Arabidopsis SNP Sequence Viewer

Chromosome : chr4 Coordinates : 13042700 - 13048115


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
13042700  AAGATTAAATCAAAATGAACAAGTTGGTTTTAGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  chr4.fa
13042700  NNNNNNNNNNCAAAATGAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  bay-0.fa
13042700  NNNNNNNNNNNNNAATGAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  bor-4.fa
13042700  NNNNNNNNNNNNNNNNNAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  br-0.fa
13042700  NNNNNNNNNTCAAAANGAACAAGTTGGTNNNNNNCTGATTTTGCCAGCAATCTTCCAANNNNNNNTNAAAAACTCGAATG  bur-0.fa
13042700  NNNNNNNNNNNAAAATGAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  c24.fa
13042700  NNNNNNNNNNCAAAATGAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  col-0.fa
13042700  NNNNNNNNNNNNNAATGAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCAAGCNTGCTTTAAAAACTCGAATG  cvi-0.fa
13042700  NNNNNNNNNNNNNNNNNAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCANNNNNGCTTTAAAAACTCGAATG  est-1.fa
13042700  NNNNNNNNNNCAAAATGAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  fei-0.fa
13042700  NNNNNNNNNNNNNAATGAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  got-7.fa
13042700  NNNNNNNNNNNAAAATGAACAAGTTGGTNNNNNNCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  ler-1.fa
13042700  NNNNNNNNNNCAAAATGAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  lov-5.fa
13042700  NNNNNNNNNNCAAAATGAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  nfa-8.fa
13042700  NNNNNNNNNNNNNNATGAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  rrs-10.fa
13042700  NNNNNNNNNNNNNNATGAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  rrs-7.fa
13042700  NNNNNNNNNNNNNAATGAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  sha.fa
13042700  NNNNNNNNNNNAAAATGAACAAGTTGGTTTTAGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  tamm-2.fa
13042700  NNNNNNNNNNNNNNNNGAACAAGTTGGTNNNNNNCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  ts-1.fa
13042700  NNNNNNNNNNNNNNNTGAACAAGTTGGTTTTNGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  tsu-1.fa
13042700  NNNNNNNNNNNNNNATGAACAAGTTGGTTTTAGTCTGATTTTGCCAGCAATCTTCCAAGCATGCTTTAAAAACTCGAATG  van-0.fa
 
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCAAACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  chr4.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  bay-0.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCAAACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  bor-4.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCAAACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  br-0.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  bur-0.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  c24.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  col-0.fa
13042780  CTTTCCAAGGGTCCTNNNNNNNANNNNNNAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTNNN  cvi-0.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  est-1.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  fei-0.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCAAACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  got-7.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  ler-1.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  lov-5.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  nfa-8.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCAAACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  rrs-10.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCAAACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  rrs-7.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  sha.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  tamm-2.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  ts-1.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  tsu-1.fa
13042780  CTTTCCAAGGGTCCTCTTCAGAGAGAGCAAATTTCAGGTCTGCANACAAGTCACCTAGAGCCGAAATAGATTCTTCTGCG  van-0.fa
 
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCTCTTGCACGTACCTCAGCTTCCAATTTTGC  chr4.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCTCTTGCACGTACCTCAGCTTCCAATTTTGC  bay-0.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCNCTTGCACGTACCTCAGCTTCCAATTTTGC  bor-4.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCTCTTGCACGTACCTCAGCTTCCAATTTTGC  br-0.fa
13042860  CCTCTCGGTTCTTCNTGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCTCTTGCACGTACCTCAGCTTCCAATTTTGC  bur-0.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCNCTTGCACGTACCTCAGCTTCCAATTTTGC  c24.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCNCTTGCACGTACCTCAGCTTCCAATTTTGC  col-0.fa
13042860  NNNGNNGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCNCTTGCACGTACCTCAGCTTCCAATTTTGC  cvi-0.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCNCTTGCACGTACCTCAGCTTCCAATTTTGC  est-1.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCTCTTGCACGTACCTCAGCTTCCAATTTTGC  fei-0.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCNCTTGCACGTACCTCAGCTTCCAATTTTGC  got-7.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCNCTTGCACGTACCTCAGCTTCCAATTTTGC  ler-1.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCNCTTGCACGTACCTCAGCTTCCAATTTTGC  lov-5.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCTCTTGCACGTACCTCAGCTTCCAATTTTGC  nfa-8.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCTCTTGCACGTACCTCAGCTTCCAATTTTGC  rrs-10.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCTCTTGCACGTACCTCAGCTTCCAATTTTGC  rrs-7.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCNCTTGCACGTACCTCAGCTTCCAATTTTGC  sha.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCNCTTGCACGTACCTCAGCTTCCAATTTTGC  tamm-2.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCNCTTGCACGTACCTCAGCTTCCAATTTTGC  ts-1.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCTCTTGCACGTACCTCAGCTTCCAATTTTGC  tsu-1.fa
13042860  CCTCTCGGTTCTTCATGTCCTTCTGGTTCTCCCATGCGTGTATTTCTCTCTCTTGCACGTACCTCAGCTTCCAATTTTGC  van-0.fa
 
