Arabidopsis SNP Sequence Viewer

Chromosome : chr3 Coordinates : 21745707 - 21746545


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTCTGAGAAGAATCTCAACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  chr3.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTNNNNNNNNNNGNNNNNNNNNTCCATGGGTCTGGTTTAGGGCCACCAAACAGNT  bay-0.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTCTGAGAAGAATCTCAACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  bor-4.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTNNNNNNNNNNGNNNNNNNNNNCCATGGGTCTGGTTTAGGGCCACCAAANNNNN  br-0.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTCNNNNNNNGNNNNNNACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  bur-0.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTNNNNNNNNGNNNNNAACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGNT  c24.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGNCTGAGAAGAATCTCNACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  col-0.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTNNNNNNNNNNGNNNNNNNNTTCCATGGGTCTGGTTTAGGGCCACCAAACAGNT  cvi-0.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTCTGAGAAGAATCTCAACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  est-1.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTCTGAGAAGAATCTCAACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  fei-0.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTCTGAGAAGAATCTCAACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  got-7.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTCTGAGAAGAATCTCAACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  ler-1.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTCTGAGAAGAATCTCAACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  lov-5.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTCTGAGAAGAATCTCAACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  nfa-8.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTNNNNNNNNGNNNNNNACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  rrs-10.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTCTGAGAAGAATCTCAACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  rrs-7.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTCTGAGAAGAATCTCAACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  sha.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTCTGNGAAGAATCTCAACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  tamm-2.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTNNNNNNNNNNGNNNNNNACTTCCATGGGTCTGGTTTAGGGCCACCAAANNNNN  ts-1.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTCTGAGAAGAATCTCAACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  tsu-1.fa
21745707  ATGTTGCTCGCTCGCGTCTTTTCCTTTGTCTNAGAAGAATCTCAACTTCCATGGGTCTGGTTTAGGGCCACCAAACAGTT  van-0.fa
 
21745787  TCACACTCAGCCAGCAACAACTACCTTTTCCATATGATTATAACAATGTTGATATTGGTCTCCTACCTGATGCTAGAAAA  chr3.fa
21745787  TNNNNTNNNNNNNNCAACAACTACCTNNNNNNNNNNNNNNNNNNNNNNNNNNTATTGGTCTCCTACCTGATGCTAGAAAA  bay-0.fa
