Arabidopsis SNP Sequence Viewer

Chromosome : chr4 Coordinates : 13334766 - 13336153


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGTGGGAATAAGGTGGTATTCACAAT  chr4.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATNGTGGGAATAAGGTGGTATTCACAAT  bay-0.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGTGGGAATAAGGTGGTATTCACAAT  bor-4.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGTGGGAATAAGGTGGTATTCACAAT  br-0.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTNNNNNNNNNNCTTTGGAAAAACACATAGTNNGAATAAGGTGNNNNNNNCAAT  bur-0.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGTGGGAATAAGGTGGTATTCACAAT  c24.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGTGGGAATAAGGTGGTATTCACAAT  col-0.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTNNNNNCCTTTGGAAAAACACATNNNNNGAATAAGGNNNNNNNCNCAAN  cvi-0.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCNAACCTTTGGAAAAANNNNNNGTGGGAATAAGGTGGNATTCACAAT  est-1.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGTGGGAATAAGGTGGTATTCACAAT  fei-0.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGNGGGAATAAGGTGGTATTCACAAT  got-7.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGTGGGAATAAGGTGGTATTCACAAT  ler-1.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGTGGGAATAAGGTGGTATTCACAAT  lov-5.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGTGGGAATAAGGTGGTATTCACAAT  nfa-8.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGTGGGAATAANNNNNNNNNNNNNNN  rrs-10.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGTGGGAATAAGGTGGTATTCACAAT  rrs-7.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGTGGGAATAAGGTGGTATTCACAAT  sha.fa
13334766  ATTNATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAANNNNNNNNNNNNNNNNNNNNNTGGTATTCACAAT  tamm-2.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTNTGCAAACCTTTGGAAAAACACATAGTGGGAATAAGGTGGTATTCACAAT  ts-1.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGTGGGAATAAGGTGGTATTCACAAT  tsu-1.fa
13334766  ATTTATCAACTACCGCAGCCAAGAGTTTCTTTGCAAACCTTTGGAAAAACACATAGTGGGAATAAGGTGGTATTCACAAT  van-0.fa
 
13334846  TTATTTCCGAATAGCAGCAATTACTACACATTATATATTTTATAGATTACCGTAAAACAAGTTTGCTGTACACCAGCTTT  chr4.fa
13334846  TTATTTCCGAATAGCAGCAATTACTANNNNNNNNNNNNNNNNNNNNNNACCGTAAAACAAGTTTGCTGTACACCAGCTTT  bay-0.fa
13334846  TTATTTCCGAATAGCAGCAATTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAACAAGTTTGCTGTACACCAGCTTT  bor-4.fa
13334846  TTATTTCCGAATAGCAGCAATTACTACNNNNNNNNNNNNNNNNNNNNNNNNNNAAAACAAGTTTGCTGTACACCAGCTTT  br-0.fa
13334846  TTATTTCCGAATAGCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAAACAAGTTTGCNNNNNNNCAGCTTT  bur-0.fa
13334846  TTATTTCCGAATAGCAGCAATTACTANNNNNNNNNNNNNNNNNNNNNNACCGTAAAACAAGTTTGCTGTACACCAGCTTT  c24.fa