13042940  AGCCATTGAAATGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  chr4.fa
13042940  AGCCATTGAANTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  bay-0.fa
13042940  AGCCNTTNAANTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  bor-4.fa
13042940  AGCCNTTGAAATGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  br-0.fa
13042940  AGCCANTNNANTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  bur-0.fa
13042940  AGCCATTGAANTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  c24.fa
13042940  AGCCATTGAANTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  col-0.fa
13042940  AGCCNTTGAAATGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  cvi-0.fa
13042940  AGCCNTTNAANTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  est-1.fa
13042940  AGCCNTTGAAATGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  fei-0.fa
13042940  AGCCATTGAANTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  got-7.fa
13042940  AGCNNNNNNNNTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  ler-1.fa
13042940  AGCNNNNNNNNTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  lov-5.fa
13042940  AGCCATNNNNNTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  nfa-8.fa
13042940  AGCCATTGAANTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  rrs-10.fa
13042940  AGCCATTGAANTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  rrs-7.fa
13042940  AGCCNTTGAAATGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  sha.fa
13042940  AGCCNTTNAANTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  tamm-2.fa
13042940  ANNNNNNNNNNNNNNTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  ts-1.fa
13042940  AGCCATTGAANTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  tsu-1.fa
13042940  AGCCATTGAANTGGCTCGACGTATACATGATGGAGGTATCTACAGTCAAGTATATATGTGAGTCAGCTTCATAAATGATT  van-0.fa
 
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  chr4.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  bay-0.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  bor-4.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  br-0.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCNNNNNNNNNGGCCTACCTCTAATCATTCTGTNNN  bur-0.fa
13043020  GGACCAAAAACAGCCATNTTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  c24.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  col-0.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTNTG  cvi-0.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  est-1.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  fei-0.fa
13043020  GGACCAAAAACAGCCATNTTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  got-7.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  ler-1.fa
13043020  GGACCAAAAACAGCCATNTTTCAGTGATTAATGCGTTCTTTAAGGCCTCTNGGGTGGCCTACCTCTAATCATTCTGTATG  lov-5.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  nfa-8.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  rrs-10.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTNTG  rrs-7.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  sha.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCNTACCTCTAATCATTCTGTATG  tamm-2.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTNTG  ts-1.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  tsu-1.fa
13043020  GGACCAAAAACAGCCATATTTCAGTGATTAATGCGTTCTTTAAGGCCTCTAGGGTGGCCTACCTCTAATCATTCTGTATG  van-0.fa
 
