa
 
93543  CTTGGAACTCCAGAGAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGGTCCCACTAGTGGGACATAAGGG  chr1.fa
93543  CTTGGAACTCCAGAGAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGNNNNNNNNNNNNNNNNNNCATAAGGG  bay-0.fa
93543  CTTGGAACTCCAGAGAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGGNNNNNNNNNNNNNNCATAAGGG  bor-4.fa
93543  CTTGGAACTCCAGAGAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGGNNNNNNNNNNNNNNCATAAGGG  br-0.fa
93543  CTTGGAACTNCAGAGAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGGNNNNNNNNNNNNNNCATAANGG  bur-0.fa
93543  CTTGGAACTCCAGAGAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGNNNNNNNNNNNNNNNCATAAGGG  c24.fa
93543  CTTGGAACNNNNNNGAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGGNNNNNNNNNNNNNNNATAAGGG  col-0.fa
93543  CTTGGAACTCCAGAGAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGGNNNNNNNNNNNNNACATAAGGG  cvi-0.fa
93543  CTTGGAANTNCAGAGAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGNNNNNNNNNNNNNNNCATAAGGG  est-1.fa
93543  CTTGGAACTCCAGAGAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGGTNNNNNNNNNNNNNCATAAGGG  fei-0.fa
93543  CTTGGNNNNNNNNNNNNNTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGGTCNNNNNNNNNNNNNNNNAGGN  got-7.fa
93543  CTTGGANNNNNNNNNNNTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
93543  CTTGNNNNNNNNNNNNNNNTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
93543  CTTGGAACTCCNGAGAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGNNNNNNNNNNNNNNNCATAAGGG  nfa-8.fa
93543  CTTGGAACTCCAGAGAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGNNNNNNNNNNNNNNNNNNNNNNG  rrs-10.fa
93543  CTTGGNNNNNNNNNGAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGNNNNNNNNNNNNNNNNATAAGGG  rrs-7.fa
93543  CTTGGAANNNNNNNNNNNNGNNNNNNNNTGCTTCCGGATAGGCATTGTCTTTNGGAGNNNNNNNNNNNNNNNNNTAAGGG  sha.fa
93543  CTTGGANNNNNNNNNNNNNGNNNNNNNNNNCTTCCGGATAGGCATTGTCTTTGGGNNNNNNNNNNNNNNNNNNNNNAGGG  tamm-2.fa
93543  CTTGNNNNNNNNNNNNGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGNNNNNNNNNNNNNNNNATAAGGG  ts-1.fa
93543  CTTGGNNNNNNNNNNAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGANNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
93543  CTTGGAACTCCAGAGAGTTTCAGGTTCATGCTTCCTGATAGGCATTGTCTTTGGGAGGTNNNNNNNNNNNNNCATAAGGG  van-0.fa
 
93623  AAGAGTGATTGTGTATTGTGGTCTCCATGACAATCCAAAGAACTCAATTCATAAAGATGGAACTTTTTGCGGTAAACCCT  chr1.fa
93623  AAGAGTGATTGNNNNNNGTGGTCTCCATGACAATCCAAAGAACTCAATTCATAAAGATGGAACTTTTTGCGGTAAACNCT  bay-0.fa
93623  AAGAGTGATTGTGTATTGTGGTCTCCATGACAATCCAAANNNNNNNNNNNNNNNNNNNNNAACTTTTTGCGGTAAACCCT  bor-4.fa
93623  AAGAGTGATTGTGTATTGTGGTCTCCATGACAATCCAAAGANNNNNNNNNNNNNNNNNGGAACTTTTTGCGGTAAACCCT  br-0.fa
93623  AAGAGTGATTGTGNATTGTGGTCTCCATGACAATCCAAAGAACTCAATTCATAAAGATGGAACTTTTTGCGGTAAACCCT  bur-0.fa
