Arabidopsis SNP Sequence Viewer

Chromosome : chr3 Coordinates : 21742455 - 21745972


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
21742455  TAATCATCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  chr3.fa
21742455  NNNNNNTCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  bay-0.fa
21742455  TAANCATCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  bor-4.fa
21742455  NNNNNNNNNNNNNNNNNNNGTTGATNAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCNTTCGCTATCT  br-0.fa
21742455  TAATCATCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  bur-0.fa
21742455  TANTCATCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  c24.fa
21742455  NNNNNNNNNCTACNTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTNTTCATTCGCTATCT  col-0.fa
21742455  NNNNNNNNNCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTNNNNNTTCGCTATCT  cvi-0.fa
21742455  NNNNNATCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  est-1.fa
21742455  NNNNNNNNNNNNNNNNNNAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTNTTCATTCGCTATCT  fei-0.fa
21742455  TAATNATCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  got-7.fa
21742455  TAATCATCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  ler-1.fa
21742455  TAATCATCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTNTTCATTCGCTATCT  lov-5.fa
21742455  NNNNCATCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  nfa-8.fa
21742455  TNNNNNNCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  rrs-10.fa
21742455  NNNNNATCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  rrs-7.fa
21742455  NNNNNNNCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  sha.fa
21742455  NNNNNNNNNNNNNTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  tamm-2.fa
21742455  NNNNNNTCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  ts-1.fa
21742455  TNNNNNTCTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  tsu-1.fa
21742455  NNNNNNNNTCTACTTTGGAGTTGATAAGTGATCGAATTGCACGCAAAAGGAGCTGGAAGGTTGTTATTCATTCGCTATCT  van-0.fa
 
21742535  CTCCCTTACATACACACACACACGCGCGCTCTCTTTAGTATTTTAAGTATCTGAGACTGTTTGATGGTAATTACTACACA  chr3.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNNNGCGCTCTCTTTANNNNNNNNNNNNNNNNNGNCTGTTTGATGGTAATTACTACACA  bay-0.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNGNGCGCTCTCTTTANNNNNNNNNNTATCTGAGACTGTTTGATGGTAATTACTACACA  bor-4.fa
21742535  CTCCCNNNNNRNNNNNNNNNNNNNNNNNNTCTCTTNNNNNNNNNNNNNNNNNNNNNNNGTTNNNNNNNNNNNNNNNNNCA  br-0.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNNNNNGCTCTCTTTAGTANNNNNAGTATCTGAGACTGTTTGATGGTAANTACTACACA  bur-0.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNGCGCGCTCTCTTNNNNNNNNNNNNNNNNNGAGACTGTTTGATGGTAANTACTACACA  c24.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNNNNNNCTCTCTTTNNNNNNNNNNNNNNNNNNNNNNNTTTGATGGTAANTACTACNCA  col-0.fa
21742535  CTCCCTNNNNRNNNNNNNNNNNNNCGCGCTCTCTTTNNNNNNNNNNNNNNNNNNGANTGTTTGATGGTAANTACTACACA  cvi-0.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNNNGCGCTCTCTTTANNNNNNNNNNNATCTGAGACTGTTTGATGGTAATTACTACACA  est-1.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTTGNNNNNANNNNNNNCACA  fei-0.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNNCGCGCTCTCTTTAGTNNNNNNNGTATCTGAGACTGTTTGATGGTAATTACTACACA  got-7.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNNNGCGCTCTCTTTAGNNNNNNNNGTATCTGAGACTGTTTGATGGTAANTACTACACA  ler-1.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNNNNCGCTCTCTTTAGTNNNNTAAGTATCTGAGACTGTTTGATGGTAANTACTACACA  lov-5.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNNNNNNNNCTCTTTNNNNNNNNNNGTATCTGAGACTGTTTGATGGTAANTACTACACA  nfa-8.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNGCGCGCTCTCTTTNNNNNNNNNNNNNNNNGAGACTGTTTGATGGTAATTACTACACA  rrs-10.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNCGCGCGCTCTCTTTAGTNNNNNNAGTATCTGAGACTGTTTGATGGTAATTACTACACA  rrs-7.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNNCGCGCTCTCTTNNNNNNNNNNNNNNNNNNNGACTGTTTGATGGTAATTACTACACA  sha.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNNNNCGCTCTCTTTANNNNNNNNNNNNNNNNNNNNNGTTTGATGGTAATTACTACACA  tamm-2.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNGCGCGCTCTCTTTNNNNNNNNNNNNNNNNNAGACTGTTTGATGGTAANTACTACACA  ts-1.fa
21742535  CTCCCTTNNNRNNNNNNNNNNNNNNNNNNTCTCTTTNNNNNNNNNNNNNTCTGAGACTGTTTGATGGTAATTACTACACA  tsu-1.fa
21742535  CTCCCTNNNNRNNNNNNNNNNNNNNGCGCTCTCTTTNNNNNNNNNNNNNTCTGAGACTGTTTGATGGTAATTACTACACA  van-0.fa
 
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  chr3.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  bay-0.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCN  bor-4.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTNNNNNNNNTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  br-0.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  bur-0.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  c24.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCNNNNNGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  col-0.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCANATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  cvi-0.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  est-1.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATNNNNNNNGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  fei-0.fa
21742615  GGTGATGCTAGGAAGATNCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCN  got-7.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  ler-1.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  lov-5.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  nfa-8.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  rrs-10.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  rrs-7.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  sha.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGNTTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  tamm-2.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  ts-1.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  tsu-1.fa
21742615  GGTGATGCTAGGAAGATGCCTTCCAAGATTCAGATTGTTTACAAAGCGAGATTATGTGAATCCCGGTGGTAGTAACCGCT  van-0.fa
 
21742695  CATCAGGCTCATTCAACAGATGAGTGACTGCAAAGAGCTTTGGGTTTGTTTTTCTTTAATTGCCTTAAAAGGATGAAAAA  chr3.fa
21742695  CATCAGGCTCATTCAACAGATGANTGACTGCAAAGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGANGAAAAA  bay-0.fa
21742695  NGNNNNGCTCATTCAACAGATGANTGACTGCAAAGAGCTTTGGGTTNNNNNNNNNNNNNNNNNNNNNNNAGGATGAAAAA  bor-4.fa
21742695  CATCAGGCTCATTCAACAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
21742695  CATCANGCTCATTCAACAGATGANTGACTGCAANGAGCTTTGGNTNNNNNNNNNNNNNNNNNNNNNNNNNNNATGAAAAA  bur-0.fa
21742695  CATCANGCTCATTCAACAGATGANTGACTGCAAAGAGCTTNGGNNTTGNNNNNNNNNNNNNNNNNNNAAAGGATGAAAAA  c24.fa
21742695  CATCAGGCTCATTCAANAGATGANTGACTGCAAAGAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
21742695  CATCAGGCTCATTCAACAGATGANTGACTGCAAAGAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
21742695  CATCAGGCTCATTCAACAGATGANTGACTGCAAAGAGCTTTGGNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
21742695  CATCAGGCTCATTCAACAGATGANTGACTGCAAAGAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
21742695  CATCAGGCTCATTCAACAGATGANTGACTGCAAAGAGCNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNATGAAAAA  got-7.fa
21742695  CATCANGCTCATTCAACAGATGANTNACTGCAAAGAGCTTNNGNNNNNNNNNNNNNNNNNNGCCTTAAAAGGATGAAAAA  ler-1.fa
21742695  CATCANGCTCATTCAACAGATGANTGACTGCAAAGAGCTTNNNNNNNGNNNNNNNNNNNNNNNNNTAAAAGGATGAAAAA  lov-5.fa
21742695  CATCAGGCTCATTCAACAGATGANTGACTGCAAAGAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATGAAAAA  nfa-8.fa
21742695  CATCAGGCTCATTCAACAGATGANTGACTGCAAAGAGCTTTGGNNNNNNNNNNNNNNNNNNNNNNNNAAAGGATGAAAAA  rrs-10.fa
21742695  CATCAGGCTCATTCAACAGATGANTGACTGCAAAGAGCTTTGGNTNNGNTNNTNNNNNNNNNNNNNNAAAGGATGAAAAN  rrs-7.fa
21742695  CATCAGGCTCATTCAACAGATGANTGACTGCAAAGAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGAAAAN  sha.fa
21742695  CATCAGGCTCATTCAACAGATGANNNNCNNCNAAGAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNN  tamm-2.fa
21742695  CATCAGGCTCATTCAACAGATGANTGACTGCAAAGAGCTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAANN  ts-1.fa
21742695  CATCAGGCTCATTCAACAGATGANTGACTGCAAAGAGCTTTGGNTNNNNNNNNNNNNNNNNNNNNNNNAAGGNNNNNNAA  tsu-1.fa
21742695  CATCAGGCTCATTCAACAGATGANTGACTGCAAAGAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGATGAAAAN  van-0.fa
 