13043100  TTGGTATAAACTTGCGTATGAGAAAAGAGGGAGGGAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCTGC  chr4.fa
13043100  TTGGTATAAACTTGCGTATGAGAAAAGANGNNNGGAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCNGC  bay-0.fa
13043100  TTGGTATAAACTTGCGTATGAGANNNNNNNNNNNNNGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGNNNTNNN  bor-4.fa
13043100  TTGGTATAAACTTGCGTATGAGAAANNNNNNNNNNAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAANNNNTNNN  br-0.fa
13043100  NTGGTATAAACTTGCGTATGAGAANNNNNNNNNNNNNNNNACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCNGC  bur-0.fa
13043100  TTGGTATAAACTTGCGTATGAGAAAAGAGNNNNNGAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCTGC  c24.fa
13043100  TTGGTATAAACTTGCGTATGAGAAAAGAGGGAGNGAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCNGC  col-0.fa
13043100  TTGGTATAAACTTGCGTATGAGAAANNNNNNNNNNNGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCTGC  cvi-0.fa
13043100  NTGGTATAAACTTGCGTATGAGAANNNNNNNNNNNAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCTGC  est-1.fa
13043100  TTGGTATAAACTTGCGTATGAGAAAANNNNNNNNGAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCTGC  fei-0.fa
13043100  TTGGTATAAACTTGCGTATGAGAAANNNNNNNNNNNGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCNGC  got-7.fa
13043100  TTGGTATAAACTTGCGTATGAGAAAAGNNNNNGGGAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCTGC  ler-1.fa
13043100  TTGGTATAAACTTGCGTATGAGAAAAGAGNNNNNGAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCTGC  lov-5.fa
13043100  TTGGTATAAACTTGCGTATGAGAAANNNNNNNNNNAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCTGC  nfa-8.fa
13043100  TTGGTATAAACTTGCGTATGAGAAANNNNNNNGGGAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCTGC  rrs-10.fa
13043100  TTGGTATAAACTTGCGTATGAGAAANNNNNNNNNNNGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCTGC  rrs-7.fa
13043100  TTGGTATAAACTTGCGTATGAGAAAANANNNNNNNAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCNGC  sha.fa
13043100  TTGGTATAAACTTGCGTATGAGAAAAGNNNNNNGGAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCTGC  tamm-2.fa
13043100  TTGGTATAAACTTGCGTATGAGNNNNNNNNNNNNNNNTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCTGC  ts-1.fa
13043100  TTGGTATAAACTTGCGTATGAGAAAAGNNNNNNNNAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCTGC  tsu-1.fa
13043100  TTGGTATAAACTTGCGTATGAGAAANNNNNNNNNGAGTATACCTGGGCAAGCTGAGCAACCTTAAAACCAAAGCTCCNGC  van-0.fa
 
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  chr4.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  bay-0.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  bor-4.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  br-0.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  bur-0.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  c24.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  col-0.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  cvi-0.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  est-1.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  fei-0.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  got-7.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  ler-1.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  lov-5.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  nfa-8.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  rrs-10.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATNATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  rrs-7.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  sha.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  tamm-2.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  ts-1.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  tsu-1.fa
13043180  TGCAAAGACCACGCACAAGCTTATATAGGTAGGTCACATCATCATGATCATAACTGCCTTTATCCTTCTGCAATGTCAGA  van-0.fa
 
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  chr4.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  bay-0.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  bor-4.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  br-0.fa
13043260  TACGAGNNNNNNNNTGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAANG  bur-0.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  c24.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  col-0.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  cvi-0.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  est-1.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  fei-0.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  got-7.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  ler-1.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  lov-5.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  nfa-8.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  rrs-10.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  rrs-7.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  sha.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  tamm-2.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  ts-1.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  tsu-1.fa
13043260  TACGAGACATGGTATGTCCCAACAGAACCTGGGAATCCGTTACTGATCTCAGCTATTTCAGGGTAATGCGTGACAAAAAG  van-0.fa
 
13043340  AACCAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  chr4.fa
13043340  AACCAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  bay-0.fa
13043340  AACCAANCATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  bor-4.fa
13043340  AACCAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  br-0.fa
13043340  AACCAANNNNCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  bur-0.fa
13043340  AACCAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  c24.fa
13043340  AACCAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  col-0.fa
13043340  AACCAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  cvi-0.fa
13043340  AACCAAACATCTCTTTNCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  est-1.fa
13043340  AACCAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  fei-0.fa
13043340  AACNAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  got-7.fa
13043340  AACCAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  ler-1.fa
13043340  AACCAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  lov-5.fa
13043340  AACCNAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  nfa-8.fa
13043340  AACCAANCATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  rrs-10.fa
13043340  AACCAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  rrs-7.fa
13043340  AACCAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  sha.fa
13043340  AACCAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  tamm-2.fa
13043340  AACCAAACANCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  ts-1.fa
13043340  AACCAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  tsu-1.fa
13043340  AACCAAACATCTCTTTTCTGCTAGGAGATGCTGTAATGTTGCATAGGCAATGGCTACACCGTCGTGTGTGCTAGTGCCTC  van-0.fa
 