21745787  TCACACTCAGCCAGCAACAACNACCTTTTCCNNNNNNNNNNNNNAATGTTGATATTGGTCTCCTACCTGATGCTAGAAAA  bor-4.fa
21745787  NNNNNTNNNNNNNNCAACAACNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTCTCCTACCTGATGCTAGAAAA  br-0.fa
21745787  NNNNNTNNNNNNAGCAACAACNACCTNNNNNNNNNNNNNNNNNNNNNNNNNATATTGGTCTCCTACCTGATGCTAGAAAA  bur-0.fa
21745787  TCACATNNNGCCAGCAACAACNACNNNNNNNNNNNNNNNNNNNNNNNNNNNATATTGGTCTCCTACCTGATGCTAGAAAA  c24.fa
21745787  TCACACTCAGCCAGCAACAACNACCTTTTNNNNNNNNNNNNNNNNNNNNNNNTNTTGGTCTCCTACCTGATGCTAGAAAA  col-0.fa
21745787  TCACNTNNNNNNANCAACAACNANNNNNNNNNNNNNNNNNNNNNNNNNNNNATATTGGTCTCCTACCTGATGCTAGAAAA  cvi-0.fa
21745787  TCACACTCAGCCAGCAACAACNACCTTTTCCANNNNNNNNNNNNNNNNTTGATATTGGTCTCCTACCTGATGCTAGAAAA  est-1.fa
21745787  TCACACTCAGCCAGCAACANNNNNNTTTNNNNNNNNNNNNNNNNNNNNTTGATATTGGTCTCCTACCTGATGCTAGAAAA  fei-0.fa
21745787  TCACACGNNNNNNNCAACAACNACCTTTTCCANNNNNNNNNNNNNNTGTTGATATTGGTCTCCTACCTGATGCTAGAAAA  got-7.fa
21745787  TCACACTCAGCCAGCAACAACNACCTTTTCCATATGNTTATANNAATGTTGATATTGGTCTCCTACCTGATGCTAGAAAA  ler-1.fa
21745787  TCACACTCAGCCAGCAACAACNACCTTTTCCATATGANTNNNNNNNTGTTGATATTGGTCTCCTACCTGATGCTAGAAAA  lov-5.fa
21745787  TCACACTCAGCCAGCAACAACNACCTTTTCCATNNNNNNNNNNNAATGTTGATATTGGTCTCCTACCTGATGCTAGAAAA  nfa-8.fa
21745787  TCACATNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATTGGTCTCCTACCTGATGCTAGAAAA  rrs-10.fa
21745787  TCACACTCAGCCAGCAACAACNACCTTTTCCATATNNNNNNNNNNNNGTTGATATTGGTCTCCTACCTGATGCTAGAAAA  rrs-7.fa
21745787  TCACACTCAGCCAGCAACAACNACCTTTTCCATNNNNNNNNNNNNNNNNNNATATTGGTCTCCTACCTGATGCTAGAAAA  sha.fa
21745787  TCACACTCAGCCAGCAACAACNACCTTTTCCANNNNNNNNNNNNNNNNNNNNTATTGGTCTCCTACCTGATGCTAGAAAA  tamm-2.fa
21745787  NNNNATNNNGCCAGCAACAACNANNNNNNNNNNNNNNNNNNNNNNNNNNNNATATTGGTCTCCTACCTGATGCTAGAAAA  ts-1.fa
21745787  TCACACTCAGCCAGCAACAACNACCTTTTCCATNNNNNNNNNNNNNNGTTGATATTGGTCTCCTACCTGATGCTAGAAAA  tsu-1.fa
21745787  TCACNCTCAGCCAGCAACAACNACCTTTTCNNNNNNNNNNNNNNNNNNNTGATATTGGTCTCCTACCTGATGCTAGAAAA  van-0.fa
 
21745867  CGATCTTTCGGATTGCCTTTATCGAGTACAAATTCTGCTAGACGGTCACAGACTCCTTGGGCTCAAAGTTCATCTGAGAA  chr3.fa
21745867  CGATCTTTCGGATTGCCTTNATCGAGTACAAATTCTGCTAGACGGTCACNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bay-0.fa
21745867  CGATCTTTCGGATTGCCTTTATCGAGTACAAATTCTGCTAGACGGTCACAGACTCCTTGGGCTCAAAGTTCATCTGANAA  bor-4.fa
21745867  CGATCTTTCGGATTGCCTTTATCGAGTACAAATTCTGCTAGACNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
21745867  CGATCTTTCGGATTGCCTTNATCGAGTACAAATTCTGCTAGACGGTNNNNNGNNNNNNNNCNNNNNNNNNNNNNNNNNNN  bur-0.fa
21745867  CGATCTTTCGGATTGCCTTTATCGAGTACAAATTCTGCTAGACGGTCACANGNNNNNNNNNNNNAAAGTTCATCTGANNA  c24.fa
21745867  CGATCTTTCGGATTGCCTTTATCGAGTACAAATTCTGCTAGACGGTCACAGACTCCTTGGGCTCAAAGTTCNNNNNNNNN  col-0.fa
21745867  CGATCTTTCGGATTGCCTTTATCGAGTACAAATTCTGCTAGACGGTCANNNGNNNNNNNNCNNNNNNNNNNNNNNNNNNN  cvi-0.fa
21745867  CGATCTTTCGGATTGCCTTTATCGAGTACAAATTCTGCTAGACGGTCACAGACTCCTTGGGCTCAAAGTTCATCTGAGAA  est-1.fa
21745867  CGATCTTTCGGATTGCCTTNATCGAGTACAAATTCTGCTAGACGGTCACAGACTCCTTGGGCTCAAAGTTCNNNNNNNNN  fei-0.fa
