Arabidopsis SNP Sequence Viewer

Chromosome : chr3 Coordinates : 3069358 - 3071145


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
3069358  TGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGGTGGCTCCGGCGGTGCATAGCCGACAATTGGGA  chr3.fa
3069358  TGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGGTGGCTCCGGCGGTGCATAGCCGACAATTGGGA  bay-0.fa
3069358  TGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGGTGGCTCCGGCGGTGCATAGCCGACAATTGGGA  bor-4.fa
3069358  TGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGANGNNNNNNNCGGCGGTGCATAGCCGACAATTGGGA  br-0.fa
3069358  NGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGNNNNCTCCGGCGGTGCATAGCCGACAATTGGGA  bur-0.fa
3069358  TGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGANGNNGNCTCCGGCGGTGCATAGCCGACAATTGGGA  c24.fa
3069358  TGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGANGNNGNCTCCGGCGGTGCATAGCCGACAATTGGGA  col-0.fa
3069358  TGAAGANGAAGGAGATGCAGGCAATAGNNNTNNNNNAGCCGACGANGGNGGNTCCGGCGGTGCATAGCCGACAATTGGGA  cvi-0.fa
3069358  TGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGGTGGCTCCGGCGGTGCATAGCCGACAATTGGGA  est-1.fa
3069358  TGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGGTGNCTCCGGCGGTGCATAGCCGACAATTGGGA  fei-0.fa
3069358  TGAAGANGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGGTGNCTCCGGCGGTGCATAGCCGACAATTGGGA  got-7.fa
3069358  TGAAGANNNNGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGANGNNGNCTCCGGCGGTGCATAGCCGACAATTGGGA  ler-1.fa
3069358  TGANNNNNNAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGGTGNCTCCGGCGGTGCATAGCCGACAATTGGGA  lov-5.fa
3069358  TGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGGTGNCTCCGGCGGTGCATAGCCGACAATTGGGA  nfa-8.fa
3069358  TGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGNNNNNNNCGGCGGTGCATAGCCGACAATTGGGA  rrs-10.fa
3069358  TGAAGANGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGGTGNCTCCGGCGGTGCATAGCCGACAATTGGGA  rrs-7.fa
3069358  TGAAGNTGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGGTGNCTCCGGCGGTGCATAGCCGACAATTGGGA  sha.fa
3069358  TGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGANGNNGNCTCCGGCGGTGCATAGCCGACAATTGGGA  tamm-2.fa
3069358  TGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGNNNNCTCCGGCGGTGCATAGCCGACAATTGGGA  ts-1.fa
3069358  TGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGGTGGCTCCGGCGGTGCATAGCCGACAATTGGGA  tsu-1.fa
3069358  TGAAGATGAAGGAGATGCAGGCAATAGAGACGTCGCAGCCGACGACGGTGGCTCCGGCGGTGCATAGCCGACAATTGGGA  van-0.fa
 
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGAGGAGATGTCTAGAACTGCGTTATCTGC  chr3.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGNGGAGATGTCTAGAACTGCGTTATCTGC  bay-0.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGAGGAGATGTCTAGAACTGCGTTATCTGC  bor-4.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGNGGAGATGTCTAGAACTGCGTTATCTGC  br-0.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGNGGAGATGTCTAGAACTGCGTTATCTGC  bur-0.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGAGGAGATGTCTAGAACTGCGTTATCTGC  c24.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGAGGAGATGTCTAGAACTGCGTTATCTGC  col-0.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGANNNNNNNATGTCTAGAACTGCGTTATCTGC  cvi-0.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGAGGAGATGTCTAGAACTGCGTTATCTGC  est-1.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGAGGAGATGTCTAGAACTGCGTTATCTGC  fei-0.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGNGGAGATGTCTAGAACTGCGTTATCTGC  got-7.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCNGCAGCCAAATGTCGAAGGAAGATGNGGAGATGTCTAGAACTGCGTTATCTGC  ler-1.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGNNNNNNNGATGTCTAGAACTGCGTTATCTGC  lov-5.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGAGGAGATGTCTAGAACTGCGTTATCTGC  nfa-8.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGAGGAGATGTCTAGAACTGCGTTATCTGC  rrs-10.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGAGGAGATGTCTAGAACTGCGTTATCTGC  rrs-7.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGNGGAGATGTCTAGAACTGCGTTATCTGC  sha.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGAGGAGATGTCTAGAACTGCGTTATCTGC  tamm-2.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGAGGAGATGTCTAGAACTGCGTTATCTGC  ts-1.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGATGAGGAGATGTCTAGAACTGCGTTATCTGC  tsu-1.fa
3069438  GCTCAGTTGTCGGGAAGTATGAGTTTCAGCAGCCAAATGTCGAAGGAAGANNNNNNNNTGTCTAGAACTGCGTTATCTGC  van-0.fa
 