21742775  ATGTCAAATACTTTTTAGGTCTTTTGTATTTATATATGACATCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  chr3.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  bay-0.fa
21742775  NNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNGACATCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  bor-4.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTNNNNNNNAATGAACACGNNNNNN  br-0.fa
21742775  ATGTNNNNNNNNNTTTAGNNNNNNNNNNNNNNNNNNNGACATCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  bur-0.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  c24.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  col-0.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  cvi-0.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  est-1.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACNGTTTTTCTTAACCAGAATGAACACGGTGGTG  fei-0.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  got-7.fa
21742775  NNNNNNNNNNNNTTTTNNNNNNNNNNNNNNNNNNNNNNNCATCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  ler-1.fa
21742775  ATGNNNNNNNNTTTTTNNNNNNNNNNNNNNNNNNNNNNACATCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  lov-5.fa
21742775  ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  nfa-8.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  rrs-10.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  rrs-7.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  sha.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGACTGNTTTTCTTAACCAGAATGAACACGGTGGTG  tamm-2.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  ts-1.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCATGACTGTTTTTCTTAACCAGAATGAACACGGTGGTG  tsu-1.fa
21742775  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGACTGNTTTTCTTAACCAGAATGAACACGGTGGTG  van-0.fa
 
21742855  TGTATTATTTTTTACGCAGTGGCGAAGTAAAATAATGAGATCTCTGAGCTAATTCTCGAGTTATTTAGTGTAATTAGTAT  chr3.fa
21742855  TGTNTTNTTTTTTACGCNNNNNNNNNANNNNNNNNNNNNNNNNNNGAGCTAATTCTCGAGTTNNNNNNNNNNNNNNNNNN  bay-0.fa
21742855  TGTATTATTTTTTACGCANNNNNNNNNNNNNNNNNNNNNATCTCTGAGCTAATTCTCGAGTTATTTNNNNNNNNNNNNNT  bor-4.fa
21742855  NNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNAATTCTCNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
21742855  TGTATTATTTTTTACGCNNNNNNNNNANNNNNNNNNNNNNNNNNTGAGCTAATTCTCGAGTTATTTAGTGTNATTAGTAT  bur-0.fa
21742855  TGTATTATTTTTTACGCNNNNNNNNNANNNNNNNNNNNNNNNTCTGAGCTAATTCTCGAGTTATTTAGNNNNNNNNNNNT  c24.fa
21742855  TGTNNNNTTTTTTACGCAGTGGCGAAGNANNNNNNNNNNNNNNNNGAGCTAATTCTCGNGTNNNNNNNNNNNNNNNNNNN  col-0.fa
21742855  TGTATTNTTTTTTACGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTAATTCTCGNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
21742855  TGTATTATTTTTTACGCNNNNNNNNNNNNNNNNNNNNNNNNCTCTGAGCTAATTCTCGAGTTATTTANNNNNNNNNNNNN  est-1.fa
21742855  TGTATTATTTTTTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTAATTCTCGNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
21742855  TGTATTNTTTTTTACGCAGTNNNNNNANNNNNNNNNNNNATCTCTGAGCTAATTCTCGAGTTATNTNNNNNNNNNNNNNN  got-7.fa
21742855  TGTATTATTTTTTACGCNNNNNNNNNANNNNNNNNNNNNATNTCTGAGCTAATTCTCGAGTTATTTAGTNNNNNNNGTAT  ler-1.fa
21742855  TGTATTATTTTTTACGCNNNNNNNNNANNNNNNNNNNNNNTCNCTGAGCTAATTCTCGAGTTATTTANNNNNNNTAGTAT  lov-5.fa
21742855  TGTATTATTTTTTACGCNNNNNNNNNANNNNNNNNNNNNNNNNNTGAGCTAATTCTCGAGTTATTTANNNNNNNNNNNAT  nfa-8.fa
21742855  TGTATTATTTTTTACGCNNNNNNNNNANNNNNNNNNNNNNNCTCTGAGCTAATTCTCGAGTTNTTTAGNNNNNNNNNNNN  rrs-10.fa
21742855  TGTATTATTTTTTACGCNNNNNNNNNANNNNNNNNNNNNATNTCTGAGCTAATTCTCGAGTTATTTNNNNNNNNNNNNNN  rrs-7.fa
21742855  TGTATTATTTTTTACGNNNNNNNNNNANNNNNNNNNNNNNNNNNNGAGCTAATTCTCGAGTTATTTNNNNNNNNNNNNNN  sha.fa
21742855  TGTATTATTTTTTACGNNNNNNNNNNANNNNNNNNNNNNNNNNNNGAGCTAATTCTCGANNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
21742855  TGTATTATTTTTTACGCNNNNNNNNNNNNNNNNNNNNNNNNCTCTGAGCTAATTCTCGAGTTNTTTANNNNNNNNNNNNN  ts-1.fa
21742855  TGTATTATTTTTTACGCNNNNNNNNNANNNNNNNNNNNNNTCTCTGAGCTAATTCTCGAGTTATTTAGNNNNNNNNNNNN  tsu-1.fa
21742855  NNNNNNATTTTTTACGCNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGCTAATTCTCGAGTTATNNNNNNNNNNNNNNNN  van-0.fa
 
