Arabidopsis SNP Sequence Viewer

Chromosome : chr2 Coordinates : 17005214 - 17005419


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
17005214  ACTTTCATGTTTCTTTTGCCTTTTGGTCTACATTTTTTTTAACTCCATAAAGGGGAGAGGTGGGTTGAACCAGTTACATG  chr2.fa
17005214  ACTTTCATGNNNNNNNNNNNTTTTGGTCTNCATTTTTTTTANNNNNNNNNNNNNNNNAGGTGGNTTGAACCAGTTACATG  bay-0.fa
17005214  ACTTTCATGTNTCTTTNGCCTTTTGGTCTNCATTTTTNNNNNNNNNNNANAGGGGAGAGGTGGGTTGAACCAGTTACATG  bor-4.fa
17005214  ACTTTCNNNNNNNNNNNNNNNNTTGGTCNNNNNTTTTTTTNANNNNNNNNNNNNGAGAGGTGGGTTGAACCAGTTACATG  br-0.fa
17005214  ACTTTCATGTTTNTTNNNNNNNTTGGTCTACATTTTTTTTAACTNNNNNNNNNGNNGNNNNNGGTTGAACCAGTTACATG  bur-0.fa
17005214  ACTTTCNNNNNNNNNNNGNNTTTTGGTCTACNTTTTTTTTNNNNNNNNNNAGGGGAGAGGTGGGTTGAACCAGTTACATG  c24.fa
17005214  ACTTTCNTGTTTCNTNNNNNNNTTGGTCTACNTTTTTTNNNNNNNNNNNNAGGGGAGAGGTGGNTTGAACCAGTTACATG  col-0.fa
17005214  ACTTTNNNNNNNNNNNNNNNNNTTGGTCNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNGTGGNTTGAACCAGTTACATG  cvi-0.fa
17005214  ACTTTCATGTTTCTTTNGCCTTTTGGTCTACATTTTTTTTANNNNNNNAAAGGGGAGAGGTGGGTTGAACCAGTTACATG  est-1.fa
17005214  ACTTTCNNNNNNNTTNTGNCTTTTGGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTGGGTTGAACCAGTTACATG  fei-0.fa
17005214  ACTTTCNTNNNNNNNNNNNNNNNTGGTCTACNTTTTNNNNNNNNNNNNNNNNNNNNNAGGTGGNTTGAACCAGTTACATG  got-7.fa
17005214  ACTTTCNNNNNNNNTNNNNNNNTTGGTCTACATTTNNNNNNNNNNNNNNNNNGGGAGAGNTGGGTTGAACCAGTTACATG  ler-1.fa
17005214  ANTNNNNNNNNNNNNNNNNNNNTTGGTCNNNNNTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAACCAGTTACATG  lov-5.fa
17005214  ACTTTCATGTTTNTTNNNNNNNTTGGTCTACNTTTTTTTTNNNNNNNNNNNNNGGAGAGGTGGGTTGAACCAGTTACATG  nfa-8.fa
17005214  ACTTTCATGTTTCTTTTGCCTTTTGGTCNNNNNTTTTTTTNNNNNNNNNNNGGGGAGAGGTGGGTTGAACCAGTTACATG  rrs-10.fa
17005214  ACTTNNNNNNNNNNNNNGCNTTTTGGTCTNCATTTTTNNNNNNNNNNNNNNNNNNNNNNNNNGGTTGAACCAGTTACATG  rrs-7.fa
17005214  ACTTTCANNNNNNNNNNNNNNNTTGGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTGGNTTGAACCAGTTACATG  sha.fa
17005214  ACTTNNNNNNNNNTTNNNNNNNTTGGTCNNNNNNNNNNNNNNNNNNNNNNNNNGGAGAGGTGGGTTGAACCAGTTACATG  tamm-2.fa
17005214  ACTTTNNNNNTTCTTTTGCNTTTTGGTCNNNNNNNNNNNNNNNNNNNNNNNNGNGAGAGGTGGGTTGAACCAGTTACATG  ts-1.fa
17005214  ACTTTCATGTTTNTTNNNNNNNTTGGTCTACNTTTTTTTNNNNNNNNNNNNGGGGAGAGGTGGNTTGAACCAGTTACATG  tsu-1.fa
17005214  ACTTTCATGNNNNNNNTGNCTTTTGGTCNNNNNTTTTTTTNNNNNNNNNNNGGGGAGAGGTGGGTTGAACCAGTTACATG  van-0.fa
 