3069518  GTTTAGAGCGAAAGAAGAAGAGATCGAGAAGAAGAAGATGGAGATTAGGGAAAGGGTTCAAGCTCAGCTTGGTCGTGTCG  chr3.fa
3069518  GTTTAGAGCGAAAGAAGAANNNRRRRRRRRRRRRRRRNNNNNGATTAGGGAAAGGGTTCANRRRRRRRRRRRTCGTGNRG  bay-0.fa
3069518  GTTTAGAGCGAAAGAAGANNNNRRRRRRRRRRRRRRRNNNNAGATTAGGGAAAGGGTTCAARRRRRRRRRRRTCGTGTRG  bor-4.fa
3069518  GTTTAGAGCGAAAGAAGAAGNNRRRRRRRRRRRRRRRNNNGAGATTAGGGAAAGGGTTCANRRRRRRRRRRRTCGTGTRG  br-0.fa
3069518  GTTTAGAGCGAAAGAAGAAGNNRRRRRRRRRRRRRRRNNNNNNNTTAGGGAAAGGGTTCANRRRRRRRRRRRTCGTGTRG  bur-0.fa
3069518  GTTTAGAGCGAAAGAAGAAGNNRRRRRRRRRRRRRRRNNNNNGATTAGGGAAAGGGTTCAARRRRRRRRRRRTCGTGTRG  c24.fa
3069518  GTTTAGAGCGAAAGAAGAAGNNRRRRRRRRRRRRRRRNNNGAGATTAGGGAAAGGGTTCAARRRRRRRRRRRTCGTGTRG  col-0.fa
3069518  GTTTAGAGCGAAAGAAGANNNNRRRRRRRRRRRRRRRNNNNNNNTTAGGGAAAGGGTTCANRRRRRRRRRRRTCGTGTRG  cvi-0.fa
3069518  GTTTAGAGCGAAAGAAGANGNNRRRRRRRRRRRRRRRNNNNNGATTAGGGAAAGGGTTCAARRRRRRRRRRRTCGTGTRG  est-1.fa
3069518  GTTTAGAGCGAAAGAAGAAGNNRRRRRRRRRRRRRRRNNNGAGATTAGGGAAAGGGTTCAARRRRRRRRRRRTCGTGTRG  fei-0.fa
3069518  GTTTAGAGCGAAAGAAGANGNNRRRRRRRRRRRRRRRNNNNAGATTAGGGAAAGGGTTCAARRRRRRRRRRRTCGTGTRG  got-7.fa
3069518  GTTTAGAGCGAAAGAAGAANNNRRRRRRRRRRRRRRRNNNNAGATTAGGGAAAGGGTTCANRRRRRRRRRRRTCGTGNRG  ler-1.fa
3069518  GTTTAGAGCGAAAGAAGANNNNRRRRRRRRRRRRRRRNNNNNNNTTAGGGAAAGGGTTCANRRRRRRRRRRRTCGTGNRG  lov-5.fa
3069518  GTTTAGAGCGAAAGAAGAANNNRRRRRRRRRRRRRRRNNNNNGATTAGGGAAAGGGTTCAARRRRRRRRRRRTCGTGTRG  nfa-8.fa
3069518  GTTTAGAGCGAAAGAAGAAGNNRRRRRRRRRRRRRRRNNNNNGATTAGGGAAAGGGTTCAARRRRRRRRRRRTCGTGTRG  rrs-10.fa
3069518  GTTTAGAGCGAAAGAAGANNNNRRRRRRRRRRRRRRRNNNNNNATTAGGGAAAGGGTTCAARRRRRRRRRRRTCGTGTRG  rrs-7.fa
3069518  GTTTAGAGCGAAAGAAGAAGNNRRRRRRRRRRRRRRRNNNNNNNNNAGGGAAAGGGTTCANRRRRRRRRRRRTCGTGTRG  sha.fa
3069518  GTTTAGAGCGAAAGAAGAANNNRRRRRRRRRRRRRRRNNNNNGATTAGGGAAAGGGTTCAARRRRRRRRRRRTCGTGTRG  tamm-2.fa
3069518  GTTTAGAGCGAAAGAAGAANNNRRRRRRRRRRRRRRRNNNNNNATTAGGGAAAGGGTTCAARRRRRRRRRRRTCGTGTRG  ts-1.fa
3069518  GTTTAGAGCGAAAGAAGAAGNNRRRRRRRRRRRRRRRNNNGAGATTAGGGAAAGGGTTCAARRRRRRRRRRRTCGTGTRG  tsu-1.fa
3069518  GTTTAGAGCGAAAGAAGANNNNRRRRRRRRRRRRRRRNNNNNNNTTAGGGAAAGGGTTCAARRRRRRRRRRRTCGTGNRG  van-0.fa
 
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTATATTGGTTATTTCATATATAAAAAAAAGATTGTT  chr3.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATNTATATTNNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  bay-0.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTATATTNNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  bor-4.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTATNTTGGNNNNNNNNNNNNNNNNNNNNNNNRNRNN  br-0.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTATATTGGNNNNNNNNNNNNNNNNNNNNNNNRNRNN  bur-0.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTNTATNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  c24.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTATNTNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  col-0.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTANCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  cvi-0.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTATATTGNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  est-1.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTATATTGNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  fei-0.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTNTATTNNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  got-7.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTATATTGGNNNNNNNNNNNNNNNNNNNNNNNRNRNN  ler-1.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  lov-5.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  nfa-8.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  rrs-10.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  rrs-7.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTNTANNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  sha.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTATATTGNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  tamm-2.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTATNTNNNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  ts-1.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTATATTGNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  tsu-1.fa
3069598  AAGAAGAGACTAAGCGTCTTGCTTTGATCCGTGAGGTATGTATCTATATTGNNNNNNNNNNNNNNNNNNNNNNNNRNRNN  van-0.fa
 
3069678  TTTTTTTTGGAGAATTGTGCTTCAATTTTGGTTTTTGTTATGGAAATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  chr3.fa
3069678  NNNRNNNTGGNGAATTGTGCTTCAATTTTGGTTNNNNNNRNNNNNATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  bay-0.fa
3069678  NNNRNNTTGGNGAATTGTGCTTCAATTTTGGTTTNNGNNRNNGNAATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  bor-4.fa
3069678  NNNRNNNTGGNGAATTGNGCTTCNATTTTGGTTTNNNNNRNNGAAATTTTTTGGATTGGGNTGTGAAATTGAACATTTGG  br-0.fa
3069678  NNNRNNNTGGNGAATTGTGCTTCAATTTTGGTTTTNNNNRNGNAAATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  bur-0.fa
3069678  NNNRNNNTGGAGAATTGTGCTTCAATTTTGGTTTNNNNNRNNNNNNNTTTTTGGATTGGGATGTGAAATTGAACATTTGG  c24.fa
3069678  NNNRNNNTGGAGAATTGTGCTTCAATTTTGGTTTNNNNNRNNNAAATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  col-0.fa
3069678  NNNRNNNTGGNGAATTGTGCTTNNATTTTGGTTTNNNNNRNNNNNNNTTTTTGGATTGGGATGTGAAATTGAACATNNNN  cvi-0.fa
3069678  NNNRNNTTGGAGAATTGTGCTTCAATTTTGGTTTNNNNNRNNNAAATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  est-1.fa
3069678  NNNRNNNTGGAGAATTGTGCTTCAATTTTGGTTTTNNNNRNNNAAATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  fei-0.fa
3069678  NNNRNNTTGGAGAATTGTGCTTCNATTTTGGTTTTTNNNRNNNAAATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  got-7.fa
3069678  NNNRNNNTGGNGAATTGTGCTNNNNNNTTGGTTTNNNNNRNNNAAATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  ler-1.fa
3069678  NNNRNNNNGGNNNNTTGTGCTNNNNNNTTGGNNNNNNNNRNNNAAATTTTTTGGATTGGGNTGTGAAATTGAACATTTGG  lov-5.fa
3069678  NNNRNNNTGGNGAATTGTGCTTCANTTTTGGTTTNNNNNRNNNANATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  nfa-8.fa
3069678  NNNRNNNTGGNGAATTGTGCTTCAATTTTGGTTTTNNNNRNNNAAATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  rrs-10.fa
3069678  NNNRNNTTGGAGAATTGTGCTTCAATTTTGGTNNNNNNNRNNNANATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  rrs-7.fa
3069678  NNNRNNNNNNNGAATTGNGCNTCNNTTTTGGNNNNNNNNRNNNNNNNTTTTTGGATTGGGATGTGAAATTGAACATTTGG  sha.fa
3069678  NNNRNNNTGGAGAATTGNGCTTCAATTTTGGTTTTNNNNRNNNAAATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  tamm-2.fa
3069678  NNNRNNNTGGAGAATTGTGCTTCAATTTTGGTTNNNNNNRNNNAAATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  ts-1.fa
3069678  NNNRNTTTGGAGAATTGTGCTTCAATTTTGGTTTTNNNNRNNNAAATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  tsu-1.fa
3069678  NNNRNNNTGGAGAATTGTGCTTCNATTTTGGNNNNNNNNRNNNAAATTTTTTGGATTGGGATGTGAAATTGAACATTTGG  van-0.fa
 