21742935  CTGAATAAGTTGAAGACGTTAAATTACTATATTTAAATCCTTTTTTTTTGTTGCGTGAAAAAAAGAATAGGAAGACCTCG  chr3.fa
21742935  NNNNNNAAGTTGAAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTNTTGCGTGAAAAAAANNNNNNNAAGACCTCG  bay-0.fa
21742935  NTGAATAAGTTGAAGACGTTANNNNNNNNNNNNNNNNNNNNNNTTTTTTGTTGCGTGAAAAAAAGAATAGGAAGACCTCG  bor-4.fa
21742935  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACCTCG  br-0.fa
21742935  CTGAATAAGTTGAAGACGTTANNNNNNNNNNNNNNNNNNNNNNTTTTTTGTTGCGTGAAAAAAAGAANAGGAAGACCTCG  bur-0.fa
21742935  NTGAATAAGTTGAAGACGNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTGTTGCGTGAAAAAAAGAATAGGAAGACCTCG  c24.fa
21742935  NNNNNNNAGTTGANGNCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTTGCGTGNAANNNNNNNNNNNAAGACCTCG  col-0.fa
21742935  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTGNNNNNNGAAAAAAANNNNNNNAAGACCTCG  cvi-0.fa
21742935  NNNNNNAAGTTGAAGACGTNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTNTTGCGTGAAAAAAANAATAGGAAGACCTCG  est-1.fa
21742935  NNNNNNNNNNTGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTGTTGNGTGAAAANNNNNNNNNNAAGACCTCG  fei-0.fa
21742935  NNNNNTAAGTTGAAGNCGTTANNNNNNNNNNNNNNNNNNNNNNTNTTTTGTTGCGTGAAAAAAANNNNNNNAAGACCTCG  got-7.fa
21742935  CTGAATAAGTTGAAGACGTTAANNNNNNNNNNNNNNNNNNNNTTTTTTTGTTGCGTGAAAAAAANAATAGGAAGACCTCG  ler-1.fa
21742935  CTGAATAAGTTGAAGACGTTANNNNNNNNNNNNNNNNNNNNNNTTTTTTGTTGCGTGAAAAAAANAATAGGAAGACCTCG  lov-5.fa
21742935  CTGAATAAGTTGAAGACGTTNNNNNNNNNNNNNNNNNNNNNNNTTTTTTGTTGCGTGAAAAAAAGAATAGGAAGACCTCG  nfa-8.fa
21742935  NNNNNNAAGTTGAAGNCGTTNNNNNNNNNNNNNNNNNNNNNNTTTTTTTGTTGCGTGAAAAAAANAATAGGAAGACCTCG  rrs-10.fa
21742935  NNGNATAAGTTGAAGACGTNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTGTTGCGTGAAAAAAAGAATAGGAAGACCTCG  rrs-7.fa
21742935  NNNNNNAAGTTGAAGACGTNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTGTTGCGTGAAAAAAANAATAGGAAGACCTCG  sha.fa
21742935  NNNNNNNNNTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTNNNNNGTGAAAANNNNNNNNGGAAGACCTCG  tamm-2.fa
21742935  NNNNATAAGTTGAAGANGNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTGTTGCGTGAAAAAAANAATAGGAAGACCTCG  ts-1.fa
21742935  NNNNNNAAGTTGAAGACGTTANNNNNNNNNNNNNNNNNNNNNNTTTTTTGTTGCGTGAAAAAAAGAANAGGAAGACCTCG  tsu-1.fa
21742935  NNNNATAAGTTGAAGACGNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTGTTGCGTGAAAAAAANAATAGGAAGACCTCG  van-0.fa
 
21743015  AGCCAATAAAAAGGGTATACAGTAGGGCGATAAAAAGTGTAAAAGAGTGTCTTGTAGAAAATAAGATGAGGTCAAATCGA  chr3.fa
21743015  AGCCAATAAAAAGGGTATACAGTAGGGCGATAAAAAGTGNAAAAGAGTGTCTNNNNNNNAATAAGATGAGGTCAAATCGA  bay-0.fa
21743015  AGCCAATAAAAAGGGTATACAGTAGGGCGATAAAAAGTGNAAAAGAGTGTCTTGTAGAAAATAAGATGAGGTCAAATCGA  bor-4.fa
21743015  AGCCAATAANNNNNNNNNNNNNNNNNGCGATAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCAAATCGA  br-0.fa
21743015  AGCCAATAAAAAGGGNATACAGTAGGGCGATAAAAAGTGTAAAAGAGTGTCTTGTAGAAAATAAGATGAGGTCAAATCGA  bur-0.fa
21743015  AGCCAATAAAAAGGGTATACAGTAGGGCGATAAAAAGNNNNNNAGAGTGTCTTGTAGAAAATAAGATGAGGTCAAATCGA  c24.fa
21743015  AGCCAATAAAANNNNNNNNNNNNNNGGCGATAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCAAATCGA  col-0.fa
21743015  AGCCAATAAAANNNNNNNNNNGNAGGGCGATAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTCAAATCGA  cvi-0.fa
21743015  AGCCAATAAAAAGNNNNNNNNNNNNNTNGNTANAAAGNGNAAAAGAGNNNCNTGTAGAAAATAAGATGAGGTCAAATCGA  est-1.fa
21743015  AGCCAATAAAAANNNNNNACAGNAGGGCGATAAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCAAATCGA  fei-0.fa
21743015  AGCCAATAAAAAGGGNATACAGTAGGGCGATAAAAAGNNNNNNAGAGTNNNNNNTAGAAAATAAGATGAGGTCAAATCGA  got-7.fa
21743015  AGCCAATAAAAAGGGTATACAGTAGGGCGATAAAAAGNNNNNNAGAGTGTCTTGTAGAAAATAAGATGAGGTCAAATCGA  ler-1.fa
21743015  AGCCAATAAAAAGGGTATACAGTAGGGCGATAAAAAGTGNAAAAGAGTGTCTTGTAGAAAATAAGATGAGGTCAAATCGA  lov-5.fa
21743015  AGCCAATAAAAAGGGTATACAGTAGGGCGATAAAAAGNNNNNNAGAGTGTCNTGTAGAANATNAGATGAGGTCAAATCGA  nfa-8.fa
21743015  AGCCAATAAAAAGGGTATACAGTAGGGCGATAAAAAGNNNNNNAGAGTGNCNNGNAGAAAATAAGATGAGGTCAAATCGA  rrs-10.fa
21743015  AGCCAATAAAAAGGGTATACAGTAGGGCGATAAAAAGTGNAAAAGAGTGTNTTGTAGAAAATAAGATGAGGTCAAATCGA  rrs-7.fa
21743015  AGCCAATAAAAAGGGTATACNNNNNGGCGATAAAAAGNNNNNNNNANNNNNNNNNNGAAAATAAGATGAGGTCAAATCGA  sha.fa
21743015  AGCCAATAAAAANNNNNNNCNNNNGGGCGATAAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGAGGTCAAATCGA  tamm-2.fa
21743015  AGCCAATAAAAAGGGTATACAGTAGGGCGATAAAAANNNNNAAAGAGTGNNNNGTAGAAAANAAGATGAGGTCAAATCGA  ts-1.fa
21743015  AGCCAATAAAAAGGGTATACAGTAGGGCGATAAAAAGNNNNNNAGAGTGTCTTGTAGAAAATAAGATGAGGTCAAATCGA  tsu-1.fa
21743015  AGCCAATAAAAAGGNTATACAGTAGGGCGATAAAAANNNNNNNNNNNNNNNNNNNANNANATAAGATGAGGTCAAATCGA  van-0.fa
 