21745867  CGATCTTTNNNNNTGCCTTNATCGAGTACAAATTCTGCTAGACGGTCACAGACTCCTTGGGCTCAAAGTTCATCNNNNNN  got-7.fa
21745867  CGATCTTTCGGATTGCCTTNATCGAGTACAAATTCTGCTAGACGGTCACAGACTCCTTGGGCTCAAAGTTCATCTNNNNN  ler-1.fa
21745867  CGATCTTTCGGATTGCCTTNATCGAGTACAAATTCTGCTAGACGGTCACAGACTCCTTGGGCTCAAAGTTCNNNNNNNNN  lov-5.fa
21745867  CGATCTTTCGGATTGCCTTNATCGAGTACAAATTCTGCTAGACGGTCACAGACTCCTTGGGCTCAAAGTTCATCTGAGAA  nfa-8.fa
21745867  CGATCTTTCGGATTGCCTTNATCGAGTACAAATTCTGCTAGACGGTCACAGGNNNNNNNNCNNNAAAGTTCATCTGANAA  rrs-10.fa
21745867  CGATCTTTCGGATTGCCTTTATCGAGTACAAATTCTGCTAGACGGTCACAGACTCCTTGGGCTCAAAGTTCATCTGAGAA  rrs-7.fa
21745867  CGATCTTTCGGATTGCCTTTATCGAGTACAAATTCTGCTAGACGGTCACAGACTCCTTGGGCTCAAAGTTCANNNNNNNN  sha.fa
21745867  CGATCTTTCGGATTGCCTTNATCGAGTACAAATTCTGCTAGACGGTCACAGACTCCTTGGGCTCAAAGTTCNNNNNNNNN  tamm-2.fa
21745867  CGATCTTTCGGATTGCCTTNATCGAGTACAAATTCTGCTAGACGGTCACANGNNNNNNNNCNNNAAAGTTCATCTNNNNN  ts-1.fa
21745867  CGATCTTTCGGATTGCCTTNATCGAGTACAAATTCTGCTAGACGGTCACAGACTCCTTGGGCTCAAAGTTCATCTGAGAA  tsu-1.fa
21745867  CGATCTTTCGGATTGCCTTNATCGAGTACAAATTCTGCTAGACGGTCACAGACTCCTTGGGCTCAAAGTTCATCNNNNNN  van-0.fa
 
21745947  CTCTTGTTCTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGGGTCAAGGTTATCTTCGTCCATAA  chr3.fa
21745947  NNNNNRNNNTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATNNNNNNNNNNNNNNNNNNNNNNNNN  bay-0.fa
21745947  CTCTTRTTCTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGGGTCAAGGTTATCTTCGTCCATAA  bor-4.fa
21745947  NNNNNRNNNNNNNNNGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
21745947  NNNNTRTNNTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
21745947  CTNTTRTTCTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGNNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
21745947  NNNNNRNNNNNAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGGGTCAAGGTTATCTTCGTCCATAA  col-0.fa
21745947  NNNNTRTNNNGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTANNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
21745947  CTNTTRTTCTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGGGTCAAGGTTATCTTCGTCCATAA  est-1.fa
21745947  NNNNNRNNNNGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGGGTCAAGGTTATCTTCGTCCATAA  fei-0.fa
21745947  NNNTTRTTCTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGGGTCAAGGTTATCTTCGTCCATAA  got-7.fa
21745947  NNNTTRNTCTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGGGTCAAGGTTATCTTCGTCCATAA  ler-1.fa
21745947  NNNNNRNNNTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGGGTCAAGGTTATCTTCGTCCATAA  lov-5.fa
21745947  CTCTTRTTCTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGGGTCAAGGTTATCTTCGTCCATAA  nfa-8.fa
21745947  CTCTTRTTNTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGGNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
21745947  CTCTTRTTCTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGGGTCAAGGTTATCTTCGTCCATAA  rrs-7.fa