93623  AAGAGTGATTGNNNNNNGTGGTCTCCATGACAATCCAAAGAACTCNNNNNNTAAAGATGGAACTTTTTGCGGTAAACCCT  c24.fa
93623  AAGAGTGATTGTGTNTTGTGGTCTCCATGACAATCCAAANNNNNNNNNNNNNNNNNNNNGAACTTTTTGCGGTAAACCCT  col-0.fa
93623  AAGAGTGATTGTGTNTTGTGGTCTCCATGACAATCCAAAGAACTCAATNCANAANGATGGAACTTTTTGCGGTAAACCCT  cvi-0.fa
93623  AAGAGTGATTGTGTNTTGTGGTCTCCATGACAATCCAAAGAACNNNNNNNNNNNNNNNGGAACTTTTTGCGGTAAACCCT  est-1.fa
93623  AAGAGTGATTGTGTATTGTGGTCTCCATGACAATCCAAAGAACTCANTNCATAAAGATGGAACTTTTTGCGGTAAACCCT  fei-0.fa
93623  NNNNNNNNNNNNNTNTTGTGGTCTCCATGACAANCNNNNNNNNNNNNNNNNNNNNNNNNNAANTTTTTGCGGTAAACCCT  got-7.fa
93623  NNNNNNNNNNNNNNNNNGTGGTCTCCATGACAATCCAAAGANNNNNNNNNNNNNNNNNNGAACTTTTTGCGGTAAACCCT  ler-1.fa
93623  NNNNNNNNNNNNNNNNNGTGGTCTCCATGACAANCNNNNNNNNNNNNNNNNNNNNNNNNNNANTTTTTGCGGTAAACCCT  lov-5.fa
93623  AAGAGTGATTGTGTNTTGTGGTCTCCATGACAATCCAAAGAACTCAATTCANAAAGATGGAACTTTTTGCGGTAAACCCT  nfa-8.fa
93623  AAGAGTGATTGTGTNTTGTGGTCTCCATGACAATCCAAANNNNNNNNNNNNNNNNNNNNGAACTTTTTGCGGTAAACCCT  rrs-10.fa
93623  AAGAGTGATTGNNNNNNGTGGTCTCCATGACAANCNNNNNNNNNNNNNNNNNNNNNNNNGAACTTTTTGCGGTAAACCCT  rrs-7.fa
93623  AAGAGTGATTGTGTNTTGTGGTCTCCATGACAATCCAAAGAACTCAATNNNNNNNNATGGAACTTTTTGCGGTAAACCCT  sha.fa
93623  AAGAGTGATTGNGTATTGTGGTCTCCATGACAATCCAAAGAACNNNNNNNNNNNNNNNNGAACTTTTTGCGGTAAACCCT  tamm-2.fa
93623  AAGAGTGATTGTGTNTTGTGGTCTCCATGACAATCCAAAGNNNNNNNNNNNNNNNNNNNGAACTTTTTGCGGTAAACCCT  ts-1.fa
93623  NNNNNNNNNNNNNNNNNGTGGTCTCCATGACAATCCNNNNNNNNNNNNNNNNNNNNNNNNNANTTTTTGCGGTAAACCCT  tsu-1.fa
93623  AAGAGTGATTGTGTNTTGTGGTCTCCATGACAATCCAAAGAACNNNNNNNNNNNNNNNGGAACTTTTTGCGGTAAACCCT  van-0.fa
 
93703  TGGAGAAGGTATTGTTTGATCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  chr1.fa
93703  TGGAGAAGGTNTTGTTTGATNTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  bay-0.fa
93703  TGGAGAANNNNNNNNNTGATCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGNTGTTTGTGG  bor-4.fa
93703  TGGAGAAGGTNTTGTTTGATCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  br-0.fa
93703  TGGAGAAGGTNTTGTTTGATCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  bur-0.fa
93703  TGGAGAAGGTNTTGTTTGATCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  c24.fa
93703  TGGAGAAGNNNNNNTTTGATCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  col-0.fa
93703  TGGAGAAGGTNTTGTTTGATCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  cvi-0.fa
93703  TGGAGAAGGTNTTGTTTGATCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  est-1.fa
93703  TGGAGAAGGTATTGTTTGATCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  fei-0.fa
93703  TGNNNNNNNNNNNNNNNNNNCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGANNNNNNTTTGTGG  got-7.fa
93703  TNNNNNNNNNNNNNNTTGATCTTGGCATTGAGGAAAGCGACCTCTGNAGCTCGTATGTTGCACAAGATAGNTGTTTGTGG  ler-1.fa
93703  TGNNNNNNNNNNNNNNNNNTCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACNNNNNNNNNNNNTGTGG  lov-5.fa