21743095  GTCGTCCTTTTTTTGGTATCAGTAGAGTACTTTCAGTCTTACGTCAAATCGAATCAGTAGATTTTGACTTTTTGAGTAAT  chr3.fa
21743095  GTCGTCCTTTTTTTGGTATCAGTAGAGTACTTTCAGTCTTACGTCAAATCGANNNNNNNNNTTNNNNNNNTTTGAGTNNN  bay-0.fa
21743095  GTCGTCCTTTTTTTGGTATCAGTAGAGTACTTTCAGTCTTACGTCAAATCGAATCAGTAGATTTTGACTTTTTGAGTAAT  bor-4.fa
21743095  GTCGTCCTTTTTTTNNNNNNNNNNNNNNNNNNNNNNTCTTACGTCAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
21743095  GTCGTCCTTTTTTTGGTATCAGTAGAGTACTTTCAGTCTTACGTCAAATCGAATCANNNNNNNTTGACTTNTTGAGTAAT  bur-0.fa
21743095  GTCGTCCTTTTTTTGGTATCAGTNGAGTACTTTCAGTCTTACGTCAAATCGAATCAGTAGNTTTTGACTTTTTGAGTAAT  c24.fa
21743095  GTCGTCCTTTTTTTGGTATCNGTAGAGTNCTTTCAGTCTTACGTCAAATCGNNNNNNNNNNNNNTGNCTTTTTGAGTANN  col-0.fa
21743095  GTCGTCCTTTTTTTGGTANCAGTAGAGTACTTTCAGTCTTACGTCAAATCGAATCNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
21743095  GTCGTCCTTTTTTTGGTATNAGTAGAGTACTTTCAGTCTTACGTCAAATCGAATCAGTAGATTTTGANTTTTTGAGTAAT  est-1.fa
21743095  GTCGTCCTTTTTTTGGTATCNGTAGNNNNNNNTCAGTCTTACGTCAAATCGANNNNNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
21743095  GTCGTCCTTTTTTTGGTATCAGTAGAGTACTTTCAGTCTTACGTCAAATCGAATCNGTAGATTTTGACTTTTTGAGTAAT  got-7.fa
21743095  GTCGTCCTTTTTTTGGTATCAGTAGAGTACTTTCAGTCTTACGTCAAATCGAATCAGTAGATTTTGNCTTTTTGAGTAAT  ler-1.fa
21743095  GTCGTCCTTTTTTTGGTATCAGTAGAGTACTTTCAGTCTTACGTCAAATCGAATCAGTAGATTTNNNNNNTTTGAGTAAT  lov-5.fa
21743095  GTCGTCCTTTTTTTGGTATCAGTAGAGTACTTTCAGTCTTACGTCAAATCGAATCAGNAGATTTTGNCTTTTTGAGTAAT  nfa-8.fa
21743095  GTCGTCCTTTTTTTGGTATCAGTAGAGTACTTTCAGTCTTACGTCAAATCGAATCAGTAGATTTTGANTTTTTGAGTAAN  rrs-10.fa
21743095  GTCGTCCTTTTTTTGGTATCAGTAGAGTACTTTCAGTCTTACGTCAAATCGAATCANNNNNTTTTGANTTTTTGAGTAAT  rrs-7.fa
21743095  GTCGTCCTTTTTTTGGTATCAGTAGAGTNCTTTCAGTCTTACGTCAAATCGAATCNNNNNNNTNNNNNNNTTTGAGTANN  sha.fa
21743095  GTCGTCCTTTTTTTGGTATCNGTAGNNNNNNTTCAGTCTTACGTCAAATCGAATNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
21743095  GTCGTCCTTTTTTTGGTATCAGTAGAGTACTTTCAGTCTTACGTCAAATCGAATCNNNNNNNTNNNNNNNTTTGAGTAAT  ts-1.fa
21743095  GTCGTCCTTTTTTTGGTATCAGTAGAGTACTTTCAGTCTTACGTCAAATCGAATCAGTAGNTTTTGACTTTTTGAGTAAT  tsu-1.fa
21743095  GTCGTCCTTTTTTTGGTATCAGTAGAGTACTTTCAGTCTTACGTCAAATCGAATCNNNNNNNNNNNNNNNTTTGNGNNNN  van-0.fa
 
21743175  GTAGATACTAGTACTAAGCTCTGACCATTTAAATTATTTACAGATAGACTAGAACGTCGTAGTTGTTGGGGTTAGTTGAA  chr3.fa
21743175  NNNNNNNNNAGNACTAAGCTCTGACCATTTNNNNNNNNNNNNNNTAGACTAGAACGTCGTNGTTGTTGNGNNTNGTTGAA  bay-0.fa
21743175  GTAGATACTAGTACTAAGCTCTGACCATTTAANNNNNNNNNNNNTAGACTAGAACGTCGTAGTTGTTNNNNNNNNNNNNN  bor-4.fa
21743175  NNNNNNNNNNNNNNNNNGCTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTCGNAGTTGTNNNNNNNNNNTGAA  br-0.fa
21743175  GTAGATACTAGTACTAAGCTCTGACCATTTAAATTNNNNNCAGATAGACTAGAACGTCGTAGTTGTTGGGGTTAGTTGAA  bur-0.fa
21743175  GTAGATACTAGTACTAAGCTCTGACCATTTAANNNNNNNNNNNNTAGACTAGAACGTCGTAGTTGTTGGGGTTAGTTGAA  c24.fa
21743175  NNNNNNNNNNNNACTAAGCTCTGACCATTNNNNNNNNNNNNNNNNNNNNNNGAACGTCGTNGTTGTTGNGNNTNGTTGAA  col-0.fa
21743175  NNNNNNNNNNNNNCTAAGCTCTGANNNNNNNNNNNNNNNNNNNNNAGACTAGAACGTCGTAGTTGTTNNNNNNNGTTGAA  cvi-0.fa
21743175  NNNNNNNNTAGTACTAAGCTCTGACCATNNNNNNNNNNNNNNNNTAGACTAGAACGTCGTAGTTGTTGGGGTTNGTTGAA  est-1.fa
21743175  NNNNNNNNNNNNNCTAAGCTCTGACNNNNNNNNNNNNNNNNNNNNNNNCTAGANCGNCGNAGTTGTTGNGNNTNNNNGAA  fei-0.fa
21743175  GTANATACTAGTACTAAGCTCTGACCATTTANNNNNNNNNNNNNNAGACTAGAACGNCGTAGTTGTTGGGGTTNGTTGAA  got-7.fa
21743175  GTAGATACTAGTACTAAGCTCTGACCATTTAAATTNNNNNNNNNTAGACTAGAACGTCGTAGTTGTTGNGNNTNGTTGAA  ler-1.fa
21743175  GTAGNTACTAGTACTAAGCTCTGACCATTTAAANNNNNNNCAGATAGACTAGAACGTCGTAGTTGTTGGGGTTNGTTGAA  lov-5.fa
21743175  GTAGATACTAGTACTAAGCTCTGACCATTTAANNNNNNNNNNNATAGACTAGAACGTCGTAGTTGTTGNGNNTNGTTGAA  nfa-8.fa
21743175  NNNNNTACTAGTACTAAGCTCTGACCATTNNNNNNNNNNNNNNNTAGACTAGAACGTCGTAGTTGNNNNNNNNNGTTGAA  rrs-10.fa
21743175  NTNGATACTAGTACTAAGCTCTGACCATTNNNNNNNNNNNNNNNNAGACTAGAACGTCGTAGTTGTTGGGGTTAGTTGAA  rrs-7.fa
21743175  NNNNNNNNNNGTACTAAGCTCTGACCATNNNNNNNNNNNNNNNNNNNNCTAGAACGTCGTAGTTGTTGNGNNTNGTTGAA  sha.fa
21743175  NNNNNNNNNNNTACTAAGCTCTGACCANNNNNNNNNNNNNNNNNNNNACTAGAACGTCGTNGTTGTTGNGNNTNGTTGAA  tamm-2.fa
21743175  NTNNANACTAGTACTAAGCTCTGACCATTNNNNNNNNNNNNNNNNNGACTAGAACGTCGTAGTTGTTNNNNNNNGTTGAA  ts-1.fa
21743175  GTAGNTACTAGTACTAAGCTCTGACCATTTANNNNNNNNNNNNNNAGACTAGAACGTCGTAGTTGTTGGGGTNAGTTGAA  tsu-1.fa
21743175  NNNNNNNNNNGTACTAAGCTCTGACCATTTNNNNNNNNNNNNNNNAGACTAGAACGTCGTAGTTGTTGGGGTTNGTTGAA  van-0.fa
 