21745947  NNNNNRNNNTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGGGTCAAGGTTATCTTCGTCCATAA  sha.fa
21745947  NNNNNRNNNTGAATTGTCTTTCGTCAACNCCAGCGAGCAACTAACGTCCTTCTATGGGTCAAGGTTATCTTCGTCCATAA  tamm-2.fa
21745947  NNNTTRTTNTGAATTGTCTTTCGTCNNNNNNNNCGAGCAACTAACGTCCTTCTATGNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
21745947  CTCTTRTTCTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGGGTCAAGGTTATCTTCGTCCATAA  tsu-1.fa
21745947  NNNTTRTTNTGAATTGTCTTTCGTCAACCCCAGCGAGCAACTAACGTCCTTCTATGGGTCAAGGTTATCTTCGTCCATAA  van-0.fa
 
21746027  ACGTTGGAACTACAAATAAGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGCCA  chr3.fa
21746027  NNNNNNNNNNNNNNNCNNNNCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGCCA  bay-0.fa
21746027  ACGTTGGAACTACAAATAAGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGCCA  bor-4.fa
21746027  NNNNNNNNNNNNNNNCNNNNNNNNNNGCACCCGTAGAGGAGTATCNAATGAANAANCANAAAGTCCCCAAGTTGCTGCCA  br-0.fa
21746027  NNNNNNNNNNNNNNNCNNNNNNNNNNGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGNCN  bur-0.fa
21746027  NNGTTGGAACTACNNCNNNGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGCCA  c24.fa
21746027  ACGTTGGAACTACAAATAAGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGCCA  col-0.fa
21746027  NNNNNNNNNNNNNNNCNNNGCGGNTAGCACCCGTAGAGGAGTATCNNNNNNNNAACCATAAAGTCCCCAAGTTGCTGCCA  cvi-0.fa
21746027  ACGTTGGAACTACAAATAAGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGCCA  est-1.fa
21746027  ACGTTGGAACTACAAATAAGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAANCATAAAGTCCCCAAGTTGCTGCCA  fei-0.fa
21746027  ACGTTGGAACTACAAATAAGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCANAAAGTCCCCAAGTTGCTGCCA  got-7.fa
21746027  ACGTTGGAACTACAAATAAGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGCCA  ler-1.fa
21746027  ACGTTGGAACTACAAATAAGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGCCA  lov-5.fa
21746027  ACGTTGGAACTACAAATAAGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGCCA  nfa-8.fa
21746027  NNNTTGGAACTNNNNCNNNGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTNNNNNNCA  rrs-10.fa
21746027  ACGTTGGAACTACAAATAAGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGCCA  rrs-7.fa
21746027  ACGTTGGAACTACAAATAAGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGCCA  sha.fa
21746027  ACGTTGGAACTACAAATAAGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCANAAAGTCCCCAAGTTGCTGCCA  tamm-2.fa
21746027  NNNTTGGAACTACNNCNNNGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGCCA  ts-1.fa
21746027  ACGTTGGAACTACAAATAAGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGCCA  tsu-1.fa
21746027  ACGTTGGAACTACAAATAAGCGGGTAGCACCCGTAGAGGAGTATCCAATGAAGAACCATAAAGTCCCCAAGTTGCTGCCA  van-0.fa
 
21746107  ATGCAAGGTGGCTTAAATTATGTTAAAGAATTTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTCTAAGG  chr3.fa
21746107  ATGCGNGGTGGCNTAAATTANNNNNNNNNNNNTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTNNNNNN  bay-0.fa
21746107  ATGCAAGGTGGCTTAAATTATGNNNNNNNATTTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTCTAAGG  bor-4.fa