93703  TGGAGAAGGTATTGTTTGATCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  nfa-8.fa
93703  TGGAGAANNNNNNNNTTGNTCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  rrs-10.fa
93703  TGGAGANNNNNNNNTTTGATCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  rrs-7.fa
93703  TGGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  sha.fa
93703  TGGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  tamm-2.fa
93703  TGGAGAAGNNNNNNNTTGATCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  ts-1.fa
93703  TGGNNNNNNNNNNNTNNNNNCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACANNNNANNNNNNNNNGG  tsu-1.fa
93703  TGGAGAAGGTNTTGTTTGATCTTGGCATTGAGGAAAGCGACCTCTGGAGCTCGTATGTTGCACAAGATAGATGTTTGTGG  van-0.fa
 
93783  AATGCAAAACTGTTCCCGATTCTTACGTATAGTGAAATGCTGAAGTTAGCGTCGTGGTTGATGGGTTTAGATGATAGTAG  chr1.fa
93783  AATGCAAAANTGTTCCCGATTCTTACGTATAGTGAAATGCTGAAGTTAGCGTCGTGGTTGATGGGTTTNGATGATAGTAG  bay-0.fa
93783  AATGCAAAACTGTTCCCGATTCTTACGNNNNNNGAAATGCTGAAGTTAGCGTCGTGGTTGATGGGTTNNNNNNNNNNNNN  bor-4.fa
93783  AATGCAAAACTGTTCCCGATTCTTACGTATAGTGAAATGCTGAAGTTAGCGTCGTGGTTGATGGGTTTNGNNGNNNNNAN  br-0.fa
93783  AATGCAAAACTGTTCCCGATTCTTACGTATAGTGAAATGCTGAAGTTNGCGTCGTGGTTGATGGGTTTNGATGATAGTAG  bur-0.fa
93783  AATGCAAAACTGTTCCCGATTCTTACGTATAGTGAAATGCTGAAGTTAGCGTCGTGGTTGATGGGTTTNGATGATAGTAG  c24.fa
93783  AATGCAAAACTGTTCCCGATTCTTACGNATAGTGAAATGCTGAAGTTAGCGTCGTGGTTGATGGGNNNNNNNNNNNNNNN  col-0.fa
93783  AATGCAAAACTGTTCCCGATTCTTACGTATAGTGAAATGCTGAAGTTAGCGTCGTGGTTGATGGGTTTAGATGATAGNAG  cvi-0.fa
93783  AATGCAAAACTGTTCCCGATTCTTACGTATAGTGANATGCTGAAGTTAGCGTCGTGGTTGATGGGTTNNNNNNNNNNNNN  est-1.fa
93783  AATGCAAAACTGTTCCCGATTCTTACGTATAGTGAAATGCTGAAGTTNGCGTCGTGGTTGATGGGTTTAGATGATAGTAG  fei-0.fa
93783  AATGCAAAACTGTTCCCGATTNNNNNNNNNNNNNNNNNNNTGAAGTTAGCGTCGTGGTTGATGGGNNNNNNNNNNNNNNN  got-7.fa
93783  AATGCAAAACTGTTCCCGATTCTTNNNNNNNNTGAAATGCTGAAGTTAGCGTCGTGGTTGATGGGTTNNNNNNNNNNNNN  ler-1.fa
93783  AATGCAAAACTGTTCCCGATTCTNNNNNNNNNNNNNNNNCTGAAGTTAGCGTCGTGGTTGATGGGNNNNNNNNNNNNNNN  lov-5.fa
93783  AATGCAAAACTGNTNNNANNNNNNNNNNNNAGTGAAATGCTGAAGTTAGCGTCGTGGTTGATGGGTTTNGATGATAGNAG  nfa-8.fa
93783  AATGCAAAACTGTTCCCGATTCTTANGTATAGTGAAATGCTGAAGTTAGCGTCGTGGTTGATGGGTTTAGANNNNNNNNN  rrs-10.fa
93783  AATGCAAAACTGTTCCCGATTCNNNNNNATAGTGAAATGCTGNAGTTAGCGTCGTGGTTGATGGGNNNNNNNNNNNNNNN  rrs-7.fa
93783  AATGCAAAACTGTTCCCGATTCTTACGTATAGTGAAATGCTGAAGTTAGCGTCGTGGTTGATGGGTTTNGATGATAGTAG  sha.fa
93783  AATGCAAAACTGTTCCCGATTCTTANGNNTNGTGAAATGCTGAAGTTAGCGTCGTGGTTGATGGGTTNNNNNNNNNNNNN  tamm-2.fa
93783  AATGCAAAACTGTTCCCGATTCNTACGTATNGTGAAATGCTGAAGTTNGCGTCGTGGTTGATGGGTTTNGANNNNNNNNN  ts-1.fa
93783  NATGCAAAACTGTTCCCGATTNNNNNNNNNNNNNNNANGCTGAAGTTAGCGTCGTGGTTGATGGGNNNNNNNNNNNNNNN  tsu-1.fa
93783  AATGCAAAACTGNTNNNANNNNNNNNNNNTAGTGAAATGCTGAAGTTAGCGTCGTGGTTGATGGGTTTNGANGNNNNNNN  van-0.fa
 