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCCTCTTTCGCTTTCAGTTCCATCAAAAAGCTGT  chr3.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCCTCTTTCGCTTTCAGTTCCATCAAAAAGNNNN  bay-0.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCCNCTTTCGCTTTCAGTTCCATCAAAAAGCTGN  bor-4.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCNNNNNNNNNNNNNNNNCNTTCNGTTCCATCANNNNNNNNN  br-0.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCNNNNNTCGCTTTCAGTTCCATCAAAAAGCTGT  bur-0.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCCTCTTTCGCTTTCAGTTCCATCAAAAAGCNNN  c24.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCNTCTNTNNCNTTCAGTTCCATCAAAAANNNNN  col-0.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCCTCTTTCGCTTTCAGTTCCATCAAANNNNNNN  cvi-0.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCCNCTTTCGCTTTCAGTTCCATCAAAAANNNNN  est-1.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCNCCTCTTTCGCTTTCAGTTCCATCAAAAANNNNN  fei-0.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCCTCTTTCGCTTTCAGTTCCATCAAAAAGCNNN  got-7.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTNCTCTTTCGCTTTCAGTTCCATCAAAAAGCNNN  ler-1.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCNNNTNTTTCGCTTTCAGTTCCATCAAAAAGCNNN  lov-5.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCCTCTTTCGCTTTCAGTTCCATCAAAAAGCTGN  nfa-8.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCCTCTTTCGCTTTCAGTTCCATCAAAAANNNNN  rrs-10.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCCTCTTTCGCTTTCAGTTCCATCAAAAAGNNNN  rrs-7.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCCTCTTTCGCTTTCAGTTCCATCAAAANNNNNN  sha.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTNNNNNNNNTCTCNTNNTTCGCTTTCAGTTCCATCAAAANNNNNN  tamm-2.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCCTCTTTCGCTTTCAGTTCCATCAAAANNNNNN  ts-1.fa
21743255  GANGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCCTCTTTCGCTTTCAGTTCCATCAAAAAGNNNN  tsu-1.fa
21743255  GAAGGCAAGCGCGTGTGGCCTAATGGTTAAGAAATTAAGCCCCCTCTCCTCTTTCGCTTTCAGTTCCATCAAAANNNNNN  van-0.fa
 
21743335  AAAATAATAAATACGGAAGTAAAAGCGCAATAAGATAGAGAGATTCTCCGAGCGGGAAAACTCTTGAAACCTCTTTTTCT  chr3.fa
21743335  NNNNNNNNNNNNNNNNAAGTAAAAGCGCAATAAGATAGAGAGATTCTCCGAGCGGGAAAACTCTTGAAACCTCTTTNNNN  bay-0.fa
21743335  AAAATNNNNNNNNNNNAAGTAAAAGCGCAATAAGATAGAGAGATTCTCCGAGCGGGAAAACTCTTGAAACCTCTTTTTNN  bor-4.fa
21743335  NNNNNNNNNNNNNNNNNAGNAAAAGCGCNNNNNNNNNNNNNNNNTCTCCGAGCGGGAAAACTCNNNNNNNNNNNNNNNNN  br-0.fa
21743335  AANNNNNNAAATACGGAAGTAAAAGCGCAATAAGATAGAGAGATTCTCCGAGCGGGAAAACTCTTGAAACCTCTTTTNNN  bur-0.fa
21743335  NNNNNNNNNNNNNNNGAAGTAAAAGCGCAATAAGATAGAGAGATTCTCCGAGCGGGAAAACTCTTGNAACCTCTTTTTNN  c24.fa
21743335  NNNNNNNNNNNNNNNNNAGNAAAAGCGCNNNNNNNNNNNNNGATTCTCCGAGCGGGAAAACTCTTGNAACCTNNNNNNNN  col-0.fa
21743335  NNNNNNNNNNNNNNNNAAGTAAAAGCGNNNNNNNANNNNGAGATTCTCCGAGCGGGAAAACTCTTNNNNNNNNNNNNNNN  cvi-0.fa
21743335  NNNNNNNNNNNNNNNGAAGTAAAAGCGCAATAAGATAGAGAGATTCTCCGAGCGGGAAAACTCTTGNAACCTCTTTNNNN  est-1.fa
21743335  NNNNNNNNNNNNNNNNAAGTAAAAGCGCANNNNNNNNNNNNNNTTCTCCGAGCGGGAAAACTCTTGAAACCNCNNNNNNN  fei-0.fa
21743335  NNNNNNNNNNNNNNNGAAGTAAAAGCGCAATAAGATAGAGAGATTCTCCGAGCGGGAAAACTCTTGAAACCTCTTTNNNN  got-7.fa
21743335  NNNNNNNNNNNNNNNGAAGTAAAAGCGCAATAAGATAGAGAGATTCTCCGAGCGGGAAAACTCTTGNAACCTCTTTTNNN  ler-1.fa
21743335  NNNATAATANNNNNNGAAGTAAAAGCGCAATAAGATAGAGAGATTCTCCGAGCGGGAAAACTCTTGNAACCTCTTTTNNN  lov-5.fa
21743335  NNNNNNNNNNNNNNNGAAGTAAAAGCGCAATAAGATAGAGAGATTCTCCGAGCGGGAAAACTCTTGNAACCTCTTNNNNN  nfa-8.fa
21743335  NNNNNNNNNNNNNNNGAAGTAAAAGCGCAATAAGATAGAGAGATTCTCCGAGCGGGAAAACTCTTGAAACCTCTTTTTNN  rrs-10.fa
21743335  NNNNNNNNNNNNNNNGAAGTAAAAGCGCAATAAGATANAGAGATTCTCCGAGCGGGAAAACTCTTGAAACCTCTTTNNNN  rrs-7.fa
21743335  NNNNNNNNNNNNNNNGAAGTAAAAGCGCAATAAGANNGNGAGATTCTCCGAGCGGGAAAACTCTTGAAANNTCTNTNNNN  sha.fa
21743335  NNNNNNNNNNNNNNNNAAGTAAAAGCGCAATANNNNNNNNNGATTCTCCGAGCGGGAAAACTCTTGAAACCNNNNNNNNN  tamm-2.fa
21743335  NNNNNNNNNNNNNNNNAAGTAAAAGCGCAATAAGATNGAGAGATTCTCCGAGCGGGAAAACTCTTGAAACCTCTTTTNNN  ts-1.fa
21743335  NNNATNNNNNNNNNNGAAGTAAAAGCGCAATAAGATAGAGAGATTCTCCGAGCGGGAAAACTCTTGAAACCTCTTTTNNN  tsu-1.fa
21743335  NNNNNNNNNNNNNNGGAAGNAAAAGCGCAATAAGATAGAGAGATTCTCCGAGCGGGAAAACTCTTGNAACCTCTTTNNNN  van-0.fa
 