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGAAGAACAGGTTCTGATTATGTGTGACGCTTCACTTAATTCTTCTAGA  chr4.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGAANNGNNNNNNNNNATTATGTGTGACGCTTCACTTAATTCTTCTAGA  bay-0.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGNNNNGNNNNNNNNNATTATGTGTGACGCTTCACTTAANNNNNNNANA  bor-4.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGNNNNGNNNNNNNNGATTATGTGTGACGCTTCACTTAATTCTTCTNGA  br-0.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGANNNNNGNNNNNNNNNNTTATGTGTGACGCTTCACTTAATNNNNNNNNN  bur-0.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGNNNNGNNNNNNNNNNTTATGTGTGACGCTTCACTTAATTCTTCTAGA  c24.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGAAGAACAGGTTCTGATTATGTGTGACGCTTCACTTAATTCTTCTAGA  col-0.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGNNNNGNNNNNNNNNATTATGTGTGACGCTTCACTTAATTCNNNNNNN  cvi-0.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGNNNNGNNNNNNNNGATTATGTGTGACGCTTCACTTAATTNTTNNAGN  est-1.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGNNNNGNNNNNNNNGATTATGTGTGACGCTTCACTTAATTCTTCTAGA  fei-0.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGANNNGNNNNNNNNGATTATGTGTGACGCTTCACTTAATTCTTCNNNN  got-7.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGAANNGNNNNNNNNNNNTNTGTGTGACGCTTCACTTAATTCTTNNAGA  ler-1.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGANNNGNNNNNNNNNNTTATGTGTGACGCTTCACTTAATTCTTCTAGA  lov-5.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGNNNNGNNNNNNNNNNTTATGTGTGACGCTTCACTTAATTCTNNNNNN  nfa-8.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGNNNNGNNNNNNNNNATTATGTGTGACGCTTCACTTAATTCTTCNAGA  rrs-10.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGAAGAACAGGTTCTGATTATGTGTGACGCTTCACTTAATTCNTCNAGA  rrs-7.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGANNNGNNNNNNNNNATTATGTGTGACGCTTCACTTAATTCTTCNAGA  sha.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGNNNNGNNNNNNCTGATTATGTGTGACGCTTCACTTAATTCTTCTAGA  tamm-2.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGANNNNNGNNNNNNNNNNTTATGTGTGACGCTTCACTTAATTCNNNNNNN  ts-1.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGNNNNGNNNNNNNTGATTATGTGTGACGCTTCACTTAATTCTTNNNNN  tsu-1.fa
13043420  TTCCAAGCTCATCTAATATAACAAGCGAACGAGANNNGNNNNNNNTGATTATGTGTGACGCTTCACTTAATTCTTCTANA  van-0.fa
 
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  chr4.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  bay-0.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  bor-4.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  br-0.fa
13043500  NNNGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGNGCAGCTTGGCGAA  bur-0.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGNGCAGCTTGGCGAA  c24.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGNGCAGCTTGGCGAA  col-0.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  cvi-0.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  est-1.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGNGCAGCTTGGCGAA  fei-0.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  got-7.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  ler-1.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGNGCAGCTTGGCGAA  lov-5.fa
13043500  NAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  nfa-8.fa
13043500  AAGGTACTTCNGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  rrs-10.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  rrs-7.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  sha.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  tamm-2.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  ts-1.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  tsu-1.fa
13043500  AAGGTACTTCTGCCATGCTGGATACTGTCTGAAGCACCCATCCGAGTGAAAACACCATCAAGCACGTGCAGCTTGGCGAA  van-0.fa
 