93863  AAACAAGGAGAAGATTAAGTTGTGGAGAAGCTCACAACGTGTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  chr1.fa
93863  AAACAAGGAGAAGNNNNNNTTGTGGAGAAGCTCACAACGTGTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  bay-0.fa
93863  NNNNNNNNNNNNNNNNNNNNTGTGGAGAAGCTCACAACGNGTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  bor-4.fa
93863  NNNNNNNNAGAAGATTAAGTTGTGGAGAAGCTCACAACGTGTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  br-0.fa
93863  AAACAAGGAGAAGATTNAGTTGTGGAGAAGCTCACAACGTGTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  bur-0.fa
93863  AAACAAGGAGAAGATTAAGTTGTGGAGAAGCTCACAACGTGTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  c24.fa
93863  NNNNNNNNNNNANNNNNNNTTGTGGAGAAGCTCACAACGTGTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  col-0.fa
93863  AAACAAGNAGAAGATTAAGTTGTGGAGAAGCTCACAACGTGTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  cvi-0.fa
93863  NNNNNNNNNNNAGATTAAGTTGTGGAGAAGCTCACAACGTGTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  est-1.fa
93863  AAACAAGNAGAAGATTAAGTTGTGGAGAAGCTCACAACGTGTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  fei-0.fa
93863  NNNNNNNNNNANGANNNAGTTGTGGAGAAGCTCACNNNNNNTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  got-7.fa
93863  NNNNNNNNNNNNNNNNNNNTTGTGNNNNNNNTCACNNNNNNNNAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  ler-1.fa
93863  NNNNNNNNNNNNNNNNNNNNNGTNNNNNNNNTCACANNNNNNNNNNNNNGAAGAGTTGCATGGATCAATCAACTTTCCTG  lov-5.fa
93863  AAACAAGNAGAAGATTAAGTTGTGGAGAAGCTCACAACGTGTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  nfa-8.fa
93863  NNNNNNNNAGAAGATTAAGTTGTGGAGAAGCTCACAACGTGTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  rrs-10.fa
93863  NNNNNNNNNNNANNNNNNNNTGTGGAGAAGCTCACAACGTGTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  rrs-7.fa
93863  AAACAAGNAGNNNNNNNNNNNNNNNNNNNGCTCACAACGTGTAAGCTTAGAAGAGTTNNNCNNNNNNATCAACTTTCCTG  sha.fa
93863  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCACAACNNNNNAGCTTAGAAGNGNNNNNCNNNNNNNTCAACTTTCCTG  tamm-2.fa
93863  NNNNNNNNAGNNNNNNNNNTNGTGGAGAAGCTCACAACNNNNNANCTNAGAAGAGTTGCATGGATCAATCAACTTTCCTG  ts-1.fa
93863  NNNNNNNNNNNNNNNNNNNNTGTGGAGANGCTCACANNNNNNNNNCTTAGAAGAGTTGCATGGANCAATCAACTTTCCTG  tsu-1.fa
93863  NNNNNNNNNNNAGATTAAGTTGTGGAGAAGCTCACAACGTGTAAGCTTAGAAGAGTTGCATGGATCAATCAACTTTCCTG  van-0.fa
 
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTGATCTTGCGGGTGGAATCGCTAAAGCATGTATGAACTATGGTATGCTT  chr1.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTGATCTTGCGGGTGGAATCGCTAAAGCATGTATGAACTATGGTATGCTT  bay-0.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTGATCTTGCGGGTGGAATCGCTAAAGCATGTATGAACTATGGTATGCTT  bor-4.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTGATCTTGCGGGTGGAATCGCTAAAGCATGTATGAACTATGGTATGCTT  br-0.