21743415  CATCTCTCTATCTACACTTTATCTTTCATCTCCTTCATCGTTCTCTTCTCAAGATATCGATTCCTTCAACTTTGTCTGAT  chr3.fa
21743415  NNNNNNNNNNNNNNNNCTTTNTNNTNCANCNNNNNNNTCGTTCTCTTCTCAAGATATCGATTCCTTCAACTTTGTCTGAT  bay-0.fa
21743415  NNNNNNNNNNNCTACANNNNNTCTTTCATCTCCNTCATCGTTCTCTTCTCAAGATATCGATTCCTTCAACTTTGTCTGAT  bor-4.fa
21743415  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNCCTTCAACTTTGNNNNAT  br-0.fa
21743415  NNNNNNNNNNNNNNNACTTTATCTTTCNTCNCCNNNNTCGTTCTCTTCTCAAGATATCGATTCCTTCAACTTTGTCTGAT  bur-0.fa
21743415  NNNNNNNNNNNNNNCACTTTATCTTTCANNNNNNNCATCGTTCTCTTCTCAAGATATCGATTCCTTCAACTTTGTCTGAT  c24.fa
21743415  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATTCCTTCAACTTTGTCTGAT  col-0.fa
21743415  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTTCTCTTCTCNNNNNNNNNNNTCCTTCAACTTTGTCTGAT  cvi-0.fa
21743415  NNNNNNNNNNNNNNNNNNNNNNNTTTCNNNNNNNNCATCGTTCTCTTCTCAAGATATCGATTCCTTCAACTTTGTCTGAT  est-1.fa
21743415  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTCNNNNNNNNNNNNNNCCTTCAACTTTGTCTGAT  fei-0.fa
21743415  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNCCNNNNTCGTTCTCTTCTCAAGATATCGATTCCTTCAACTTTGTCTGAT  got-7.fa
21743415  NNNNNNNNNNNNNNNNNNNNNNCTTTCNNNNNNNTCATCGTTCTCTTCTCAAGATATCGATTCCTTCAACTTTGTCTGAT  ler-1.fa
21743415  NNNNNNNNNNTCTACACTTTATCNNNNNNNNCCNTCATCGTTCTCTTCTCAAGATATCGATTCCTTCAACNTTGTCTGAT  lov-5.fa
21743415  NNNNNNNNNNNNNACACTTTATCTTTCATCNNNNNCATCGTTCTCTTCTCAAGATATCGATTCCTTCAACTTTGTCTGAT  nfa-8.fa
21743415  NNNNNNNNNNNNNNNNNNNNNNNTTTCNNNNNNNNCATCGTTCTCTTCTCAAGATATCGATTCCTTCAACTTTGTCTGAT  rrs-10.fa
21743415  NNNNNNNNNNNCTACANNNNNTCTTTCATCNNNNNCATCGTTCTCTTCTCAAGATATCGATTCCTTCAACTTTGTCTGAT  rrs-7.fa
21743415  NNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNTCGTTCNCTTCTCAAGNTATCGATTCCTTCAACTTTGTCTGAT  sha.fa
21743415  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCGTTCTCTTCTCAANNNATCGATTCCTTCAACTTTGTCTGAT  tamm-2.fa
21743415  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATCGTTCTCTTCTCAAGATATCGATTCCTTCAACTTTGTCTGAT  ts-1.fa
21743415  NNNNNNNNNNNNNNNNNNNNNNCTTTCNTCNCCNTCATCGTTCTCTTCTCAAGATATCGATTCCTTCAACTTTGTCTGAT  tsu-1.fa
21743415  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCGTTCTCTTCTCAAGATATCGATTCCTTCAACTTTGTCTGAT  van-0.fa
 
21743495  CCATGGAGGTTGATTACGGTGGATTTTCTATCAGGTGATTTGGTCACATTTCTTTATAATATCTTTGATTTTTGTTTATA  chr3.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bay-0.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACATTTCNNNNNNNNNNNNNNNNNNNTTGNNNNNA  bor-4.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCNNNNNNNNNNTTTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACATNNNNNNNNNNNNNNNNNNNTTTTTGTTTATA  bur-0.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACATTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTNNNNGGTGATTTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTNTCAGGTGATTTGGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACATTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACATTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACATTTCNNNNNNNNNNNNNNNNNNNNNNNNNATA  rrs-10.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNTA  rrs-7.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
21743495  CCATGGAGGTTGATTNCGGTGGATTTTCTATCAGGTGATTTGGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
21743575  ATGTGCTGCATTGGCGAGTTTTGAATTTTTTGATTTGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGAGTGATAAT  chr3.fa
21743575  NNNTGCTGCATTGGCGAGTTTNNNNNNNNNNNNNNNGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGAGTGATAAT  bay-0.fa
21743575  ATGTGCTGCATTGGCGAGTTTNNNNNNNNNNNNNTTGGCGAAATCGCAGAGAGTACACGGAGAAGGTAANGAGTGATAAT  bor-4.fa
21743575  NNNNNCTGCATTGGCGAGTTNNNNNNNNNNNNNNNNNNCGAAATCGCAGAGAGTACACGGAGAAGGNNNNNNNNNNNNNN  br-0.fa
21743575  ANGTGCTGCATTGGCGAGTTTNNNNNNNNNNNNNNTGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGAGTGANAAT  bur-0.fa
21743575  ATGTGCTGCATTGNCGAGTTTNNNNNNNNNNNNNNNGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGAGTGATAAT  c24.fa
21743575  NNNTGCTGCATTGGCGAGTTTNNNNNNNTTTGNTTTGGCGAAATCGCAGAGAGNACACGGAGAAGGTAAGNNNNNATAAT  col-0.fa
21743575  NNNTGCTGCATTGGCGAGTTTNNNNNNNNNNNNNNNGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGNNNNNNNNN  cvi-0.fa
21743575  ATGTGCTGCATTGNCGAGTTTNNNNNNNNNNNNNTTGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGAGTGATAAT  est-1.fa
21743575  NNNTGCTGCATTGGCGAGTTTNNNNNNNNNNNNNNNNNCGAAATCGCAGAGAGTACACGGAGAAGGTAAGNNNNNNNNNN  fei-0.fa
21743575  NNNNNNNNNNNNNNCGAGTTTNNNNNNNNNNNNNNNGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGAGTGATAAT  got-7.fa
21743575  NTGTGCTGCATTGNCGAGTTTNNNNNNNNNNNNNTTGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGAGTGATAAT  ler-1.fa
21743575  ATGTGCTGCATTGGCGAGTTTNNNNNNNNNNNNNTTGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGAGTGATAAT  lov-5.fa
21743575  NNNTGCTGCATTGGCGAGTTTNNNNNNNNNNNNNNNGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGAGTGATAAT  nfa-8.fa
21743575  ATGTGCTGCATTGGCGAGTTTNNNNNNNNNNNNNTTGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGAGTGATAAT  rrs-10.fa
21743575  ATGTGCTGCATTGGCGAGTTTNNNNNNNNNNNNNNTGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGAGTGATAAT  rrs-7.fa
21743575  NNNTGCTGCATTGGCGAGTTTNNNNNNNNNNNNNNNGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGAGTGANNNN  sha.fa
21743575  NNGTGCTGCATTGGCGAGTTTNNNNNNNNNNNNNNNNNCGAAATCGCAGAGAGTACACGGNGAAGGTANNNNNNNNNNNN  tamm-2.fa
21743575  NNNTGCTGCATTGNCGAGTTTNNNNNNNNNNNNNNNGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGAGTNNNNNT  ts-1.fa
21743575  NTGTGCTGCATTGGCGAGTTTNNNNNNNNNNNNNTTGGCGAAATCGCAGAGAGTACACGGAGAAGGTAANGAGTGATAAT  tsu-1.fa
21743575  NNNTGCTGCATTGGCGAGTTTNNNNNNNNNNNNNNNGGCGAAATCGCAGAGAGTACACGGAGAAGGTAAGGAGTGATNAT  van-0.fa
 