3069758  GGTTTTTATATTGTATAGAATGTGGATTTAATTCATGTTTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  chr3.fa
3069758  GGTTTTTNTNNNNNNNNNNATGTGGATTTAATNNNNNNNNAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  bay-0.fa
3069758  GGTTNNNNNNNNNNNNNNNNNGTGGATTTAATTNNNNNTTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  bor-4.fa
3069758  GGTTNNNNNNNNNNNNNNAATGTGGATTTAATTCATNTTTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  br-0.fa
3069758  GGTTTTTNTATTGTATAGAATGTGGATTTAATTCATNTTTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  bur-0.fa
3069758  GGTTNNNNNNNNNNNNNNNNTGTGGATTTAATTNNNNNNNAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  c24.fa
3069758  GGTTNNNNNNNNNNNNNNAATGTGGATTTAATTCATGTTTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  col-0.fa
3069758  NNNNNNNNNNNNNNNNNNNNNNNNNANTNNNNNNNNNNNNAAGGGGAAATTGTAGNNNNNNNGNNNNNNNNNNTTCAAGA  cvi-0.fa
3069758  GGTTTTNNNNNNNNNNNNNATGTGGATTTAATTNATGTTTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  est-1.fa
3069758  GGTTNNNNNNNNNNNNNNNATGTGGATTTAATTNNNNNNTAAGGGGAAATTGTAGGACCCAACTGTTGGAAANTTCAAGA  fei-0.fa
3069758  GGTTNNNNNNNNNNNNNNNNNNTGGATTTAATTCATNTTTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  got-7.fa
3069758  GGTTTTTNTANNNNNNNGAATGTGGATTTAATTNNNNNTTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  ler-1.fa
3069758  GGTTNNNNNNNNNNNNNNNATGTGGATTTNANNNNNNNTTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  lov-5.fa
3069758  GGTNNNNNNNNNNNNNNNNNNNTGGATTTANNNNNNNNNNNNNNGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  nfa-8.fa
3069758  GGTTTNNNNNNNNNNNNNNNNNTGGATTTAATNNNNNNNTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  rrs-10.fa
3069758  GGTTNNNNNNNNNNNNNNNNNGTGGATTTAANNNNNNNTTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  rrs-7.fa
3069758  GNTNNNNNNNNNNNNNNNNATGTGGATTTAATTCANNTNTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  sha.fa
3069758  GGTTNNNNNNNNNNNNNNNNNGTGGATTTAATTCNNNNTTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  tamm-2.fa
3069758  GGTTTTNNTANNNNNNNNAATGTGGATTTAATTCATNTTTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  ts-1.fa
3069758  GGTTNNNNNNNNNNNNNNNATGTGGATTTAATTCANGTTTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  tsu-1.fa
3069758  GGTTTTTNTNNNNNNNNNNATGTGGATTTAATTCATGTTTAAGGGGAAATTGTAGGACCCAACTGTTGGAAATTTCAAGA  van-0.fa
 
3069838  TCTGACAATTGCATTGAACAAATTCTTTTATAATTTTCCTTTGGTTTTTGTGTGGTTTATGCCATTTGGGGAGAAAATTT  chr3.fa
3069838  TCTGACAATTGCATTGAACAANNNNNNNNNNNNNNNNNNNNNGRNNTTNGTRTGGTTTNTGCCATTTGGGGAGAAAATTT  bay-0.fa
3069838  TCTGACAATTGCATTGAACAAATNNNNNNNNNNNNNNNNNNNNRNTTTNGTRTGGTTTATGCCATTTGGGGAGAAAATTT  bor-4.fa
3069838  TCTGACAATTGCATTGAACAANNNNNNNNNNNNNNNNNNNNNNRNNNTNGNRNNGTTTATGCCATTTGGGGAGAAAATTT  br-0.fa
3069838  TCTGACAATTGCATTGAACAAATTCTTTNNNNNNNNNNNNNTNRTTTTNGNRNGGTTTNTGCCATTTGGGGAGAAAATTT  bur-0.fa
3069838  TCTGACAATTGCATTGAACAAATTNNNNNNNNNNNNNNNNNNGRNTNTNGNRTGGTTTATGCCATTTGGGGAGAAAATTT  c24.fa
3069838  TCTGACAATTGCATTGAACAAATTNNNNNNNNNNNNNNNNNNNRTTTTNGTRTGGTTTATGCCATTTGGGGAGAAAATTT  col-0.fa
3069838  TCTGACAATTGCATTGAACNNNNNNNNNNNNNNNNNNNNNNNNRNNNTNNNRNNNTTTNTGCCATTTGGGGAGAAAATTT  cvi-0.fa
3069838  TCTGACAATTGCATTGAACAAATTNNNNNNNNNNNNNNNNNNNRTTTTNGTRTGGTTTATGCCATTTGGGGAGAAAATTT  est-1.fa
3069838  TCTGACAATTGCATTGAACAAANNNNNNNNNNNNNNNNNNNTGRNTTTNGNRTGGTTTATGCCATTTGGGGAGAAAATTT  fei-0.fa
3069838  TCTGACAATTGCATTGAACAAATNNNNNNNNNNNNNNNNNNNNRNNTTNGNRTGGTTTNTGCCATTTGGGGAGAAAATTT  got-7.fa
3069838  TCTGACAATTGCATTGAACAAANNNNNNNNNNNNNNNNNNNNNRNNNTNGNRTGGTTTNTGCCATTTGGGGAGAAAATTT  ler-1.fa
3069838  TCTGACAATTGCATTGAACAANNNNNNNNNNNNNNNNNNNNNNRNNNTNNNRNNNTTTNTGCCATTTGGGGAGAAAATTT  lov-5.fa
3069838  TCTGACAATTGCATTGAACNNNNNNNNNNNNNNNNNNNNNNNNRNNNTNGNRNNGTTTNTGCCATTTGGGGAGAAAATTT  nfa-8.fa
3069838  TCTGACAATTGCATTGAACAANNNNNNNNNNNNNNNNNNNNNNRNNNTNGTRTGGTTTATGCCATTTGGGGAGAAAATTT  rrs-10.fa
3069838  TCTGACAATTGCATTGAACAAANNNNNNNNNNNNNNNNNNNNNRNNNTNGTRNNNTTTATGCCATTTGGGGAGAAAATTT  rrs-7.fa
3069838  TCTGACAATTGCATTGAACAANNNNNNNNNNNNNNNNNNNNNNRNNNTNNTRNNNTTTNTGCCATTTGGGGAGAAAATTT  sha.fa
3069838  TCTGACAATTGCATTGAACAAANNNNNNNNNNNNNNNNNNNNNRNNNTNGTRTGGTTTNTGCCATTTGGGGAGAAAATTT  tamm-2.fa
3069838  TCTGACAATTGCATTGAACAANNNNNNNNNNNNNNNNNNNNNNRNNTTNGTRNGGTTTATGCCATTTGGGGAGAAAATTT  ts-1.fa
3069838  TCTGACAATTGCATTGAACAAANNNNNNNNNNNNNNNNNNNNGRTTTTTGTRTGGTTTATGCCATTTGGGGAGAAAATTT  tsu-1.fa
3069838  TCTGACAATTGCATTGAACAANNNNNNNNNNNNNNNNNNNNNNRNTNTNGNRTGGTTTATGCCATTTGGGGAGAAAATTT  van-0.fa
 