21746107  ATGCGAGGTNNNNNNNNNNNNNNNNNNNNNNNNNTTTGCAGGCCAGCAAATTAGGNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
21746107  NNNNGNNGTGGCTTAAATNNNNNNNNNNAATTTCTTTGCAGGCCAGCAAANTAGGAAATCACTAATCTAGGAGTCTNNNN  bur-0.fa
21746107  ATGCGAGGTGGCTTAAATTATNNNNNNNNNTTTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTCTANNN  c24.fa
21746107  ATGCAAGGTGGCTTAAATTNNNNNNNNNNNNNNCTTTGCAGGCCAGCAAATTAGGAAANNACTAATCNAGGAGTCTAAGG  col-0.fa
21746107  ATNNGNNNNGGNNNNNNNNNNNNNNNNNNNNNTCTTTGCAGGCCAGCAAATTAGGNAANCACTAATCTAGGANNNNNNNN  cvi-0.fa
21746107  ATGCAAGGTGGCTTAAATTANNNNNNNNNNNTTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTCTAAGG  est-1.fa
21746107  ATGCAAGGTGGCTTAANNNNNNNNNNNNNNNNTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGANNNNNAGG  fei-0.fa
21746107  ATGCAAGGTGGCTTAAATTATNNNNNNNNNTTTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTCTAAGG  got-7.fa
21746107  ATGCAAGGTGGCTTAAATTANNNNNNNNNATTTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTCTAAGG  ler-1.fa
21746107  ATGCAAGGTGGCTTAAATTATNNNNNNNAATTTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTCTAAGG  lov-5.fa
21746107  ATGCAAGGTGGCTTAAATTANNNNNNNNNNTTTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTCTAAGG  nfa-8.fa
21746107  ATGCGAGGTGGCTTAAATTANNNNNNNNNATTTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTCNNNNN  rrs-10.fa
21746107  ATGCAAGGTGGCTTAAATTANNNNNNNNAATTTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTCTAAGG  rrs-7.fa
21746107  ATGCAAGGTGGCTTAAATTATNNNNNNNNNTTTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTCTAAGG  sha.fa
21746107  ATGCAAGGTGGCTTAAATTANNNNNNNNNNNNTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTNTAAGG  tamm-2.fa
21746107  ATGCGAGGTGGCTTAAATTNNNNNNNNNNNNTTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTNNNNNN  ts-1.fa
21746107  ATGCAAGGTGGCTTAAATTANNNNNNNNNNNTTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTCTAAGG  tsu-1.fa
21746107  ATGCAAGGTGGCTTAAATTNNNNNNNNNNNNNTCTTTGCAGGCCAGCAAATTAGGAAATCACTAATCTAGGAGTCTAAGG  van-0.fa
 
21746187  GTATATAGCCTTGTATTGTTTGAACCATCCCTTGTGTGTTTTATGAATTATTTGGTGTTAGTGCCTTACTCGGAATGAAT  chr3.fa
21746187  NNNNNNNNNNNNNNNNNGTTTGAACCATCCCTTGTGTGTTTTNNNNNNNNNNNNNNNANNNTGCCTTACTCGGAATGAAT  bay-0.fa
21746187  GTATATAGCCTTGTATTGTTTGAACCATCCCTTGTGTGTTTTNTGNNNNNNNTGGTGTTAGTGCCTTACTCGGAATGAAT  bor-4.fa
21746187  NNNNNNNNNNNNNNNNNNTTTGAACCATCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTACTCGGAATGAAT  br-0.fa
21746187  NNNNNNNNNNNNNNNNNGTTTGAACCATCCCTTGTGTGTTTTNTGNNNNNNNNNNNNANNNNGCCTTACTCGGAATGAAT  bur-0.fa
21746187  NNNNNNNNNNNNNNNNNGTTTGAACCATCCCTTGTGTGTTNNNNNNNNNNNNNNNNNANNNTGCCTTACTCGGAATGAAT  c24.fa
21746187  GTATATAGCCTTGTATTGTTTGAACCATCCCTTGTGTGNNNNNNNNNNNNNNTGGTGTTNGTGCCTTACTCGGAATGAAT  col-0.fa
21746187  NNNNNNNNNNNNNNNNNGTTTGAACCATCCCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTCGGAATGAAT  cvi-0.fa
21746187  GTATATAGCCTTGTATTGTTTGAACCATCCCTTGTGTGTTTTNNNNNNNNNTTGGTGTTAGTGCCTTACTCGGAATGAAT  est-1.fa