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  chr4.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  bay-0.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  bor-4.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCNTGAATCATTTAGCATTTCAACATATGCAAGAGA  br-0.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCNTTTCANCATANGCAAGAGA  bur-0.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  c24.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  col-0.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAANANNNNNNNTCATTTAGCATTTCAACATATGCAAGAGA  cvi-0.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAANCATTTAGCATTTCAACATATGCAAGAGA  est-1.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  fei-0.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  got-7.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  ler-1.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  lov-5.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  nfa-8.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  rrs-10.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTNNNNNNTTTAGCATTTCAACATATGCAAGAGA  rrs-7.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  sha.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  tamm-2.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGANTCATTNAGCATTTCAACATATGCAAGAGA  ts-1.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  tsu-1.fa
13043580  TGACGCTGGTACAAAGGAACCAACCTGGAAAACCAATGGGAATATCTTGAATCATTTAGCATTTCAACATATGCAAGAGA  van-0.fa
 
13043660  TTTTTTCTACTGTTAATGTTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  chr4.fa
13043660  TTTTTTCTNNNNNNNNNNTTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  bay-0.fa
13043660  TTTTTNNNNNNNNNNNNNNTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  bor-4.fa
13043660  TTTTNNNNNNNNNNNNNNNTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  br-0.fa
13043660  TTTTTNNNNNNNNNNNNNTTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  bur-0.fa
13043660  TTTTTTCTNNNNNNNNNNTTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  c24.fa
13043660  TTTTTTCTACTNNNNNNGTTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  col-0.fa
13043660  TTTTTNNNNNNNNNNNNNNNTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  cvi-0.fa
13043660  TTTTNNNNNNNNNNNNNNNTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  est-1.fa
13043660  TTTTNNNNNNNNNNNNNNNNTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  fei-0.fa
13043660  TTTTTNNNNNNNNNNNNNNTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  got-7.fa
13043660  TTTTTTCTNNNNNNNNNNTTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATGTAGCAGCTCTTTCCT  ler-1.fa
13043660  TTTTTTCTACNNNNNNNNTTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  lov-5.fa
13043660  TTTTTTCTNNNNNNNNNNTTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  nfa-8.fa
13043660  TTTTTTCTNNNNNNNNNNTTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  rrs-10.fa
13043660  TTTTTTNNNNNNNNNNNNNTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  rrs-7.fa
13043660  TTTTTTNNNNNNNNNNNNTTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  sha.fa
13043660  TTTTTTCTANNNNNNNNNTTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  tamm-2.fa
13043660  TTTTTNNNNNNNNNNNNNTTTATGTTACCTGAGCCATTATGGAAATNAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  ts-1.fa
13043660  TTTTTTCNNNNNNNNNNNTTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATATAGCAGCTCTTTCCT  tsu-1.fa
13043660  TTTTTTNNNNNNNNNNNNTTTATGTTACCTGAGCCATTATGGAAATTAAAGCAACTTGACGGATGTAGCAGCTCTTTCCT  van-0.fa
 
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  chr4.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  bay-0.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  bor-4.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  br-0.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTNTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  bur-0.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  c24.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  col-0.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTNG  cvi-0.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  est-1.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  fei-0.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  got-7.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTNCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  ler-1.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  lov-5.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  nfa-8.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  rrs-10.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  rrs-7.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  sha.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  tamm-2.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTNATTTGGGACGAAGTTATCTNN  ts-1.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCNATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  tsu-1.fa
13043740  CCCATGTTAGGTCCGGTGATAATTTGGCAATATTCCCCTTCTGCATGCAAAATTGTGTCATTTGGGACGAAGTTATCTTG  van-0.fa
 