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTCACATTCAAACTTTTTTTTTTTGTTTGCAAACCAATA  chr2.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTCNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNAATA  bay-0.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTCNNNNNNNNNNNNTTTNNNRRNNNNNNNNNNNNNNNA  bor-4.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTNNNNNNNNNNNNNNTTNNNRRNNNNNNNNNNNNAATA  br-0.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACNTNNNNNNNNNNNNTTTTNNNRRNNNNNNNNNNNCAATA  bur-0.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTCACANNNNNNNNNTTTNNNRRNNNNNNNNNNNCAATA  c24.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTCACANNNNNNNNTTTTNNNRRNNNNNNNNNNNCAATA  col-0.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCNCCTCAAGTCCACNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNN  cvi-0.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTCACANNNNNNNNTTTTNNNRRNNNNNNNNNNCCAATA  est-1.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTCANNNNNNNNNNNTTTNNNRRNNNNNNNNNNNNNATA  fei-0.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTCACNNNNNNNNNNNTNNNNRRNNNNNNNNNNNNAATA  got-7.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTNNNNNNNNNNNNNNTTNNNRRNNNNNNNNNNNNNNNN  ler-1.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACNNNNNNNNNNNNNNNTTTNNNRRNNNNNNNNNNNNNNNN  lov-5.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCNNNNNNNNTCCACTTCANNNNNNNNNNTTTTNNNRRNNNNNNNNNNNCAATA  nfa-8.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTCACANNNNNNNNNTTTNNNRRNNNNNNNNNNNCAATA  rrs-10.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTCNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNATA  rrs-7.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCNCAAGTCCACNTNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNN  sha.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTCNNNNNNNNNNNNNTTNNNRRNNNNNNNNNNNNNNNA  tamm-2.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTCANNNNNNNNNNNTTTNNNRRNNNNNNNNNNNNNATA  ts-1.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTCACANNNNNNNNNNTTNNNRRNNNNNNNNNNNNAATA  tsu-1.fa
17005294  TGACTAGGTTAGCCAAAAGTGGAAAACCACCTCAAGTCCACTTCACANNNNNNNNNNTTNNNRRNNNNNNNNNNNCAATA  van-0.fa
 
17005374  ATTGAACTTGGTATGTACTTTATATGACGTATGTACGATACTACGA   chr2.fa
17005374  ATTGAACTTGGTATGTACTTTATATGACGTATGTACGATACTACGA   bay-0.fa
17005374  ATTGAACTTGGTATGTACTTTATATGACGTATGTACGATACTACNN   bor-4.fa
17005374  ATTGAACTTGGTANNNNNNTTATATGACGTATGTACGATNNNNNNN   br-0.fa
17005374  ATTGAACTTGGTATGTACTTTATATGACGTATGTACGATACTACGA   bur-0.fa
17005374  ATTGAACTTGGTATGTACTTTATATGACGTATGTACGATACTACGA   c24.fa
17005374  ATTGAACTTGGTATGTACTTTATATGACGTATGTACGATACTACGN   col-0.fa
17005374  NTTGNNNNNNNTNTGTACTTTATATGACGTATGTACNNNNNNNNNN   cvi-0.fa
17005374  ATTGAACTTGGTATGTACTTTATATGACGTATGTACGATACTACGA   est-1.fa
17005374  ATTGAACTTGGTATGTACTTTATATGACGTATGTACGATACTACNN   fei-0.fa
17005374  ATTGNNNTNNGNNNNNACTTTATATGACGTATGTACGATACTACNN   got-7.fa
17005374  NNNNNNNNNNNNNNNNNNNNNNNNNNNNGTNTGTACGANNNNNNNN   ler-1.fa
17005374  NNNNNNNNNNNNNNNNNNNNNNNNTGACGTATGTACGANACTNCNN   lov-5.fa
17005374  ATTGAACTTGGTATNTACTTTATATGACGTATGTACGATACTACGA   nfa-8.fa
17005374  ATTGNACTTGGTATGTNCTTTATATGACGTATGTACGATACTACNN   rrs-10.fa
17005374  ATTGNNNNNNGTANNNNNNTTATATGACGTATGTACNNNNNNACNN   rrs-7.fa
17005374  NNTNNNNTTGGTATGTANTTTATATGACGTATGTACNNNNCTACNN   sha.fa
17005374  ATTGNNNNNNNNNNNNNNNNTATATGACGTATGTACGNNNNNNNNN   tamm-2.fa
17005374  ATNNNNNNNNNNNNGTACTTTANATGACGTATGTACGATACTANNN   ts-1.fa
17005374  ATTGAACTTGGTATGTACTTTATATGACGTATGTACGANACTACGA   tsu-1.fa
17005374  ATTGAACTTGGTNNNNACTTTATATGACGTATGTACGATACTACGN   van-0.fa
 
visited.