21746187  GTATATAGCCTTGTNTTGTTTGAACCATCCCTTGTGNNNNNNNNNNNNNNNNNGGTGTTAGTGCCTTACTCGGAATGAAT  fei-0.fa
21746187  GTATATAGCCTTGTATTGTTTGAACCATCCCTTGTGTGTNNNNNNNNNNNNNTGGTGTTAGTGCCTTACTCGGAATGAAT  got-7.fa
21746187  GTATATAGCCTTGTATTGTTTGAACCATCCCTTGTGTGTTTTNTGAATTNTTTGGTGTTAGTGCCTTACTCGGAATGAAT  ler-1.fa
21746187  GTATATAGCCTTGTATTGTTTGAACCATCCCTTGTGTGTTTTNTGAATTNTTTGGTGTTAGTGCCTTACTCGGAATGAAT  lov-5.fa
21746187  GTATATAGCCTTGTATTGTTTGAACCATCCCTTGTGTGNNNNNNNNNNNNNNTGGTGTTAGTGCCTTACTCGGAATGAAT  nfa-8.fa
21746187  NNNNNNNNNNNNNNNNTGTTTGAACCATCCCTTGTGTGTNNNNNNNNNNNNNNNNNNANNNNGCCTTACTCGGAATGAAT  rrs-10.fa
21746187  GTATATAGCCTTGTATTGTTTGAACCATCCCTTGTGTGTTNNNNNNNNNNNNTGGTGTTAGTGCCTTACTCGGAATGAAT  rrs-7.fa
21746187  GTATATAGCCTTGTATTGTTTGAACCATCCCTTGTNTGTTNNNNNNNNNNTTTGGTGTTAGTGCCTTACTCGGAATGAAT  sha.fa
21746187  GTATATNGNNTNGTATTGTTTGAACCATCCCTTGTNNNNNNNNNNNNNNNNNNGGTGTTAGTGCCTTACTCGGAATGAAT  tamm-2.fa
21746187  NNNNNNNNNNNNNNNNNGTTTGAACCATCCCTTGTGTGNNNNNNNNNNNNNNNNNNNANNNNGCCTTACTCGGAATGAAT  ts-1.fa
21746187  GTATATAGCCTTGTATTGTTTGAACCATCCCTTGTGTGTNNNNNNNNNNNTTTGGTGTTAGTGCCTTACTCGGAATGAAT  tsu-1.fa
21746187  GTATATAGCCTTGTATTGTTTGAACCATCCCTTGTNNNNNNNNNNNNNNNNNNGGTGTTAGTGCCTTACTCGGAATGAAT  van-0.fa
 
21746267  TGTTGTACATGATTGCCTTGTTTAAGTCGTACAACACCAAAAGCTTCTAGATCCGTATAAGCATGCGAGTCCCCTCTAGA  chr3.fa
21746267  TGTTGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bay-0.fa
21746267  TGTTGTACATGATTGCCTTGTTTAAGTCGTACAACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAN  bor-4.fa
21746267  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
21746267  TGTTGTACATGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
21746267  TGTTGTACATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAN  c24.fa
21746267  TGTTGTACATGATTGCCTTGTTTAAGTCGTACAACACCAAAAGCTTCTAGATCCGTATAAGCATGCGAGTCCCCTCTAGA  col-0.fa
21746267  TGTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAN  cvi-0.fa
21746267  TGTTGTACATGATTGCCTTGTTTAAGTCGTACAACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
21746267  TGTTGTNCATGATTGCCTTGTTTAAGTCGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
21746267  TGTTGTACATGATTGCCTTGTTTAAGTCGTACAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAN  got-7.fa
21746267  TGTTGTACATGATTGCCTTGTTTAAGTCGTACAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAN  ler-1.fa
21746267  TGTTGTACATGATTGCCTTGTTTAAGTCGTACAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
21746267  TGTTGTACATGATTGCCTTGTTTAAGTCGTACAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAN  nfa-8.fa
21746267  TGTTGTACATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAA  rrs-10.fa
21746267  TGTTGTACATGATTGCCTTGTTTAAGTCGTACAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA  rrs-7.fa
21746267  TGTTGTACATGATTGCCTTGTTTAAGTCGTACAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAN  sha.fa
21746267  TGTTGNACATGATTGCCTTGTTTAAGTCGTACAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