3069918  TGGGGCTTTTGTGTTTGTTTTAGGATTTTAAATGATCAATAGCAAGTAAACCTGGATTTGCTAAAAATAAGCTATTTGGA  chr3.fa
3069918  TGGGGCTTNNNNNNNNNNNTTAGGATTTTAAATGATNAATAGCAAGTAAACCTGGATTTGCTAAAAATNNNNNNNNNNGA  bay-0.fa
3069918  TGGGGCTTTTGTNTNNGNNNNNNNNTNNTNAATGATCAATNGCAAGTAAACCTGGATTTGCTAAAAATAANNNNNNNGNA  bor-4.fa
3069918  TGGGGCTTTNNNNNNNNNNNNNGGATTTTAAATGATCAATAGCAAGTAAACCTGGATTTGCTAAAAATAAGCTNTTTGGA  br-0.fa
3069918  TGGGGCTTNNNNNNNNNNNNNNGGATTTTAAATGATCAATAGCAAGTAAACCTGGATTTGCTAAAAATAAGCTATTTGGA  bur-0.fa
3069918  TGGGGCTTTTGTNNNNNNNNNNNNNNNNTNAATGATCAATAGCAAGTAAACCTGGATTTGCTAAAAATAANNNNNNNGNA  c24.fa
3069918  TGGGGCTTNNNNNNNNNNNNNNGGATTTTAAATGATCAATAGCAAGTAAACCTGGATTTGCTAAAAATAAGCTNTTTGGA  col-0.fa
3069918  TGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGTAAACCTGGATTTGCTAAAAANNNNNNNNNNNNN  cvi-0.fa
3069918  TGGGGCTTTNNNNTTTGTTTTAGGATTTTAAATGATCAATAGCAAGTAAACCTGGATTTGCTAAAAATAANNNNNNTGGA  est-1.fa
3069918  TGGGGCTTTNNNNNNNNNNNNNGGATTTTNAATGATCAATAGCAAGTAAACCTGGATTTGCTAAAAATAAGCNNNNNNNA  fei-0.fa
3069918  TGGGGCTTTNNNNNNNNNNNNNGGATTTTNAATGATCAANAGCAAGTAAACCTGGNNNNNNNNTNNNNNNNNNNNNNGGA  got-7.fa
3069918  TGGGGNTNNNNNNNNNNNNNNNGGATTTTAAATGATCAATAGCAAGTAAACCTGGATTTGCTAAAAATAAGCTNTTTGGA  ler-1.fa
3069918  TGGGGNNNNNNNNNNNNNNNNNNNNTNNTNAATGATCNNTNGCAAGTAAACCTGGATTTGCTAAAAATAANNNNNNNNNN  lov-5.fa
3069918  TGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATNNNNNGCAAGTAAACCTGGATTTGCTAAANNNNNNNNNNNNNNN  nfa-8.fa
3069918  TGGGGCTTTTGNNNNNGNNNNNGGATTTTAAATGATCAATAGCAAGTAAACCTGGATTTGCTAAAAATAAGNNNNNNGGA  rrs-10.fa
3069918  TGGGGCTTTNNNNTNNGNNNNNGGNNNNNNAATGATCNATAGCAAGTAAACCTGGATTTGCTAANNNNNNNNNNNNNNGN  rrs-7.fa
3069918  TGNGGCTNNNNNNNNNNNNNNNGGNNNNNNNNTGATCAATAGCAAGTAAACCTGGATTTGCTAAAAATAAGNNNNNNNNN  sha.fa
3069918  TGGGGNTNNNNNNNNNNNNNNNGGATTTTAAATGATNAATAGCAAGTAAACCTGGATTTGCTAAAAATAANNNNNNNNNN  tamm-2.fa
3069918  TGGGGNNNNNNNNNNNNNNNNNGGATTTTAAATGATCAATAGCAAGTAAACCTGGATTTGCTAAAAATAAGNNNNNNNGA  ts-1.fa
3069918  TGGGGCTTTNNNNNNNNNNNNNGGATTTTAAATGATCAATAGCAAGTAAACCTGGATTTGCTAAAAATAAGNNNNNTGGA  tsu-1.fa
3069918  TGGGGCTTNNNNNNNNNNNNNNGGATTTTAAATGATCAATAGCAAGTAAACCTGGATTTGCTAAAAATAAGNNNNNNGGA  van-0.fa
 
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  chr3.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  bay-0.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  bor-4.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  br-0.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  bur-0.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  c24.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  col-0.fa
3069998  NNNNNNNNNNNNNNNNNNGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTNTGAATCTGGTCTTAGTCTCTGGTNNN  cvi-0.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  est-1.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  fei-0.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  got-7.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  ler-1.fa
3069998  NNNNNNTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTNN  lov-5.fa
3069998  NNNNNNTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  nfa-8.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  rrs-10.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  rrs-7.fa
3069998  NNNAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTNAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  sha.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  tamm-2.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  ts-1.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  tsu-1.fa
3069998  TTAAGTTTTTTGTGAAAAGAACCATTTGCTTCTTCTGGGTGATGTTAAAGTTTATGAATCTGGTCTTAGTCTCTGGTTTT  van-0.fa
 