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTGATCTTGCGGGTGGAATCGCTAAAGCATGTATGAACTATGGTATGCTT  bur-0.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTGATCTTGCGGGTGGAATCGCTAAAGCATGTATGAACTATGGTATGCTT  c24.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTGATCTTGCGGGTGGAATCGCTAAAGCATGTATGAACTATGGTATGCTT  col-0.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTGATCTTGCGGGTGGAATCGCTAAAGCATGTATGAACTATGGTATGCTT  cvi-0.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTNATCTTGCGGGTGGAATCGCTAAAGCATGTATGAACTATGGTATGCTT  est-1.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTGATCTTGCGGGTGGAATCGCTAAAGCATGTATGAACTATGGTATGCTT  fei-0.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTGATCTTGCGGGTGGAATCGCTAAAGCATGTATGANNNNNNGTATGCTT  got-7.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCANGCTGATCTTGCGGGTGGAATCGCTAAAGCATGNNNNNACTATGGTATGCTT  ler-1.fa
93943  AGATGTGCAATGGTTCCAGCAATCNNNNNNNNGATCTTGCGGGTGGAATCGCTAAAGCNTNNNNNNNNNNNGGTATGCTT  lov-5.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTGATCTTGCGGGTGGAATCGCTAAAGCATGTATGAACTATGGTATGCTT  nfa-8.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTNATCTTGCGGGTGGAATCGCTAAAGCANNNNNNNNCTATGGTATGCTT  rrs-10.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTGATCTTGCGGGTGGAATCGCTAAAGCATGTATGAACTATGGTATGCTT  rrs-7.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTNNNNNNNNNNCNNNAATCGCTAAAGCATGTATGAACTATGGTATGCTT  sha.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGNNNNNNNNNNNNCNGGAATCGCTAAAGCATGTATGAACTATGGTATGCTT  tamm-2.fa
93943  AGATGTGCAATGGTTCCAGCAATCANCAAGCTGATCTTGCGGGTGGAATCGCTAAAGCATGTATGANCTATGGTATGCTT  ts-1.fa
93943  AGATGTGCAATGGTTCCAGCAATCANNNNNCTGATCTTGCGGGTGGAATCGCTAAAGNATGTNNNNNNNNNGGTATGCTT  tsu-1.fa
93943  AGATGTGCAATGGTTCCAGCAATCATCAAGCTGATCTTGCGGNTGGAATCGCTAAAGCATGTATGAACTATGGTATGCTT  van-0.fa
 
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTACAGAAAGAGTCATTAGGATTGGAAATATGCAAGAATTTTCTGGA  chr1.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTNCAGAAAGAGTCATTAGGATTGGAAATATGCAAGAATTTTCTGGA  bay-0.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTACNNNNNNNNNNNNNNGNNTNGNNANNNNGCAAGAATTTTCTGGA  bor-4.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTACAGANAGAGTCATTAGGATTGGAAATATGCAAGAATTTTCTGGA  br-0.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTACAGAAAGAGTCATTAGGATTGGAAATATGCAAGAATTTTCTGGA  bur-0.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTACAGAAAGAGTCATTAGGATTGGAAATATGCAAGAATTTTCTGGA  c24.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTNCANANNNNNNNANTAGGATTGGAAATATGCAAGAATTTTCTGGA  col-0.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTNCAGAAAGAGTCATTAGGATTGGAAATATGCAAGAATTTTCTGGA  cvi-0.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTACAGANNNNNNNNNTAGGATTGGAAANATGCAAGAATTTTCTGGA  est-1.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTACAGAAAGAGTCATTAGGATTGGAAATATGCAAGAATTTTCTGGA  fei-0.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTNNNNNNNNNNNNNNNNNNNNATTGGNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTNNNNNNNNNNNNNNNNNNNGNTTGGAAANATNCAAGAATTTTCTGGA  ler-1.fa