13334846  TTATTTCCGAATAGCAGCAATTACTACNNNNNNNNNNNNNNNNNNATTACCGTAAAACAAGTTTGCTGTACANCAGCTTT  col-0.fa
13334846  TTATTTCCGAATAGCAGCAATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAACAAGTTTGCTGTACACCAGCTTT  cvi-0.fa
13334846  TTATTTCCGAATAGCAGCAATTACTACANNNNNNNNNNNNNNNNNNNNNNNGTAAAACAAGTTTGCTGTACACCAGCTTT  est-1.fa
13334846  TTATTTCCGAATAGCAGCAATTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAACAAGTTTGCTGTACACCAGCTTT  fei-0.fa
13334846  TTATTTCCGAATAGCAGCAATTACTACNNNNNNNNNNNNNNNNNGANNNNNNTAAAACAAGTTTGCTGTACACCAGCTTT  got-7.fa
13334846  TTATTTCCGAATAGCAGCAATTACTANNNNNNNNNNNNNNNNNNNNNNACCGTAAAACAAGTTTGCTGTACACCAGCTTT  ler-1.fa
13334846  TTATTTCCGAATAGCAGCAATTACTACNNNNNNNNNNNNNNNNNNNTTACCGTAAAACAAGTTTGCTGTACACCAGCTTT  lov-5.fa
13334846  TTATTTCCGAATAGCAGCAATTACTANNNNNNNNNNNNNNNNNNNNNNACCGTAAAACAAGTTTGCTGTACACCAGCTTT  nfa-8.fa
13334846  NNNNNTCCGAATAGCAGCAATTACTACNNNNNNNNNNNNNNNNNNNNNNNNGTAAAACAAGTTTGCTGTACACCAGCTTT  rrs-10.fa
13334846  TTATTTCCGAATAGCAGCAATTACTACNNNNNNNNNNNNNNNNNNNNNNNNNNAAAACAAGTTTGCTGTACACCAGCTTT  rrs-7.fa
13334846  TTATTTCCGAATAGCAGCAATTACTANNNNNNNNNNNNNNNNNNNNNNNNNGTAAAACAAGTTTGCTGTACACCAGCTTT  sha.fa
13334846  TTATTTCCGAATAGCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAAACAAGTTTGCTGTACACCAGCTTT  tamm-2.fa
13334846  TTATTTCCGAATAGCAGCAATTACTANNNNNNNNNNNNNNNNNNNNNNNNNGTAAAACAAGTTTGCTGTACACCAGCTTT  ts-1.fa
13334846  TTATTTCCGAATAGCAGCAATTACTANNNNNNNNNNNNNNNNNNNNNNNNNGTAAAACAAGTTTGCTGTACACCAGCTTT  tsu-1.fa
13334846  TTATTTCCGAATAGCAGCAATTACTANNNNNNNNNNNNNNNNNNNNNNNNNNTAAAACAAGTTTGCTGTACACCAGCTTT  van-0.fa
 
13334926  GGGGGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAAGGAGAATAAACAACAGTTCACATGTTACAAGATGGGAAATTCCC  chr4.fa
13334926  GGGGGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAAGGAGAANAANCANCAGTTCACATGTTACAAGATGGGAAATTCCC  bay-0.fa
13334926  GGGNGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAAGGANNNNNAACAACAGTTCACATGTTACAAGATGGGAAATTCCC  bor-4.fa
13334926  GGGGGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAAGGANNNNNNNNNNNAGTTCACATGTNACAAGATGGGAAATTCCC  br-0.fa
13334926  NGNGGANNNNNNNNNNCTTCGGNTTCTGCAGGANAAGGAGAANNNNCNNCNGNNCNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
13334926  GGGNGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAAGGANNNNNAACAACAGTTCACATGTTACAAGATGGGAAATTCCC  c24.fa
13334926  GGGGGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAAGGAGAATAAACANCAGTTCACATGTTACAAGATGGGAAATTCCC  col-0.fa
13334926  GGGGGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAANNNNNNNNNNNNNNNNTTCACATGTTNCAAGATGGGNAATTCCC  cvi-0.fa
13334926  GGGGGAGCTGAAANCACTTCGGCTTCTGCAGGAAAAGGAGNNNNNNCAACAGTTCACATGTTACAAGATGGGNAATTCCC  est-1.fa
13334926  GGGNNNNNNNAAAGCACTTCGGCTTCTGCAGGAAAAGGANNNNNNNNANNANTTCACATGNNNNNNNNNGGGAAATTCCC  fei-0.fa