3070078  AGTACTTTTTCCCCTCAATTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  chr3.fa
3070078  AGTACTTNNNNNCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  bay-0.fa
3070078  AGTACTTTTTNCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  bor-4.fa
3070078  AGTACTTTTTCCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  br-0.fa
3070078  AGTACTTTTTCCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  bur-0.fa
3070078  AGTACTTTTTCCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  c24.fa
3070078  AGTACTTTTTCCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  col-0.fa
3070078  NNNNNNNNNNNNNNNNNNNNNATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  cvi-0.fa
3070078  AGTACTTTTTCCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  est-1.fa
3070078  AGTACTTTTTCCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  fei-0.fa
3070078  AGTACTTTTTCCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  got-7.fa
3070078  AGTACTTTTTCCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  ler-1.fa
3070078  NNNNNNNNNNNNNNNNNANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  lov-5.fa
3070078  AGTACTTTTTNCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  nfa-8.fa
3070078  AGTACTTNTTCCCCTCAATTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  rrs-10.fa
3070078  AGTACTTNNNNCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  rrs-7.fa
3070078  AGTACTTTNNNNNNTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  sha.fa
3070078  AGTACTTTTTCCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  tamm-2.fa
3070078  AGTACTTTTTCCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  ts-1.fa
3070078  AGTACTTTTTCCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  tsu-1.fa
3070078  AGTACTTTTTCCCCTCAANTTATGGGCAGAACAGTGAAAGTTTCTACATTTATAGCACTACTTGATAGAGATTAGCTCTG  van-0.fa
 
3070158  TGGATCAAAGCTCTTTCCTTTCTATGAAAAGAACAATTTGCTTTTCCTGGGTGATGTTATGTTGATGACTAAGAAGCTCA  chr3.fa
3070158  TGGATCAAAGCTCTTTCCTTTCTNNNNNNNGAACNATTTGCTTTTCCTGGGTGATGTTATGTTGATGACTAAGAAGCTCA  bay-0.fa
3070158  TGGATCAAAGCTCTTTCCTTTNNNNNNNNAGAACAATTTGCTTTTCCTGGGTGATGTTATGTTGATGACTAAGAAGCTCA  bor-4.fa
3070158  TGGATCAAAGCTCTTTCCTTTCTATGAAAAGAACAATTTGCTTTTCCTGGGTGATGTTATGTTGATGACTAAGAAGCTCA  br-0.fa
3070158  TGGATCAAAGCTCTTTCCTTTCTATGAAAAGAACAATTTGCTTTTCCTGGGTGATGTTATGTTGATGACTAAGAAGCTCA  bur-0.fa
3070158  TGGATCAAAGCTCTTTCCNTTCTNNNNNNAGAACAATTTGCTTTTCCTGGGTGATGTTNNNNNNNNNNNNNNNAAGCTCA  c24.fa
3070158  TGGATCAAAGCTCTTTCCTTTCTATNANNANAACAATTTGCTTTTCCTGGGTGATGTTATGTTGATGACTAAGAAGCTCA  col-0.fa
3070158  TGGATCAAAGCTCTTTCCTTNNNNNNNNNNNNNNNNNNNGCTTTTCCTGGGTGATGTTATGTTGATGACTAAGAAGCTCA  cvi-0.fa
3070158  TGGATCAAAGCTCTTTCCTTTCTATGNAAAGAACAATTTGCTTTTCCTGGGTGATGTTATGTTGATGACTAAGAAGCTCA  est-1.fa
3070158  TGGATCAAAGCTCTTTCCTTTCTATGAAAANAACAATTTGCTTTTCCTGGGTGATGTTATGTTGATGACTAAGAAGCTCA  fei-0.fa
3070158  TGGATCAAAGCTCTTTCCTTTCTATNNAAAGAANAATTTGCTTTTCCTGGGTGATGTTNTGTTGATGACTAAGAAGCTCA  got-7.fa
3070158  TGGATCAAAGCTCTTTCCTTTCTATGAAAAGAACAATTTGCTTTTCCTGGGTGATGTTNNNNCNNTGACNAAGAAGCTCA  ler-1.fa
3070158  TGGATCAAAGCTCTTTCCNNNNNNNNNNNNNNNNNNNNNGCTTTTCCTGGGTGATGTTNTGTTGATGACTAAGAAGCTCA  lov-5.fa
3070158  TGGATCAAAGCTCTTTCCTNNNNNNNNNNNNNNNNATTTGCTTTTCCTGGGTGATGTTATGTTGATGACTAAGAAGCTCA  nfa-8.fa
3070158  TGGATCAAAGCTCTTTCCTTTCTNNNNNNAGAACNATTTGCTTTTCCTGGGTGATGTTATGTTGATGACTAAGAAGCTCA  rrs-10.fa
3070158  TGGATCAAAGCTCTTTCCTTTCNANNNNNNNNNNNANTTGCTTTTCCTGGGTGATGTTNTGTTGATGACTAAGAAGCTCA  rrs-7.fa
3070158  TGGATCAAAGCTCTTTCCTTTCTANNNNNAGAACAATTTGCTTTTCCTGGGTGATGTTATGTTGATGACTAAGAAGCTCA  sha.fa
3070158  TGGATCAAAGCTCTTTCCTTTCTNNNNNNNGAACAATTTGCTTTTCCTGGGTGATGTTATGTTGATGACTAAGAAGCTCA  tamm-2.fa
3070158  TGGATCAAAGCTCTTTCCTTTCTATGAAAAGAACAATTTGCTTTTCCTGGGTGATGTTNTGTTGATGACTAAGAAGCTCA  ts-1.fa
3070158  TGGATCAAAGCTCTTTCCTTTCTNTGNAAAGAACAATTTGCTTTTCCTGGGTGATGTTATGTTGATGACTAAGAAGCTCA  tsu-1.fa
3070158  TGGATCAAAGCTCTTTCCTTTCTATNAAAAGAACAATTTGCTTTTCCTGGGTGATGTTNTGTTGATGACTAAGAAGCTCA  van-0.fa
 