21746267  TGTTGTACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
21746267  TGTTGTACATGATTGCCTTGTTTAAGTCGTACAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
21746267  TGTTGTACATGATTGCCTTGTTTAAGTCGTACAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
21746347  AATTCTGCGTTTGTTCTGTATACTACTATGATTCTATCTGGAATATCTGGATCATCTAGCTAGCAATTAAAGAACATAAA  chr3.fa
21746347  NNNNNNGCGTTTGTTCTGTNTACTACTATGATTCTATCTGGAATATCTGGATCATCTAGCTAGCAANNNNNNNNNNTAAA  bay-0.fa
21746347  NNNTCTGCGTTTGTTCTGTATACTACTATGATTCTATCTGGAATATCTGGATCATCTAGCTAGCAATTAAAGAACATAAA  bor-4.fa
21746347  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTGGATCATCTAGCNNNNNNNNNNNNNNNNNNAA  br-0.fa
21746347  NNNNNTGCGTTTGTTCTGNATACTACNATGATTCTATCTGGAATATCTGGATCATCTAGCTAGCAATTAAAGAACATAAA  bur-0.fa
21746347  NATTCTGCGTTTGTTCTGTATACTACTATGATTCTATCTGGAATATCTGGATCATCTAGCTAGCAATTAAAGAACATAAA  c24.fa
21746347  AATTCTGCGTTTGTTNTGNNNNNNNNNNNNNNNNTATCTGGAATATCTGGATCATCTAGCTANNNNNNNNNGAACANAAA  col-0.fa
21746347  NNNNNNNNGTTTGTTCTGNNNNNNNNNNNNNNNNNATCTGGAATATCTGGATCATCTAGCTNGCNATNNNNNAACATAAA  cvi-0.fa
21746347  NNNTCTGCGTTTGTTCTNNNNNNNACNATGATTCTATCTGGAATATCTGGATCATCTAGCTAGCAATTAAAGAACATAAA  est-1.fa
21746347  NNNNNNNNGTTTGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNATATCTGGATCATCTAGCTAGCAATNNNNNAACATAAA  fei-0.fa
21746347  NNNNNTGCGTTTGTTCTGTATACTACTATGATTCTATCTGGAATATCTGGATCATCTAGCTAGCAATTNAAGAACATAAA  got-7.fa
21746347  NNTTCTGCGTTTGTTCTGTATACTACTATGATTCTATCTGGAATATCTGGATCATCTAGCTAGCAATTAAAGAACATAAA  ler-1.fa
21746347  NNNNNTGCGTTTGTTCTGTATACTACTATGATTCTATCTGGAATATCTGGATCATCTAGCTAGCAATTAAAGAACATAAA  lov-5.fa
21746347  NNTTCTGCGTTTGTTCTGTATACTACTATGATTCTATCTGGAATATCTGGATCATCTAGCTAGCAATTAAAGAACATAAA  nfa-8.fa
21746347  AATTCTGCGTTTGTTCTGTATACTACTATGATTCTATCTGGAATATCTGGATCATCTAGCTAGCAATTAAAGAACATAAA  rrs-10.fa
21746347  ANTTCTGCGTTTGTTCTGTATACTACTATGATTCTATCTGGAATATCTGGATCATCTAGCTAGCAATTNAAGAACATAAA  rrs-7.fa
21746347  NNNNNTGCGTTTGTTCTGTNNNNNNCTATNATTCTATCTGGAATATCTGGATCATCTAGCTAGCAATTAAANAACATAAA  sha.fa
21746347  NNNNNNNCGTTTGTTCTNNNNNNNNNNNNNNNNNNNNCTGGAATATCTGGATCATCTAGCTAGCAATNNNNNNNCATAAA  tamm-2.fa
21746347  NNNNNNNCGTTTGTTCTGTNTACTACNNNNNNNCTATCTGGAATATCTGGATCATCTAGCTAGCAATTNAAGAACATAAA  ts-1.fa
21746347  NNNTCTGCGTTTGTTCTGTATACTACTATGATTCTATCTGGAATATCTGGATCATCTAGCTAGCAATTNAAGAACATAAA  tsu-1.fa
21746347  NNNNNTGCGTTTGTTCTGTNNNNNNNNNNNNTNCTATCTGGAATATCTGGATCATCTAGCTAGCAATTANAGAACATAAA  van-0.fa
 
21746427  TCGGCATCAAGATAAATTTGTTCTTAGTGTCATGTATCAATTTGGAATCCATAAACATTCTTATATGCACGTTATTCAAG  chr3.fa
21746427  TCGGCATCNNNNNNNNNNNNNNNNNNNNGTCATGTATCAATTTGGAATCCATAANNNNTCTTATATGCACGTTATTCAAG  bay-0.fa
21746427  TCGGCATCAAGANNNNNNNNNNNNNNNNGTCATGTATCAATTTGGAATCCATAAACATTCTTATATGCACGTTATTCAAG  bor-4.fa
21746427  TCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTCAAG  br-0.fa
21746427  TCGGCATCAAGNNNNNNNNNNNNNNNNTGTCATGTATCAATTTGGAATCCATAAACATTCTTATATGCACGTTATTCAAG  bur-0.fa
21746427  TCGGCATCAANNNNNNNNNNNNNNNNNNGTCATGTATCAATTTGGAATCCATAAACATTCTTATATGCACGTTATTCAAG  c24.fa