13334926  GGGGGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAAGGANNNNNNNCAACAGTTCACATGTTACAAGATGGNAAATTCCC  got-7.fa
13334926  GGGNGAGCTGAAANCACTTCGGCTTCTGCAGGAAAAGGAGNNNNNNCAACAGTTCACATGTTACAAGATGGGAAATTCCC  ler-1.fa
13334926  GGGGGAGCTGAAAGCACNTCGGCTTCTGCAGGAAAAGGAGNNNNNNCAACAGTTCACATGTTACAAGATGGGAAATTCCC  lov-5.fa
13334926  GGGGGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAAGGAGAANAANCANCAGTTCACATGTTACAAGATGGGAAATTCCC  nfa-8.fa
13334926  GGGGGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAAGGAGAANAAACAACAGTTCACATGTTACAAGATGGGAAATTCCC  rrs-10.fa
13334926  GGGGGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAAGGAGAANAAACAACAGTTCACATGTTACAAGATGGGAAATTCCC  rrs-7.fa
13334926  GGGGGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAAGGANNNNNNACAACAGTTCACATGTTACAAGATGGGAAATTCCC  sha.fa
13334926  GGGGGAGCTGAANGCACTTCGGCTTCTGCAGGAAAAGGAGAANAAACAACAGTTCACATGTTACAAGATGGGAAATTCCC  tamm-2.fa
13334926  GGGGGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAAGGAGAANAANCANCAGTTCACATGTTACAAGATGGGAAATTCCC  ts-1.fa
13334926  GGGGGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAAGGAGAANAANCANCAGTTCACATGTTACAAGATGGGAAATTCCC  tsu-1.fa
13334926  GGGGGAGCTGAAAGCACTTCGGCTTCTGCAGGAAAAGGAGAATAANCAACAGTTCACATGTTNCAAGATGGGAAATTCCC  van-0.fa
 
13335006  ATGAGCCCATCCAAACAAGAGTCTCTTTGCCATATATGAGTAAAGCAGAAGAGAAAACTTATTTTAAGAATAAGAGACCT  chr4.fa
13335006  ATGAGCCCANCCAAACAAGAGTCTCTTTGCCATATATGAGTAAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGACCT  bay-0.fa
13335006  ATGAGCCCATCCAAACAAGAGTCTCTTTGCCATATATGAGTAAAGCAGAANNNNNNNNNNNNNNNNNNNNNNAGAGACCT  bor-4.fa
13335006  ATGAGCCCATCCAAACAAGAGTCTCTTTGCCNTATATGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCT  br-0.fa
13335006  ATGAGCCCATCCAAACAAGAGTCTCTTTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGACCN  bur-0.fa
13335006  ATGAGCCCANCCAAACAAGNGTCTCTTTGCCATATATGAGTAAAGCANNNNNNNNNNNNNNNNNNNNNNNNNNGAGACCT  c24.fa
13335006  ATGAGCCCANCCAAACAAGNGTCTCTTTGCCATATATGAGTAAAGCANANNNNNNNNNNNNNNNNNNNNNNNAGAGACCT  col-0.fa
13335006  ATGAGCCCATCCAAACNNNNNNCTCTTTGCCNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCT  cvi-0.fa
13335006  ATGAGCCCATCCAAACAAGAGTCTCTTTGCCATATATGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACCT  est-1.fa
13335006  ATGAGCCCATCCAAACAAGAGTCTCTTTGCCATNTATGAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGACCT  fei-0.fa
13335006  ATGAGCCCATCCAAACAAGAGTCTCTTTGCCATATATGAGTAANGCNGANNNNNNNNNNNNNNNNNNNNNNNNNAGACCT  got-7.fa
13335006  ATGAGNCCANCCAAACAAGNGTCTCTTTGCCATATATGAGTAAAGCAGANGNNNNNNNNNNNNNNNNNNNNNNGAGACCT  ler-1.fa
13335006  ATGAGCCCATCCAANCNNGNGTCTCTTTGCCATATATGAGTAAAGCAGAAGAGANNNNNNNNNNNNNNNNNNNGAGACCT  lov-5.fa