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGATTAGCTGATCCCATGAGGAAAGAAGTTGCTATGGTTAGGAAGAAGATT  chr3.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRNGGARRAAGATT  bay-0.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRAGGARRAAGATT  bor-4.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRNGGARRAAGATT  br-0.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRNGGARRAAGATT  bur-0.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRNGGARRAAGATT  c24.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGNRNGGARRAAGATT  col-0.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRNGGARRAAGATT  cvi-0.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRNGGARRAAGATT  est-1.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRAGGARRAAGATT  fei-0.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRAGGARRAAGATT  got-7.fa
3070238  GTGGTNAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRNGGARRAAGATT  ler-1.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARNAAGTTGCTATGGTRNGGARRAANATT  lov-5.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATNGTRNGGARRAAGATT  nfa-8.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRNGGARRAAGATT  rrs-10.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRNGGARRAAGATT  rrs-7.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGNTRNGGARRAAGATT  sha.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRNGGARRAAGATT  tamm-2.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRNGGARRAAGATT  ts-1.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRAGGARRAAGATT  tsu-1.fa
3070238  GTGGTTAAACTGCATTTCAGGAACTTGAAGGRTTRGCTGATCCCATGAGGAARGAAGTTGCTATGGTRAGGARRAAGATT  van-0.fa
 
3070318  GATTCTGTCAACAAAGAATTAAAGCCATTGGGCCATACAGTTCAGAAAAAGGTAAGGCTAAAACATAATCAAATCCATTG  chr3.fa
3070318  GNTTCTRNCRACNAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCTAAAACANAATCAAATCCATTG  bay-0.fa
3070318  GATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCTAAAACANAATCAAATCCATTG  bor-4.fa
3070318  GATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCTAAAACANNNNCAAATCCATTG  br-0.fa
3070318  GATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCTAAAACATAATCAAATCCATTG  bur-0.fa
3070318  GATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCNNNNACATAATNAAATCCATTG  c24.fa
3070318  GATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCTAAAACATAATCAAATCCATTG  col-0.fa
3070318  GATTNTRNCRNNNAAGNNNRRRAGNCATTGGGRRATACAGTTCAGAAANNNNNNNNNNNNNNNNNNNNNNNAATCCATTG  cvi-0.fa
3070318  GATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCTAAAACANAATCAAATCCATTG  est-1.fa
3070318  GATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCTAAAACATAATCAAATCCATTG  fei-0.fa
3070318  GATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCTAAAACANNNNCAAATCCATTG  got-7.fa
3070318  GATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCTAAAACANAATCAAATCCATTG  ler-1.fa
3070318  GATTCNRNCRNNAAAGNANRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCNAAAANNNNNNNAAATCCATTG  lov-5.fa
3070318  GATTCTRNCRNCAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCTAAAANNNNNNCAAATCCATTG  nfa-8.fa
3070318  GATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCTAAAACANAATCAAATCCATTG  rrs-10.fa
3070318  GATTCTRNCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCTAAAACANNNNCAAATCCATTG  rrs-7.fa
3070318  GATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCNAAAANNNNNNCAAATCCATTG  sha.fa
3070318  GATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCTAAAACANAATCAAATCCATTG  tamm-2.fa
3070318  GATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGTAAGGCTAAAACANAATCAAATCCATTG  ts-1.fa
3070318  GATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGNAAGGCTAAAACATAATCAAATCCATTG  tsu-1.fa
3070318  GATTCTRNCRACAAAGAANRRRAGCCATTGGGRRATACAGTTCAGAAAAAGGNAANNNNNNNNNNNNNNNAAATCCATTG  van-0.fa
 
3070398  ACCTGTGTTTAAAATATGTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  chr3.fa
3070398  ACCTGTGTTTANNNRNNNTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  bay-0.fa
3070398  ACCTGTGTTTANANRNNNTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  bor-4.fa
3070398  ACCTGTGTTTAAAARNTGTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  br-0.fa
3070398  ACCTGTGTTTAAAARNTGTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  bur-0.fa
3070398  ACCTGTGTTTNANNRNNNTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  c24.fa
3070398  ACCTGTGTTTAAANRNNGTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  col-0.fa
3070398  ACCTGTGTTTANNNRNNNNNTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  cvi-0.fa
3070398  ACCTGTGTTTAAAARNTNTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  est-1.fa
3070398  ACCTGTGTTTAAAARNTNTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  fei-0.fa
3070398  ACCTGTGTTTAANNRNNNTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  got-7.fa
3070398  ACCTGTGTTTAAANRNNNTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  ler-1.fa
3070398  ACCTGTGTTTNNNNRNNNNNNNNNNNNNNNNNTNNNNNCNAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  lov-5.fa
3070398  ACCTGTGTTTANNNRNNNTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  nfa-8.fa
3070398  ACCTGTGTTTAAANRNNNTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  rrs-10.fa
3070398  ACCTGTGTTTANNNRNNNTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  rrs-7.fa
3070398  ACCTGTGTTTANNNRNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCAGGAACGAGAGTACA  sha.fa
3070398  ACCTGTGTTTAAANRNNNTTTTGNNNNNNNNNTAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  tamm-2.fa
3070398  ACCTGTGTTTANNNRNNNTTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  ts-1.fa
3070398  ACCTGTGTTTAAAARNNNNTTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  tsu-1.fa
3070398  ACCTGTGTTTNNNNRNNNNNTTGTTGAGGATTCAGATGCTAAGCTGGTTTATTTACGCAACTTGCAGGAACGAGAGTACA  van-0.fa
 
3070478  AAGAAGCTCTTGAAGCATTCAACGAAAAGAACAGGGAGAAGGTGCAGCTAATCACCAGGCTAATGGAGGTTAGTCAACAA  chr3.fa
3070478  AAGARGCNCTTGAAGCARRRRARGARARGAACNRNNAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  bay-0.fa
3070478  AAGARGCTCTTGAAGCARRRRARGARARGAACNRGGAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  bor-4.fa
3070478  AAGARGCTCTTGAAGCARRRRARGARARGAACNRNGAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  br-0.fa
3070478  AAGARGCNCTTGAAGCARRRRARGARARGAACNRNGAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  bur-0.fa
3070478  AAGARGCTCTTGAAGCARRRRARGARARGAACARGGAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  c24.fa
3070478  AAGARGCTCTTGAAGCARRRRARGARARGAACARGGAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  col-0.fa
3070478  AAGARGCTCTTGAAGCARRRRARGARARGAACNRNNAGAAGGTGCAGCTAATCACCARGCTAATGGAGNNNNNNNNNNNN  cvi-0.fa
3070478  AAGARGCTCTTGAAGCARRRRARGARARGAACNRGGAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  est-1.fa
3070478  AAGARGCTCTTGAAGCARRRRARGARARGAACNRGGAGAAGGTGCAGCTAATCACCARNCTAATGGAGGTTAGTCAACAA  fei-0.fa
3070478  AAGARGCTCTTGAAGCARRRRARGARARGAACARGGAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  got-7.fa
3070478  AAGARGCNCTTGAANCARRRRARGARARGANCNRNGAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  ler-1.fa
3070478  AAGARGCNCTTGAANCARRRRARGARARNANNNRNNNGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  lov-5.fa
3070478  AAGARGCTCTTGAAGCARRRRARGARARGAACNRNGAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  nfa-8.fa
3070478  AAGARGCTCTTGAAGCARRRRARGARARGAACNRGGAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  rrs-10.fa
3070478  AAGARGCTCTTGAAGCARRRRARGARARGAACNRGGAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  rrs-7.fa
3070478  AAGARGCNCTTGAANCARRRRARGARARGAACNRGGAGAAGGTGCAGCTAATCACCARNCTAATGGAGGTTAGTCAACAA  sha.fa
3070478  AAGARGCTCTTGAAGCARRRRARGARARGAACNRNGAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  tamm-2.fa
3070478  AAGARGCTCTTGAAGCARRRRARGARARGAACNRGNAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  ts-1.fa
3070478  AAGARGCTCTTGAAGCARRRRARGARARGAACARGGAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  tsu-1.fa
3070478  AANARNCTCTTGAAGCARRRRARGARARNNANNRGGAGAAGGTGCAGCTAATCACCARGCTAATGGAGGTTAGTCAACAA  van-0.fa
 