94023  GGGCGTAATTTGTCTCAGCTNTGCCATGAGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTGGA  lov-5.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTACAGAAANAGTCATTAGGATTGGAAATATGCAAGAATTTTCTGGA  nfa-8.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTNNNNNNNNNNNNNNNNNNNATTGGAAATATNCANGANTTTTCTGGA  rrs-10.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTNNNNNANNNNNNNATTAGGATTGGAAANANNCNAGAATTTTCTGGA  rrs-7.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTACANNNNNNNNNNNNNNNNNNNNAAATATGCAAGAATTTTCTGNN  sha.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAATTTTCTGGN  tamm-2.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTNCNNNNNNNNNNNTTAGGATTGGANNNNNNNAAGAATTTTCTGGA  ts-1.fa
94023  GGGCGTAATTTGTCTCANNNNNNCCATGAGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
94023  GGGCGTAATTTGTCTCAGCTGTGCCATGAGATTTTACAGNNNNNNNCATTAGGATTGGAAATATGCAAGAATTTTCTGGA  van-0.fa
 
94103  TCAATGTCCCAAATTTCAGGAGCAGAACTCCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  chr1.fa
94103  TCAATGTCCCAAATTTCAGGAGCAGAACTCCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  bay-0.fa
94103  TCAATGTCCCAAATTTCAGGAGCAGAACTCCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  bor-4.fa
94103  TCAATGTCCCAAATTTCAGGAGCAGAACTCCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  br-0.fa
94103  TCAATGTCCCAAATTTCAGGAGCAGAANTCCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  bur-0.fa
94103  TCAATGTCCCAAATTTCAGGAGCAGAACTCCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  c24.fa
94103  TCNATGTCCCAAATTTCAGGAGCNNNNNNNCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  col-0.fa
94103  TCAATGTCCCAAATTTCAGGAGCAGAANTCCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  cvi-0.fa
94103  TCAATGTCCCAAATTTCAGGAGCANAACTCCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  est-1.fa
94103  TCAATGTCCCAAATTTCAGGAGCAGAACTCCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  fei-0.fa
94103  NNNNTGTCCCAAATTTCAGGAGCANAACTCCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  got-7.fa
94103  TCAATGTCCCAAATTTCAGGAGCNNNNNNNNAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGANNNNNATCTTCTTC  ler-1.fa
94103  TCANTGTCCCAAATTTCANNNNNNNNNNNNNAAAANNNNNCCAAAGAGTCGAGCATACCAGGTNNNNNNNNNNCTTCTTC  lov-5.fa
94103  TCAATGTCCCAAATTTCAGGAGCAGAACTCCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  nfa-8.fa
94103  TCNATGTCCCAAATTTCAGGAGCAGAACTCCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  rrs-10.fa