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTATTCAGTCTTTTCTTCCTCCCATTACTGTCTCCAAGTTCCGGTGGTG  chr3.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTNNNNNNNNNNNTNNNNNNNNCATTACNGTCTCCAAGTTCCGGTGGTG  bay-0.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTATNNNNNNNNTTCTTCCTCCCATTACTGTCTCCAAGTTCCGGTGGTG  bor-4.fa
21743655  NAACGAAAATGCTGGCCGTTCGCCGGAGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCTCCAAGTTCCGGTGGTG  br-0.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTATTCNNNNTTTTCTTCCTCCCANTACTGTCTCCAAGTTCCGGTGGTG  bur-0.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTATNNNNNNNNTTCTNNNNNCCATTNCTGTCTCCAAGTTCCGGTGGTG  c24.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCNNNNNNNNNNNNNNNNNNNNNNNNNTNCTGTCTCCAAGTTCCGGTGGTG  col-0.fa
21743655  NNNCGAAAATGCTGGCCGTTCGCCGGAGATCTTANNNNNNNNNNNNNNNNNNNNNNNNCTGTCTCCAAGTTCCGGTGGTG  cvi-0.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTANNNNNNNNTTTCTTCCTCCCATTACTGTCTCCAAGTTCCGGTGGTG  est-1.fa
21743655  NNACGAAAATGCTGGCCGTTCGCCGGAGATCTTANNNNNNNNNNNNNNNNNNNNNNNNNNGTCTCCAAGTTCCGGTGGTG  fei-0.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTANNNNNNNNTTTCTTCCTCCCATTACTGTCTCCAAGTTCCGGTGGTG  got-7.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTATNNNNNNNNTTCTTCCNCCCATTACTGTCTCCAAGTTCCGGTGGTG  ler-1.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTATNNNNNNNNTTCTTCCNCCCATTNCTGTCTCCAAGTTCCGGTGGTG  lov-5.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTANNNNNNNNTTTCTTCCTCCCNTTNCTGTCTCCAAGTTCCGGTGGTG  nfa-8.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTATNNNNNNNTTTCTTCCTCCCATTACTGTCTCCAAGTTCCGGTGGTG  rrs-10.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTATNNNNNNNTTTCTTCCTCCCATTACTGTCTCCAAGTTCCGGTGGTG  rrs-7.fa
21743655  NAACGAAAATGCTGGCCGTTCGCCGGAGATCTTANNNNNNNNNNTCTNNNNNNNNNTACTGTCTCCAAGTTCCGGTGGTG  sha.fa
21743655  NNACGAAAATGCTGGCCGTTCGCCGGAGATCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTCCAAGTTCCGGTGGTG  tamm-2.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTATNNNNNNNNNTNNNNNNNNNNTTACTGTCTCCAAGTTCCGGTGGTG  ts-1.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTATNNNNNNNNNNNNTCCTCCCATTACTGTCTCCAAGTTCCGGTGGTG  tsu-1.fa
21743655  GAACGAAAATGCTGGCCGTTCGCCGGAGATCTTANNNNNNNNNNNNNNNNNNCCATTACTGTCTCCAAGTTCCGGTGGTG  van-0.fa
 
21743735  GTCGCATGAGCTTGCTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  chr3.fa
21743735  GTCGCNTGAGNNNNNNNNTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  bay-0.fa
21743735  GTCGCATGAGCTTGCTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  bor-4.fa
21743735  GTCGCNTGAGCTTGCTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGNNNNTTCTGATCCGTCCTTTCGTCGGAAGGCCA  br-0.fa
21743735  GTCGCNTGAGNNNNNNNNTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTNNNNNANNNGGCCA  bur-0.fa
21743735  GTCGCNTGNNNNNNNTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  c24.fa
21743735  GTCGCATGAGCTTGCTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGNNNNTTCTGATCCGTCCTTTCGTCGGAAGGCCA  col-0.fa
21743735  GTCGCATGAGCTTGCTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  cvi-0.fa
21743735  GTCGCATGAGCTTGCTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  est-1.fa
21743735  GTCGCATGAGCTTNCTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGNTGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  fei-0.fa
21743735  GTCGCATGAGCTNGNNTNTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCAGAAGGCCA  got-7.fa
21743735  GTCGCNTGAGCTTGCTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  ler-1.fa
21743735  GTCGCATGAGCTTGCTTCTCTGCTNACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  lov-5.fa
21743735  GTCGCNTGAGCTTGCTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  nfa-8.fa
21743735  GTCGCATGAGNNNNNNTCTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  rrs-10.fa
21743735  GTCGCATGAGCTTGCTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  rrs-7.fa
21743735  GTCGCATGAGCTTGCTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  sha.fa
21743735  GTCGCATGAGCTTGCTTCTCTGCTTACGAAATCTCCGGTCNCTGTTGNTGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  tamm-2.fa
21743735  GTCGCATGAGCTNGCTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  ts-1.fa
21743735  GTCGCATGAGCTTGCTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  tsu-1.fa
21743735  GTCGCATGAGCTTGCTTCTCTGCTTACGAAATCTCCGGTCTCTGTTGATGATTCTGATCCGTCCTTTCGTCGGAAGGCCA  van-0.fa
 
21743815  AAGCAAAGACTAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGCCGAAGATCCAGTTAGCAGAAGAT  chr3.fa
21743815  AAGCAAAGACNAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTAGCAGAAGAT  bay-0.fa
21743815  AAGCAANGACTAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTAGCAGAAGAT  bor-4.fa
21743815  AAGCAAANNNNNNNNNNNNTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTAGCAGAAGAT  br-0.fa
21743815  AAGCAAAGACTNGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTNGCAGAAGAT  bur-0.fa
21743815  AAGCAANGACTAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTAGCAGAAGAT  c24.fa
21743815  AAGCAAAGACNAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGNTAGCAGAAGAT  col-0.fa
21743815  AAGCAAAGACNNNNCAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCANNNNNNAGAAGAT  cvi-0.fa
21743815  AAGCAAAGACTAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTAGCAGAAGAT  est-1.fa
21743815  AANCAAAGACNANNCNGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTNGNNGNAGAT  fei-0.fa
21743815  AAGCAANGACTAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTAGCAGAAGAT  got-7.fa
21743815  AAGCAANGACTAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTAGCAGAAGAT  ler-1.fa
21743815  AAGCAANGACTAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGNNNNCGAAGATCCAGNTAGCAGAAGAT  lov-5.fa
21743815  AAGCAAAGACTAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTAGCAGAAGAT  nfa-8.fa
21743815  AAGCAANGACTAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTAGCAGAAGAT  rrs-10.fa
21743815  AAGCAAAGACTAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTAGCAGAAGAT  rrs-7.fa
21743815  AAGCAAAGACTAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTAGCAGAAGAT  sha.fa
21743815  AAGCAAAGACNAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGNGCCGAAGATCCAGTTAGCAGNAGAT  tamm-2.fa
21743815  AAGCAANGACTAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGNGCGACGGCGNCGAAGATCCAGTTAGCAGAAGAT  ts-1.fa
21743815  AAGCAANGACTAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTAGCAGAAGAT  tsu-1.fa
21743815  AAGCAAAGACTAGACAGTGTAAAAAGCGCTCCATCGTCGAAATTTGTGCGACGGCGNCGAAGATCCAGTTAGCAGAAGAT  van-0.fa
 