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTTTGG  chr3.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTGG  bay-0.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTGG  bor-4.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRNGG  br-0.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTGG  bur-0.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGNNNNNNNCNNNNNNNGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTGG  c24.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTGG  col-0.fa
3070558  NNNNNNNAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTNN  cvi-0.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTGG  est-1.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATNNRNNN  fei-0.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTGG  got-7.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGNATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGANTTRTNN  ler-1.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGNATGATTGAGTTAACTGGTCTAGTTATTGTNCTGCTTCTCTCTGANNTRNNN  lov-5.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGANTNRNNN  nfa-8.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTGG  rrs-10.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTGN  rrs-7.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTNN  sha.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTGN  tamm-2.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTGG  ts-1.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTGG  tsu-1.fa
3070558  ATGCTCAAGTCTCTTTTCGTTGAGTTTGAATGATTGAGTTAACTGGTCTAGTTATTGTACTGCTTCTCTCTGATTTRTNN  van-0.fa
 
3070638  TTGTGTTGTCCTTTATTTTTTCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCTAATTATTGTCTTGTAGCTCTG  chr3.fa
3070638  NTNNNNNNNCCTTTATTRTTNCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCTAATTATTGTCTTRTAGCTCTG  bay-0.fa
3070638  TTGTGTTGTCCTTTNNTRTTTCACATTACCCTTGCTTGTGTGGATAAACACATNAAGCTAATTATTGTCTTRTAGCTCTG  bor-4.fa
3070638  NNNNGTTGTCCTTTNTTRTTNCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCTAATTATTGTCTTRTAGCTCTG  br-0.fa
3070638  NTGTGTTGTCCTTTATTRTTTCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCTAATTATTGTCTTRTAGCTCTG  bur-0.fa
3070638  NTGTGTTGTCCTTTATTRTTTCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCNAATTATTGTCTTRTAGCNCTG  c24.fa
3070638  NTGTGTTGTCCTTTNTTRTTTCACATTACCCTTGCTTGTGTGGATAAACACATNAAGCTAATTATTGTCTTRTAGCTCTG  col-0.fa
3070638  NNNNNNNNNNNNNNNTTRNNNCACATTACCCTTGCTTGTGTGGATAAACACATTNNNNNNNNTNTTGTCTTRTNGCTCTG  cvi-0.fa
3070638  TTGTGTTGTCCTTTNTTRTTTCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCTAATTATTGTCTTRTAGCTCTG  est-1.fa
3070638  NNNNNNNNNNNNNTNNTRTTTCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCTAATTATTGTCTTRTAGCTCTG  fei-0.fa
3070638  TTNTGTTGTCCTTTNTTRTTTCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCTAATTATTGTCTTRTAGCTCTG  got-7.fa
3070638  TTNTNNNNNNNNNTNTTRTTTCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCTAATTATTGTCTTRTNGCTCTG  ler-1.fa
3070638  NTNNNNNNNNNNNNNNNRTNNCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCTAATTATTGTCTTRTNGCTCTG  lov-5.fa
3070638  NNNNNNNNNNNNNNNNNRTNNCACATTACCCTTGCTTGTGTGGATAAACACNNNNNNCTAATTNTNGTCTTRTAGCTCTG  nfa-8.fa
3070638  TTGTGTTGTCCTTTNTTRTTTCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCTAATTATTGTCTTRTAGCTCTG  rrs-10.fa
3070638  NNNNGTTGTCCTTTNTTRTTNCACATTACCCTTGCTTGTGTGGATAAACACATNAAGCTAATTATTGTCTTRTAGCTCTG  rrs-7.fa
3070638  NTGNNNNNNNNNTTNTTRTTNCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCTAATTATTGTCTTRTNGCTCTG  sha.fa
3070638  NNNNGTTGTCCTTTNTTRTTTCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCTAATTATTGTCTTRTAGCTCTG  tamm-2.fa
3070638  TTGTGTNNNNNTTTNTTRTTTCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCTAATTATTGTCTTRTAGCTCTG  ts-1.fa
3070638  TTGTGTTGTCCTTTNTTRTTTCACATTACCCTTGCTTGTGTGGATAAACACATTAAGCTAATTATTGTCTTRTAGCTCTG  tsu-1.fa
3070638  NNNNGTTGTCCTTTNTTRTNTCACATTACCCTTGCTTGTGTGGATAAACACATNNNNNNNNNNNNGNNNNNRNNGCTCTG  van-0.fa
 
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTTTGAT  chr3.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTNTGAT  bay-0.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTNTGAT  bor-4.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTNGNNTNNNNT  br-0.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTNTGAT  bur-0.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTNGNNTNNNNT  c24.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTNTGAT  col-0.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTNNNNNNNNNNNNN  cvi-0.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTNTGAT  est-1.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTNTGAT  fei-0.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTNNNNT  got-7.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTNNNNT  ler-1.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTNGNNTNNNNT  lov-5.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTNNNNT  nfa-8.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTTTGAT  rrs-10.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTNGNTTNTGAT  rrs-7.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTNGNNTNNNNT  sha.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTNTGAT  tamm-2.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTNNNNT  ts-1.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTNTGAT  tsu-1.fa
3070718  TTCTGAGAGACATGCATCAAACACCGATAGTTTTAGGCATATTTGTGATCTTGCGGATTCAGTGTTTAGTAGATTNTGAT  van-0.fa
 