94103  TCAATGTCCCAAATTTCAGGAGCAGAACTCCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  rrs-7.fa
94103  NNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  sha.fa
94103  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCAAAGAGTCGAGCATACCAGGTAGANGTTGATCTTCTTC  tamm-2.fa
94103  TCAATGTCCCAAATTTCAGGAGCANNNNNNNAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  ts-1.fa
94103  TNAATGTCCCAAATTTCAGGANNNNNNNNNNAAAATNCTTCCAAAGAGTCGAGCATACCAGGTNNNNNNNNNNNTTCTTC  tsu-1.fa
94103  TCAATGTCCCAAATTTCAGGAGCAGAACTCCAAAATTCTTCCAAAGAGTCGAGCATACCAGGTAGAAGTTGATCTTCTTC  van-0.fa
 
94183  GAGCATGTGGGGATGAAGCAAAAGCTATAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGCAGAAGAAACTGCTTCAGCT  chr1.fa
94183  GAGCATGTGGGGATGAAGCAAAAGCTATAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGNAGAAGAAACTGCTTCAGCT  bay-0.fa
94183  GAGCATGTGGGGATGAAGCANNNNNNNNAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGCAGANGAAACTGCTTCAGCT  bor-4.fa
94183  GAGCATGTGGGGATGAAGCAAAAGCTATAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGCAGAAGAAACTGCTTCAGCT  br-0.fa
94183  GAGCATGTGGGGATGAAGCAAAAGCTATAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGCAGAAGAAACTGCTTCAGCT  bur-0.fa
94183  GAGCATGTGGGGATGAAGCAAAAGCTATAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGCAGAAGAAACTGCTTCAGCT  c24.fa
94183  GAGCATGNGGGGATGAAGCAAAAGCTATAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGCAGAAGAAACTGCTTCAGCT  col-0.fa
94183  GAGCATGTGGGGATGAAGCAAAAGCTATAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGCAGAAGAAACTGCTTCAGCT  cvi-0.fa
94183  GAGCATGTGGGGATGAAGCAAAAGCTATAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGCAGANGAAACTGCTTCAGCT  est-1.fa
94183  GAGCATGTGGGGATGAAGCAAAAGCTATAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGCAGAAGAAACTGCTTCAGCT  fei-0.fa
94183  GAGCATGTGGGGATGAAGCAAAAGNTATAGAGTNGGAGCATAAAGTATGGGGAGCAGTTGCAGAAGAAACTGCTTCAGCT  got-7.fa
94183  GAGCATGTGGGGATGAAGCAAAAGCNATAGAGTTGGAGCATAAAGTATGGGGAGCAGNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
94183  GAGCATGTGGGGATGAAGCAANNNNNNNAGAGTTGGAGCANAAAGTATGGGGAGCAGNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
94183  GAGCATGTGGGGATGAAGCAAAAGCTATAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGCAGAAGAAACTGCTTCAGCT  nfa-8.fa
94183  GAGCATGTGGGGATGAAGCAAAAGCTATAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGCAGANGAAACTGCTTCAGCT  rrs-10.fa
94183  GAGCATGTGGGGATGAAGCAAAAGCTATAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGCAGAAGAAACTGCTTCAGCT  rrs-7.fa
94183  GAGCATGTGGGGATGAAGCAAAAGCTATAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGNNNNNGAAACTGCTTCNGCT  sha.fa
94183  GAGCATGTGGGGATGAAGCAAAAGCNATAGAGTTGGAGCATAAAGTATGGGGAGCAGTTGCAGAAGAAACTGNNNNNGCT  tamm-2.fa
94183  GAGCATGTGGNGATGAAGCAAAAGCNATAGAGTTGGAGCANAAAGTATGGGGAGCAGTTG