21746427  TCGGCATCAAGATNNNNNNNNNNTNNNNNTCATGTATCAATTTGGAATCCNNNNNNNNNNNNNTATGCACGTTATTCAAG  col-0.fa
21746427  TCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTATCAATTTGGAANNNNNNNNNNNNNNNNNATGCACGTTATTCAAG  cvi-0.fa
21746427  TCGGCATCANNNNNNNNNNNNNNNNNNNGTCATGTATCAATTTGGAATCCATAAACNTTCTTATATGCACGTTATTCAAG  est-1.fa
21746427  TCGGCNNNNNNNNNNNNNNNNNNNNNNNGTCATGTATCAATTTGGAATCCNNNNNNNNNNNNNNATGCNCGTTATTCAAG  fei-0.fa
21746427  TCGGCATCANNNNNNNNNNNNNNNNNNNGTCATGTATCAATTTGGAATCCATAAACATTCTTATATGCACGTTATTCAAG  got-7.fa
21746427  TCGGCATCAAGNNNNNNNNNNNNNNNNNGTCATGTATCAATTTGGAATCCATAAACATTCTTATATGCACGTTATTCAAG  ler-1.fa
21746427  TCGGCATCAAGNNNNNNNNNNNNNNNNNGTCATGTATCAATTTGGAATCCATNAACATTCTTATATGCACGTTATTCAAG  lov-5.fa
21746427  TCGGCATCNNNNNNNNNNNNNNNNNNNNGTCATGTATCAATTTGGAATCCATAAACATTCTTATATGCACGTTATTCAAG  nfa-8.fa
21746427  TCGGCATCAANNNNNNNNNNNNNNNNNNGTCATGTATCAATTTGGAATCCATAAACATTCTTATATGCACGTTATTCAAG  rrs-10.fa
21746427  TCGGCATCANNNNNNNNNNNNNNNNNNNGTCATGTATCAATTTGGAATCCATAAACATTCNTATATGCACGTTATTCAAG  rrs-7.fa
21746427  TCGGCATCNNNNNNNNNNNNNNNNNNNNNTCATGTATCAATTTGGAATCCATNAACATTCTTATATGCACGTTATTCAAG  sha.fa
21746427  TCGGCANNNNNNNNNNNNNNNNNNNNNNNNNNTGTATCAATTTGGAANNNNNNNNNNNNNNNNNNTGCACGTTATTCAAG  tamm-2.fa
21746427  TCGGCATCANNNNNNNNNNNNNNNNNNTGTCATGTATCAATTTGGAANCNNNNNNNNNTNTTATATGCACGTTATTCAAG  ts-1.fa
21746427  TCGGCATCANNNNNNNNNNNNNNNNNNNGTCATGTATCAATTTGGAATCCATAAACATTCTTATATGCACGTTATTCAAG  tsu-1.fa
21746427  TCGGCATNNNNNNNNNNNNNNNNNNNNNGTCATGTATCAATTTGGAANCCATAAACNTTCTTATATGCNCGTTATTCAAG  van-0.fa
 
21746507  ATCACCAGGAAGAATCTTGAGTGAGATAGTAAAATAAAG   chr3.fa
21746507  ATCANNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNN   bay-0.fa
21746507  ATCACCAGGAAGAATCTTGAGTGAGATAGNANAATAAAN   bor-4.fa
21746507  ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN   br-0.fa
21746507  ATCNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNN   bur-0.fa
21746507  ATCACNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNN   c24.fa
21746507  ATCACCAGGAAGAATCTTGANNNNNNNNNNNNNNNNNNN   col-0.fa
21746507  ATCACCAGGAAGAATCTTGAGTGNNNNNNNNNNNNNNNN   cvi-0.fa
21746507  ATCACCAGGAAGAATCTTGAGTGAGNNNNNNNNNNNNNN   est-1.fa
21746507  ATCACCAGGAAGAATCTTGNNNNNNNNNNNNNNNNNNNN   fei-0.fa
21746507  ATCACCAGGAAGAATCTTGAGTGAGATNGTAANNNNNNN   got-7.fa
21746507  ATCACCAGGAAGAATCTTGAGTGAGATANNNNNNNNNNN   ler-1.fa
21746507  ATCACCAGGAAGAATCTTGAGTGAGATANNNNNNNNNNN   lov-5.fa
21746507  ATCACCAGGAAGAATCTTGAGTGAGATANNNNNNNNNNN   nfa-8.fa
21746507  ATCACNNNNNNNNGNNNNNNNNNNNNNNNNNNNANNNNN   rrs-10.fa
21746507  ATCACCAGGAAGAATCTTGAGTGAGATAGNANNANNNNN   rrs-7.fa
21746507  ATCACCAGGAAGAATCTTGAGTGANNNNNNNNNNNNNNN   sha.fa
21746507  ATCACCAGGAAGAATCTTGAGNNNNNNNNNNNNNNNNNN   tamm-2.fa
21746507  ATCNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNN   ts-1.fa
21746507  ATCACCAGGAAGAATCTTGAGTGANNNNNNNNNNNNNNN   tsu-1.fa
21746507  ATCACCAGGAAGAATCTTGAGTGNNNNNNNNNNNNNNNN   van-0.fa
 
visited.