Arabidopsis SNP Sequence Viewer

Chromosome : chr4 Coordinates : 13333016 - 13333112


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
13333016  CTATATCGATGATGGTAAAATCAGAAGTAGCTGGTTTGTGATCACATCTTTCCCGAGGGAATTCAAAGGGAATCCGAACG  chr4.fa
13333016  NNNNNNNNNNNNTGGTAAAATCAGAAGTAGCTGGTTTGTGATCNCANNNNNNNNNNANNNNNNNNNNRNRRRRRRGAARG  bay-0.fa
13333016  CTATATCGATGATGGTAAAATCAGAAGTAGCTGGTTTGTGATCNCATCTTTCCCGAGGGAATTCAAARGRRRRRRGAARG  bor-4.fa
13333016  NNNNNNNNNNNNNGGTAAAATCAGAAGNAGCTGGTTTGTGATCACANNNNNNNNNNNNNNNNNNNNNRNRRRRRRNAARG  br-0.fa
13333016  NNNTATNNNNNNTGGTAAAATCAGAAGTAGCTGNTTTGTGATCNCNNCNTTCCCNNNNNNNNNNNNNRNRRRRRRGNNRN  bur-0.fa
13333016  CTATATCGATGATGGTAAAATCAGAAGTAGCTGGTTTGTGNNNNNATCTTTCCCGAGGGAATTCAANRGRRRRRRGAARG  c24.fa
13333016  CTATATCGATGATGGTAAAATCAGAAGTAGCTGGTTTGTGATCNCATCTTTCCCGAGNNNNNNNNAARNRRRRRRGAARG  col-0.fa
13333016  NNNNNTCGATGATGGTAAAANCAGAAGTNNNNGGTTTGTGATCACATCTTTCCCGAGGNAATTCNNNRNRRRRRRGANRG  cvi-0.fa
13333016  NNNNNNNNNNNNNGGTAAAATCAGAAGTAGCTGGTTTGTGATCNCANNNNNNNNNNANNNNNNNNNNRNRRRRRRGANRG  est-1.fa
13333016  CTATATCGNTGATGGTAAAATCAGAAGTAGCTGGTTTGTGNNNNNNTCTTTCCCGAGGGANTTCAANRNRRRRRRGAARN  fei-0.fa
13333016  CTATANCGATGATGGTAAAATCAGAAGTAGCTGGTTTGTGATCNCATCTTTCCCGNGGGAATTNNNARGRRRRRRGAARG  got-7.fa
13333016  NNNNNNNNNNNATGGTAAAATCAGAAGTAGCTGGTTTGTGATCNNNNNNNNNNNNNNNNNNNNNNNNRNRRRRRRGAARG  ler-1.fa
13333016  NNNNNNNNNNNATGGTAAAATCAGAAGTAGCTGGTTTGTGATCNCATCTTNNNNNNANNNNNNNNNNRNRRRRRRGAARG  lov-5.fa
13333016  NNNNNNNNNNNNTGGTAAAATCAGAAGTAGCTGGTTTGTGATCNCNNNNNNNNNNNANNNNNNNNNNRNRRRRRRGAARG  nfa-8.fa
13333016  CTATATCGATGATGGTAAAATCAGAAGTAGCTGGTTTGTGATCACATCTTTCCCGAGGGAATTCAAARGRRRRRRGAARG  rrs-10.fa
13333016  NNNNNNNNNNNNNGGTAAAATCAGAAGTAGCTGGTTTGTGATCACATCTNNNNNNNANNNNNNNNNNRNRRRRRRGAARG  rrs-7.fa
13333016  NNNNNNNNNNNNNGGTAAAATNNNNNNNNNTNNNNNNGTGATCNCNNNNNNNNNNNANNNNNNNNNNRNRRRRRRNNNRN  sha.fa
13333016  CTATATCGATGATGGTAAAATCAGAAGTAGCTGGTTTGTGATCNCATCTTTCCCGAGGGAATTCNANRNRRRRRRGAARN  tamm-2.fa
13333016  CTATATCGATGATGGTAAAATCAGAAGTAGCTGGTTTGTGATCACATCTTTCCCGAGGGAATTCAAARGRRRRRRGAARG  ts-1.fa
13333016  NNNNNNNNNNNNTGGTAAAATCAGAAGTAGCTGGTTTGTGATCACATCTNNNNNNNANNNNNNNNNNRNRRRRRRGAARG  tsu-1.fa
13333016  NNNNNNNNNNNNNGGTAAAATCAGAAGTAGCTGGTTTGTGATCNCATCTTNNNNNNANNNNNNNNNNRNRRRRRRGNARG  van-0.fa
 
13333096  ATTTTTTTCGTCATCTT   chr4.fa
13333096  NTTTTTTTCGTCATCNN   bay-0.fa
13333096  ATTTTTTTCGTCATNNN   bor-4.fa
13333096  NTTTTTTTCNNNNNNNN   br-0.fa
13333096  ANTTTTTTCGNNNNNNN   bur-0.fa
13333096  ATTTTTTTCGTCATCNN   c24.fa
13333096  NTTTTTTTCGTCANCNN   col-0.fa
13333096  NTTTTTNNNNNNNNNNN   cvi-0.fa
13333096  ATTTTTTTCGNCANNNN   est-1.fa
13333096  NNTTTTTNNNNNNNNNN   fei-0.fa
13333096  ATTTTTTTCGTCATCTT   got-7.fa
13333096  ATTTTTTTCGNNNNNNN   ler-1.fa
13333096  ATTTTTTTCGTCATCTT   lov-5.fa
13333096  ATTTTTTTCGTCNNNNN   nfa-8.fa
13333096  ATTTTTTTCGNNNNNNN   rrs-10.fa
13333096  ATTTTTTTCGTCATCTT   rrs-7.fa
13333096  NNNNNNNNNNNNNNNNN   sha.fa
13333096  ANTTTTTTCNNNNNNNN   tamm-2.fa
13333096  ATTTTTTTCGTCATCTN   ts-1.fa
13333096  ATTTTTTTCGTCATCNN   tsu-1.fa
13333096  ATTTTTTTCGTCNNNNN   van-0.fa
 
visited.