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  chr3.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  bay-0.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  bor-4.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  br-0.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  bur-0.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  c24.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  col-0.fa
3070798  NNTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGNNNNNNNCTTCTCCATAGTTAGCGGAATCAGTTCCTTC  cvi-0.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  est-1.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  fei-0.fa
3070798  GTTGAGTTCTTGGACCGGNCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  got-7.fa
3070798  GTTGAGTTCTTGGACCGGTNTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  ler-1.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  lov-5.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  nfa-8.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  rrs-10.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  rrs-7.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  sha.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  tamm-2.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  ts-1.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  tsu-1.fa
3070798  GTTGAGTTCTTGGACCGGTCTGTGTGTTTGCTTAAAGCTATGTGTGAGTCATCTCCATAGTTAGCGGAATCAGTTCCTTC  van-0.fa
 
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATAATTTGTCTGTAAAC  chr3.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATAATTTGTCTGTAAAC  bay-0.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATANTTTGTCTGTAAAC  bor-4.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATAATTTGTCTGTAAAC  br-0.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATAATTTGTCTGTAAAC  bur-0.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATAANTTGTCTGTAAAC  c24.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATANTTTGTCTGTAAAC  col-0.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTNNNNNNNNNNNNNTNNNNNTTCTTGCCATTNNNNNNNNNNNNNNNNNNNNNNNC  cvi-0.fa
3070878  AAACTCTATCNNNNNNNNNNNCNNNNNNNNGAGTTACATCGATCGTTCTTGCCATTTTCTAACATANTTTGTCTGTAAAC  est-1.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATAATTTGTCTGTAAAC  fei-0.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATAATTTGTCTGTAAAC  got-7.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATAATTTGTCTGTAAAC  ler-1.fa
3070878  AAACTCTATCTANGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATANTTTGTCTGTAAAC  lov-5.fa
3070878  AAACTCTATCTANGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACNNNNNNTGTCTGTAAAC  nfa-8.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATANTTTGTCNNNNNNN  rrs-10.fa
3070878  AAACTCTATCTAAGTNTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACNNNNNNTGTCTGTAAAC  rrs-7.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATNATTTGTCTGTAAAC  sha.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATAATTTGTCTGTAAAC  tamm-2.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATAATTTGTNNGTAAAC  ts-1.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTTACATCGATCGTTCTTGCCATTTTCTAACATAATTTGTCTGTAAAC  tsu-1.fa
3070878  AAACTCTATCTAAGTGTCTTCTTTTTGTATGAGTNANNTTGATCGTTCTTGCCATTTTCTAACATAATTTGTCTGTAAAC  van-0.fa
 
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTCATTTTGTTATGTGTTCTTAACTTGAATTGCG  chr3.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTCATTTTGTTATNNRNNNTTAACTTGAATTGCG  bay-0.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTNNNNNNNTNNNNNNNNNNNNNNTRNTCTTAACTTGAATTGCG  bor-4.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTCATTTTGTTNTNNRTTCTTAACTTGAATTGCG  br-0.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTCATTTTGTTATGTRTTCTTAACTTGAATTGCG  bur-0.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTNNNNNTGTTANNTRNTCTTAACTTGAATTGCG  c24.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTCATTTTGTTATGNRTTCTTAACTTGAATTGCG  col-0.fa
3070958  TGAACATATTCATCAAACCAGTCCACGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNTGAATTGCG  cvi-0.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTCATTTTGTTATGTRTTCTTAACTTGAATTGCG  est-1.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTCATTTTGTTATGNRTTCTTAACTTGAATTGCG  fei-0.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTCNTTTTGTTANGTRTTCTTAACTTGAATTGCG  got-7.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTCATTTTGTTATNNRNTCTTAACTTGAATTGCG  ler-1.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTNNNNNNNTTNNNNRNNNTTAACTTGAATTGCG  lov-5.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATANNNNNNTTGTTNNNTRNNCTTAACTTGAATTGCG  nfa-8.fa
3070958  NNNGNNNNNNNNTCAAACCAGTCCACTCTGATCTGTGTCGAATATATTCANTTTGTTATNTRTTNTTAACTTGAATTGCG  rrs-10.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTCNTTTTGTTANNNRNTCTTAACTTGAATTGCG  rrs-7.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTNNNNNTNTTNTNNRTNCTTAACTTGAATTGCG  sha.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTCATTTTGTTATGNRNTCTTAACTTGAATTGCG  tamm-2.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTCATTTTGTTATNNRTTCTTAACTTGAATTGCG  ts-1.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTNNNNNNNTNNNNNNNNNNNNNNNRTTCTTAACTTGAATTGCG  tsu-1.fa
3070958  TGAACATATTCATCAAACCAGTCCACTCTGATCTGTGTCGAATATATTCATTTTGTTATGTRTTCTTAACTTGAATTGCG  van-0.fa
 
3071038  TTCTTGACTTAACGGTTTCCGATTCGAATGATTCGCAGTTGGTGGGAGAAAGCGAAAAGATGAGAATGAAGAAGCTGGAA  chr3.fa
3071038  TTCTTGACTTAACGGTTTCCGATTCGAATGATTCGCAGTTGGTNGGAGAAAGCGAAAAGATGAGAANGAAGAAGCTGGAR  bay-0.fa
3071038  TTCTTGACTTAACGGTTTCCGATTCGAATGATTCGCAGTTGGTNGGAGAAAGCGAAAAGATGAGAANGAAGAAGCTGGAR  bor-4.fa
3071038  TTCTTGACTTAACGGTTTCCGATTCGAATGATTCGCAGTTGGTNGGAGAAAGCGAAAAGATGAGAATGAAGAAGCTGGAR  br-0.fa
3071038  TTCTTGACTTAACGGTTTCCGATTCGAATGATTCGCAGTTGGTNGGAGAAAGCGAAAAGATGAGAANGAAGAAGCNGGAR  bur-0.fa
3071038  TTCTTGACTTAACGGTTTCCGATTCGAATGATTCGCAGTTGGTNGGAGAAAGCGAAAAGATGAGAANGAAGAAGCNGGAR  c24.fa
3071038  TTCTTGACTTAACGGTTTCCGATTCGAATGATTCGCAGTTGGTNGGAGAAAGCGAAAAGATGAGAANGAAGAAGCTGGAR  col-0.fa
3071038  TTCTTGACTTAACGGTTTCCGATTCGAATGATTCGCAGTTGGTNGGAGAAAGCGAAAAGATGAGAANGAAGAAGCNGGAR  cvi-0.fa
3071038  TTCTTGACTTAACGGTTTCCGATTCGAATGATTCGCAGTTGGTNGGAGAAAGCGAAAAGATGAGAANGAAGAAGCNGGAR  est-1.fa
3071038  TTCTTGACTTAACGGTTT