Arabidopsis SNP Sequence Viewer

Chromosome : chr3 Coordinates : 10328981 - 10329073


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
10328981  CAAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  chr3.fa
10328981  CNAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  bay-0.fa
10328981  CAAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  bor-4.fa
10328981  NNAAGNNNNNAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAANGCATCTGATGGAGAAGAAGCTT  br-0.fa
10328981  CAAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATNNNNNNNNANNNNNNNNN  bur-0.fa
10328981  CAAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  c24.fa
10328981  CAAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  col-0.fa
10328981  CAAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  cvi-0.fa
10328981  CAAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  est-1.fa
10328981  CAAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  fei-0.fa
10328981  CAAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  got-7.fa
10328981  NNANNNNNNNNNNNNNNNNNNNNNNAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGNTGGAGAAGAAGCTT  ler-1.fa
10328981  CNAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  lov-5.fa
10328981  CAAAGANANAAGCTATNTGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  nfa-8.fa
10328981  CAAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGNTNNNANNNNNNNNN  rrs-10.fa
10328981  CAAAGAGANAAGCTATATGTTCNACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  rrs-7.fa
10328981  CNAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  sha.fa
10328981  CAAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  tamm-2.fa
10328981  CAAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  ts-1.fa
10328981  CAAAGAGAGAAGCTATATGTTCAACAATAACTCATGCTCATGCGTTGCCTTTGTGAATGCATCTGATGGAGAAGAAGCTT  tsu-1.fa
10328981  CAAANNNNNNNNNNCNNNNNNNNACAATAACTCATGCTCATGCGTTGCCTTTGTNNNNNNNNTNNNNNNNNNAGAAGCTT  van-0.fa
 
10329061  TTAACAGGTCATT   chr3.fa
10329061  TTAACAGGTCATT   bay-0.fa
10329061  TTAACAGGTCATT   bor-4.fa
10329061  TTAACAGGTCATT   br-0.fa
10329061  TTAACAGGTCATT   bur-0.fa
10329061  TTAACAGGTCATT   c24.fa
10329061  TTAACAGGTCATT   col-0.fa
10329061  TTAACAGGTCATT   cvi-0.fa
10329061  TTAACAGGTCATT   est-1.fa
10329061  TTAACAGGTCATT   fei-0.fa
10329061  TTAACAGGTCATT   got-7.fa
10329061  TTAACAGGTCATT   ler-1.fa
10329061  TTAACAGGTCATT   lov-5.fa
10329061  TTAACAGNNNNNN   nfa-8.fa
10329061  NTAACAGGTCATT   rrs-10.fa
10329061  TTAACAGGTCATT   rrs-7.fa
10329061  TTAACAGGTNNNN   sha.fa
10329061  TTAACAGGTCATT   tamm-2.fa
10329061  TTAACAGGTCATT   ts-1.fa
10329061  TTAACAGGTCATT   tsu-1.fa
10329061  TTAACAGGTCATT   van-0.fa
 
visited.