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAAAACGAAATGAACAAAATCATTCCAACTTATTTAAAAATAGAAAGAAA  chr4.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAAAACGANNNNNNNAAAATCATTNNNNNNNNNNNNNNNNNNNNNRRNNN  bay-0.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAAAACNNNNNNNNCAAAANCATTCNNNNNNNNNNNNNNNNNNNNRRNNN  bor-4.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAANNNNNNNNNNNNAAAANNNNNNNNNNNNNNNNNNNNNNNNNNRRNNN  br-0.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAAAACGNNNNNNNNAAANNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNN  bur-0.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAAAACGNNNNNNNNAAAATCATTCNNNNNNNNNNNNNNNNNNNNRRNNN  c24.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAAAACGANNNNNNNAAAANCATTCCANNNNNNNNNNNNNNNNNNRRNNN  col-0.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTANNNNNNNNNNNNCAAAANNNNNNNNNNNNNNNNNNNNNNNNNNRRNNN  cvi-0.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAAANCGNNNNNNNNAAAATCATTCNNNNNNNNNNNNNNNNNNNNRRNNN  est-1.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAANNNNNNNNNNNNAAAATCANNNNNNNNNNNNNNNNNNNNNNNRRNNN  fei-0.fa
13043820  TANTATAGTCTCCAGTACCTGGCAAATTTTTAAAACNNNNNNNNNAAAANCATTNNNNNNNNNNNNNNNNNNNNNRRNNN  got-7.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAAAACNNNNNNNNCAAAATCATTCCNNNNNNNNNNNNNNNNNNNRRNNN  ler-1.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAAAACGANNNNNNNAAAATCATTCCAANNNNNNNNNNNNNNNNNRRNNN  lov-5.fa
13043820  NAATATAGTCTCCAGTACCTGGCAAATTTTTAAAANNNNNNNNNNAAAANCNNNNNNNNNNNNNNNNNNNNNNNNRRNNN  nfa-8.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAAAACGANNNNNNNAAAATCATTCCNNNNNNNNNNNNNNNNNNNRRNNN  rrs-10.fa
13043820  TNATATAGTCTCCAGTACCTGGCAAATTTTTAAAACGANNNNNNNAAAATCATTCNNNNNNNNNNNNNNNNNNNNRRNNN  rrs-7.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAAAANNNNNNNNNCAAAATCANTNNNNNNNNNNNNNNNNNNNNNRRNNN  sha.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAAAANNNNNNNNNCAAAATCATTNNNNNNNNNNNNNNNNNNNNNRRNNN  tamm-2.fa
13043820  NNNTATAGTCTCCAGTACCTGGCAAATTTTTAAAACGNNNNNNNNAAAANNNNNNNNNNNNNNNNNNNNNNNNNNRRNNN  ts-1.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAAAACNNNNNNNNNAAAATCANNNNNNNNNNNNNNNNNNNNNNNRRNNN  tsu-1.fa
13043820  TAATATAGTCTCCAGTACCTGGCAAATTTTTAAAACGANNNNNNCAAAATCATTCCNNNNNNNNNNNNNNNNNNNRRNNN  van-0.fa
 
13043900  AAGAAATAGAAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  chr4.fa
13043900  NNNNNNNAGAAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  bay-0.fa
13043900  NNNNNNNNNNAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  bor-4.fa
13043900  NNNNNNNAGAAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  br-0.fa
13043900  NNNNNNNNNNAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  bur-0.fa
13043900  NNNNNNNNNNAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  c24.fa
13043900  NNNNNNNNNNAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  col-0.fa
13043900  NNNNNNNNNNAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  cvi-0.fa
13043900  NNNNNNNNNNAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  est-1.fa
13043900  NNNNNNNNNNAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  fei-0.fa
13043900  NNNNNNNNNNAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  got-7.fa
13043900  NNNNNNNNGAAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGNNNNNNTCAATTGGTTCACAGTCATCCA  ler-1.fa
13043900  NNNNNNNNNNAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  lov-5.fa
13043900  NNNNNNNNNAAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  nfa-8.fa
13043900  NNNNNNNAGAAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  rrs-10.fa
13043900  NNNNNNNNNNAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  rrs-7.fa
13043900  NNNNNNNNNNAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  sha.fa
13043900  NNNNNNNNNNAGCGAGAGCAAGATGCATNCAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  tamm-2.fa
13043900  NNNNNNNNNNAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  ts-1.fa
13043900  NNNNNNNAGAAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  tsu-1.fa
13043900  NNNNNATAGAAGCGAGAGCAAGATGCATACAGGATGACGACCAGACTGTATGTTTATCTCAACTGGTTCACAGTCATCCA  van-0.fa
 