21743895  TATGTGGTGCACAAGAAGAAGATCAAAACCACGAAATCCAAAGATTCCGGTGATCGGGAATTCACTAACAAGGTTCTTAT  chr3.fa
21743895  TATGTGGTGCACAAGAANRNNNNNNNNNCNACGAAANCCAAAGATTCCGGTGATCGGGAATTCACTAACAAGGTTCTNNN  bay-0.fa
21743895  TATGTGGTGCACAAGAAGRNNNNCAAAACCACGAAATCCAAAGATTCCGGTGATCGGGAATTCACTAACAAGGTTCTTAT  bor-4.fa
21743895  TATGTGGTGCACAAGNNNRNNNNNAAAACCACNNNNNCCAAAGATTCCGGTGATCGGGAATTCACTAANNNNNNNNNNNN  br-0.fa
21743895  TATGTGGNGCACAAGNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAATTCACTAACAAGGTTCNNNN  bur-0.fa
21743895  TATGTGGTGCACAAGAANRNNNNCAAAACCACGAAATCCAAAGATTCCGGTGATCGGGAATTCACTAACAAGGTTCTTAN  c24.fa
21743895  TATGTGGTGCANAAGNNNRNNNNNNAAACCACNNNNNNNNANGANTCCGGTGATCGGGAATTCACTAACAAGGNNNNNNN  col-0.fa
21743895  TATGTGGTGCACAAGAAGRNNNNNAAAACCACGAAATCCAAANATTCCGGTGATCGGGAATTCACTAACNNNNNNNNNNN  cvi-0.fa
21743895  TATGTGGTGCACAAGAAGRNNNNNNAAACCACGAAATCCAAAGATTCCGGTGATCGGGAATTCACTAACAAGGTTNNNNN  est-1.fa
21743895  TATGTGGTGCANAAGNANRNNNNNAAAACCACGAAANCCAAAGATTCCGGTGATCGGGAATTCACTAACAAGNNNNNNNN  fei-0.fa
21743895  TATGTGGTGCACAAGAAGRNNNNNAAAACCACNNNNNCCNNNANNNNCGGTGATCGGGAATTCACTAACAAGGTNNNNNN  got-7.fa
21743895  TATGTGGTGCANAAGNNNRNNNNNAAAACCACGAAATCCAAAGNTTCCGGTGATCGGGAATTCACTAACAAGGTTCTNAN  ler-1.fa
21743895  TATGTGGTGCACAAGANGRNNNNNAAAACCACNAAATCCAAAGNTTCCGGTGATCGGGAATTCACTAACAAGGTTCNNNN  lov-5.fa
21743895  TATGTGGTGCACAAGNANRNNNNNAAAACCACGAAATCCAAAGATTCCGGTGATCGGGAATTCACTAACAAGGTTCTTAT  nfa-8.fa
21743895  TATGTGGTGCACAAGAANRNNNNCAAAACCACGAAATCCAAAGATTCCGGTGATCGGGAATTCACTAACAAGGNNNNNNN  rrs-10.fa
21743895  TATGTGGTGCACAAGAAGRNNNNCAAAACCACGAAATCCAAAGATTCCGGTGATCGGGAATTCACTAACAAGGTTCTNNN  rrs-7.fa
21743895  TATGTGGTGCACAAGNANRNNNNNNAAACCACGAAANCCAAAGATTCCGGTGATCGGGAATTCACTAACAAGGTNNNNNN  sha.fa
21743895  TATGTGGTGCACAAGNNNRNNNNNNAAACNACGAAATCCANNNNNTCCGGTGATCGGGAATTCACTAACAAGNNNNNNNN  tamm-2.fa
21743895  TATGTGGTGCACAAGNNNRNNNNNAAAACCACGAAATCCAAAGATTCCGGTGATCGGGAATTCACTAACAAGGTNNNNNN  ts-1.fa
21743895  TATGTGGTGCACAAGAAGRNNNNCAAAACCACGAAATCCAAAGATTCCGGTGATCGGGAATTCACTAACAAGGTTCNNNN  tsu-1.fa
21743895  TATGTGGTGCACAAGAAGRNNNNNAAAACCACGAAATCCAAAGATTCCGGTGATCGGGAATTCACTAACAAGGTNNNNNN  van-0.fa
 
21743975  ACAAATAACTTTTAAATCTATGAAACTTATTATAGATGATGTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  chr3.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  bay-0.fa
21743975  NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  bor-4.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCNNN  br-0.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGATGTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  bur-0.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATGTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  c24.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  col-0.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  cvi-0.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  est-1.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAN  fei-0.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  got-7.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  ler-1.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  lov-5.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  nfa-8.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  rrs-10.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  rrs-7.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  sha.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  tamm-2.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  ts-1.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATGTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTCGAT  tsu-1.fa
21743975  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCAAATCTCTGGAGACGTTTGTGTAGGATTAAACTNNNN  van-0.fa
 
21744055  AGTCAATACTTAAGGAGAGCAAATTATAAAATCTTCTTATGTTGCAATTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  chr3.fa
21744055  AGTCAATACTTAAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNTGNAATTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  bay-0.fa
21744055  NGTCAATACTTAAGGAGAGNAAATTANNNNNNCTTNNNNNNTTGCAATTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  bor-4.fa
21744055  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC  br-0.fa
21744055  AGTCAATACTTAAGGAGAGCAAATTATAAANNNNNNNNATGTTGCAATTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  bur-0.fa
21744055  AGTCAATACTTAAGGAGAGCAAATTATNNNNNNNNNNNATGTTGCAATTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  c24.fa
21744055  AGNNNNNNNNNNNGGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTAAATCAATTGGNGCTTCTCTNTGTTCC  col-0.fa
21744055  ANTCAATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGNGCTTCTCTATGTTCC  cvi-0.fa
21744055  AGTCAATACTTAAGGAGANCNNANNNNNNNNNNNNNNNNNNNTNCAATTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  est-1.fa
21744055  AGTCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCTTCTCTNTGTTCC  fei-0.fa
21744055  AGTCAATACTTAAGGAGNGCAAATTANNNNNNNNNNNNNNNNNNNNNTTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  got-7.fa
21744055  AGTCAATACTTAAGGAGAGCAAATNANNNNNNNNNNTTATGTTGCAATTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  ler-1.fa
21744055  AGTCAATACTTAAGGAGAGCAAATTATNNNNNNNNNNNNNNNNGCAATTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  lov-5.fa
21744055  AGTCAATACTTAAGGAGAGCAAATTATNNNNNNNNNNNNNNTTGCAATTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  nfa-8.fa
21744055  AGTCAATACTTAAGGAGAGCAANNNNNNNNNNNNNNNNNTGTTGCAATTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  rrs-10.fa
21744055  AGTCAATACTTAAGGAGANCAAATTANNNNNNNNNNNNATGTTGCAATTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  rrs-7.fa
21744055  AGTCAATACTTAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTTTCTAAATCNATTGGTGCTTCTCTANGTTCC  sha.fa
21744055  AGTCAATACTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  tamm-2.fa
21744055  AGTCAATACTTAAGGAGNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  ts-1.fa
21744055  AGTCAATACTTAAGGANNNNNAANNNNNNNNNNNNNNNNNNTTGCAATTTTCTAAATCAATTGGTGCTTCTCTATGTTCC  tsu-1.fa
21744055  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN