Arabidopsis SNP Sequence Viewer

Chromosome : chr3 Coordinates : 10329133 - 10329219


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
10329133  CTGCTTCATCTGAGAAGAAGGAAGCTGAAACAAGAAAGGGCGTAACAGAAATCGAGTGTTTGAAAGAGAAGCTCGAGGGG  chr3.fa
10329133  CNGNNNNNNNNNNNNNGAAGNNNRCNGAAACAAGAAAGGGCGTAACAGAAATCGAGTGRTNGAAAGAGAAGCTCGAGGNG  bay-0.fa
10329133  CTGCTTCATCTGAGAAGAAGGAARCNGAAACAAGAAAGGGCGTAACAGAAATCGAGTGRTNGAAAGAGAAGCTCGAGGGG  bor-4.fa
10329133  CNGCNNNNNNNNNNNNNNAGNNNRNNNAAACAAGAAAGGGCGTAACAGAAATCGAGNGRNNGAAAGAGAAGCTCGAGGGG  br-0.fa
10329133  CNGCTTCATCNGAGAAGAAGNNNRCNGAAACAAGAAAGGGCGTAACAGAAATCGAGTGRNNGAAAGAGAAGCTCGAGGGG  bur-0.fa
10329133  CNGCTTCATCNGAGAAGAAGNNARCNGAAACAAGAAAGGGCGTAACAGAAATCGAGTGRTNGAAAGAGAAGCTCGAGGGG  c24.fa
10329133  CTGCTTCATCNGAGAAGAAGGAARNNGAAACAAGAAAGGGCGTAACAGAAATCGAGTGRTNGAAAGAGAAGCTCGAGGGG  col-0.fa
10329133  NNNNNNNNNNNNNNNNNNNGNAARCNGAAACAAGAAAGGGCGTAACAGAAATCGAGNNRNNNNNGNNGAAGCTCGAGGGG  cvi-0.fa
10329133  CTGCTTCNNNNNNGAAGAAGGAARCNGAAACAAGAAAGGGCGTAACAGAAATCGAGTGRTNGAAAGAGAAGCTCGAGGGG  est-1.fa
10329133  CNGCTTCATCTGAGAAGAAGGAARCNNAAACAAGANNNNNNGTAACAGAAATCGAGTGRTNGAAAGAGAAGCTCGAGGGG  fei-0.fa
10329133  CNGCTTNNNNNNNGAAGAAGNAARNNNAAACAAGAAAGGGCGTAACAGAAATCGAGTGRTNGAAAGAGAAGCTCGAGGGG  got-7.fa
10329133  NNNNNNNNNNNNNNNNNNNNNNNRNNNAAACAAGAAAGGGCGTAACAGAAATCGANNNRNNNNNGNNNAAGCTCGAGGGG  ler-1.fa
10329133  NNNNNNNNNNNNNNNNNNNGNNNRCNNAAACAAGAAAGGGCGTAACAGAAATCGANNNRNNNNNGNNGAAGCTCGAGGGG  lov-5.fa
10329133  CNGCNNNNNNNNNNNNNAAGNNNRNNNAAACAAGAAAGGGCGTAACAGAAATCGAGNGRNNGAAAGAGAAGCTCGAGGGG  nfa-8.fa
10329133  CTGCTTCATCTGAGAAGAAGGAARCNGAAACAAGAAAGGGCGTAACAGAAATCGAGTGRTNGAAAGAGAAGCTCGAGGGG  rrs-10.fa
10329133  CNGCTTNNNNNNNNNAGAAGNANRCNNAAACAAGAAAGGGCGTAACAGAAATCGAGTGRTNGAAAGAGAAGCTCGAGGGG  rrs-7.fa
10329133  CNGCNTNNNNNNNNNNNNNGNNNRNNNAAACAAGAAANGGCGTAACAGAAATCGAGNGRTNGAAAGAGAAGCTCGAGGGG  sha.fa
10329133  CNGCTTNNNNNNNNAAGAAGNANRNNNAAACAAGAAAGGGCGTAACAGAAATCGANNNRNNNNNNNNGAAGCTCGAGGGG  tamm-2.fa
10329133  CNGCTTCATNTGAGAAGAAGNNNRNNNAAACAAGAAAGGGCGTAACAGAAATCGAGTGRTNGAAAGAGAAGCTCGAGGGG  ts-1.fa
10329133  NNNNNNNNNNNNNNNNNNAGGAARCNGAAACAAGAAAGGGCGTAACAGAAATCGAGTNRNNNNNGNAGAAGCTCGAGGGG  tsu-1.fa
10329133  CTGCTTCNNNNNNNAAGAAGNNNRCNNAAACAAGAAAGGGCGTAACAGAAATCGAGTGRTNGAAAGAGAAGCTCGAGGGG  van-0.fa
 
10329213  ATAAGAG   chr3.fa
10329213  ATAAGAG   bay-0.fa
10329213  ATAAGAG   bor-4.fa
10329213  ATAAGAG   br-0.fa
10329213  ATAAGAG   bur-0.fa
10329213  ATAAGAG   c24.fa
10329213  ATAAGAG   col-0.fa
10329213  ATAAGAG   cvi-0.fa
10329213  ATAAGAG   est-1.fa
10329213  ATAAGAG   fei-0.fa
10329213  ATAAGAG   got-7.fa
10329213  ATAAGAG   ler-1.fa
10329213  ATAAGAG   lov-5.fa
10329213  ATAAGAG   nfa-8.fa
10329213  ATAAGAG   rrs-10.fa
10329213  ATAAGAG   rrs-7.fa
10329213  ATAAGAG   sha.fa
10329213  ATAAGAG   tamm-2.fa
10329213  ATAAGAG   ts-1.fa
10329213  ATAAGAG   tsu-1.fa
10329213  ATAAGAG   van-0.fa
 
visited.