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCAGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  chr4.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  bay-0.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  bor-4.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGNNNNNNNNGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  br-0.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  bur-0.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  c24.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  col-0.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGNNNNNNNNGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  cvi-0.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  est-1.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  fei-0.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  got-7.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  ler-1.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  lov-5.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  nfa-8.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCAGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  rrs-10.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  rrs-7.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  sha.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  tamm-2.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  ts-1.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  tsu-1.fa
13043980  CAAACTCGGGACGGACATAGTTCTGCAGAGGGAAAAAATTGGAAGCCNGAGTTACAAATTGAAAAGCAGTGAGTACAAGA  van-0.fa
 
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  chr4.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  bay-0.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  bor-4.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  br-0.fa
13044060  ACNTTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  bur-0.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCN  c24.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  col-0.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  cvi-0.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  est-1.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  fei-0.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTNNNNNNNNNNCNNNNNNNNAAGGGAGTGCAAACAGTCCAGTGCAGCA  got-7.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  ler-1.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  lov-5.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  nfa-8.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  rrs-10.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  rrs-7.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  sha.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  tamm-2.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  ts-1.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTNNNNNNNNNCNNNNNNNNAAGGGAGTGCAAACAGTCCAGTGCAGCA  tsu-1.fa
13044060  ACATTTATTGTGGTTTGTTCCTTCGTTACACCTTGTTTCTAGATAGAGTTGAAAGGGAGTGCAAACAGTCCAGTGCAGCA  van-0.fa
 
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  chr4.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  bay-0.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  bor-4.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  br-0.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGNNNNNNNNNNNCTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  bur-0.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  c24.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  col-0.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACNAAGCTCGGTTCAC  cvi-0.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  est-1.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  fei-0.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  got-7.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  ler-1.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  lov-5.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  nfa-8.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  rrs-10.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  rrs-7.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  sha.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  tamm-2.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  ts-1.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  tsu-1.fa
13044140  AGAGCTTGAACGGCAGCCTTAAAATCTGTGTAGTATCTACTGAAACTCTTGAGGAAACTATCCCACGAAGCTCGGTTCAC  van-0.fa
 
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  chr4.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  bay-0.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  bor-4.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  br-0.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCNNNNNTTTCTGGGGGATGATATCGAATAGTCTTCT  bur-0.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  c24.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  col-0.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  cvi-0.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  est-1.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  fei-0.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  got-7.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  ler-1.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  lov-5.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  nfa-8.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  rrs-10.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  rrs-7.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  sha.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  tamm-2.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  ts-1.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  tsu-1.fa
13044220  AATGGCAAGATGTTCAGTTGCTAGAGCTAGCTCATCCAAGCCAGCTACTATTTCTGGGGGATGATATCGAATAGTCTTCT  van-0.fa
 
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  chr4.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  bay-0.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  bor-4.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATNAGA  br-0.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGNTCAGA  bur-0.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  c24.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  col-0.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  cvi-0.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCNNNNNNGA  est-1.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  fei-0.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  got-7.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  ler-1.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  lov-5.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  nfa-8.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  rrs-10.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTNAGTTTCAGATCAGA  rrs-7.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  sha.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  tamm-2.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGNTCAGA  ts-1.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  tsu-1.fa
13044300  TGGTGCTATTTACTTTCACCCAATTCATAGGGACCTTGGAATCAACGGGCAGCTGTACAAAGCCTTAGTTTCAGATCAGA  van-0.fa
 
13044380  AATAAAGGTCCACAACTTTCAAAGATGAGAGTATCATATGCACATATGTTATACTTGGTACCAAAGAAGATATTAGGTTC  chr4.fa
13044380  AATAAAGGTCCACAACTTTCAAAGATGAGAGTATCATATGCANATATGTTATACTTGGTACCAAAGAAGATATTAGGTTC  bay-0.fa
13044380  AATAAAGGTCCACAACTTTCAAAGATGAGAGTATCATATNNNNNNNNGTTATACTTGGTACCAAAGAAGATATTAGGTTC  bor-4.fa
13044380  AATAAAGGTCCACAACTTTCAAAGATGAGAGTATCATATNNNNNNNNGTTATACTTGGTACCAAAGAAGATATTAGGTTC  br-0.fa
13044380  AATAAAGGTCCACAACTTTCAAAGATGAGAGTATCANNNNNNNNNNNNTTATACT