13335006  ATGAGCCCATCCAAACAAGAGTCTCTTTGCCATATATGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGACCT  nfa-8.fa
13335006  ATGAGCCCATCCAAACAAGAGTCTCTTTGCCATATATGAGTAAAGCAGANNNNNNNNNNNNNNNNNNNNNNAAGAGACCT  rrs-10.fa
13335006  ATGAGCCCATCCAAACAAGAGTCTCTTTGCCATATATGAGTAAAGNANNNNNNNNNNNNNNNNNNNNNNNNNAGAGACCT  rrs-7.fa
13335006  ATGAGCCCANCCAAACAAGAGTCTCTTTGCCATATATGAGNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGACCT  sha.fa
13335006  ATGAGCCCATCCAAACAAGAGTCTCTTTGCCATATATGAGTAANNNANNNNNNNNNNNNNNNNNNNNNNNNNNNANACCT  tamm-2.fa
13335006  ATGAGCCCATCCAAACAAGAGTCTCTTTGCCATATATGAGTAAAGCANNNNNNNNNNNNNNNNNNNNNNNNNNGAGACCT  ts-1.fa
13335006  ATGAGCCCANCCAAACAAGAGTCTCTTTGCCATATATGAGTNNNNNNNAANNNNNNNNNNNNNNNNNNNNNAAGAGACCT  tsu-1.fa
13335006  ATGAGCCCATCCAAACAAGAGTCTCTTTGCCATATATGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGACCT  van-0.fa
 
13335086  ACCGATTTTCGATTCTTTTTCATCATGGCGCACAAGCTCATCTTCTTCTTCTTTTGTTTCTGTTTTAACTGGGGGTCCTC  chr4.fa
13335086  ACCGATTTTCGATTCTTTTTCATCATGGCGCACAAGCTCNNNRNNNTNNNRRRRRNNNNNNNNTTTAACTGGGGGTCCTC  bay-0.fa
13335086  ACCGATTTTCGATTCTTTTTCATCATGGCGCACAAGCTCNNCRNNNTNNNRRRRRNNNNNNNNTTTAACNGGGGGTCCTC  bor-4.fa
13335086  ACCGATTTTCGNNNNTTTTTCATCATGGCGCACAAGCTNNNNRNNNTNNNRRRRRNNNNNNNNNTTAACTGGGGGTCCTC  br-0.fa
13335086  ACCGATTTTNGNNTNTTTTTCATCATGGCGCACAANNNNNNNRNNNNNNNRRRRRNNNNNNNNNNTNACTGGGGGTCCTC  bur-0.fa
13335086  ACCGATTTTCGATNCTTTTTCATCATGGCGCACAAGCTCNNNRNNNNNNNRRRRRNNNNNNNNNTTAACTGGGGGTCCTC  c24.fa
13335086  ACCGATTTTCGATTCTTTTTCATCATGGCGCACAAGCTCNNNRNNNTNNNRRRRRNNNNNNNNNTTAACTGGGGGTCCTC  col-0.fa
13335086  ACCGATTTTCGANNNNNNTTCATCATGGCGCACAAGCTCNNNRNNNNNNNRRRRRNNNNNNNNNNNNNNNNNNNNNNCTC  cvi-0.fa
13335086  ACCGATTTTCGATTCTTTTTCATCATGGCGCACAAGCTCNNNRNNNTNNNRRRRRNNNNNNNNNTTAACTGGGGGTCCTC  est-1.fa
13335086  ACCGATTTTCGNTTCTTTTTCATCATGGCGCNCAAGCTNNNNRNNNNNNNRRRRRNNNNNNNNTTTAACTGGGGGTCCTC  fei-0.fa
13335086  ACCGATTTTCGATTCTTTTTCATCATGGCGCACAAGCTCNNNRNNNTNNNRRRRRNNNNNNNNTTTAACTGGGGGTCCTC  got-7.fa
13335086  ACCGATTTTCGATTCTTTTTCATCATGGCGCACAAGCTCNNNRNNNNNNNRRRRRNNNNNNNNTTTAACTGGGGGTCCTC  ler-1.fa
13335086  ACCGATTTTCGATTCTTTTTCATCATGGCGCACAAGCTCNNNRNNNNNNNRRRRRNNNNNNNNTTTAACTGGGGGTCCTC  lov-5.fa
13335086  ACCGATTTTCGATTCTTTTTCATCATGGCGCACAAGCTCNNNRNNNNNNNRRRRRNNNNNTGTTTTAACTGGGGGTCCTC  nfa-8.fa
13335086  ACCGATTTTCGATTNTTTTTCATCATGGCGCACAAGCTCNNNRNNNTNNNRRRRRNNNNNNNNNTTAACTGGGGGTCCTC  rrs-10.fa
13335086  ACCGATTTTCGATTCTTTTTCATCATGGCGCACAAGCTCNNNRNNNNNNNRRRRRNNNNNNNNNTTAACTGGGGGTCCTC  rrs-7.fa
13335086  ACCGATTTTCGATTNTTTTTCATCATGGCGCACAAGCTNNNNRNNNNNNNRRRRRNNNNNNNNNTTAACTGGGGGTCCTC  sha.fa
13335086  ACCGATTTTCGATTCTTTTTCATCATGGCGCACAAGCTCNNNRNNNNNNNRRRRRNNNNNNNNTTTAACTGGGGGTCCTC  tamm-2.fa
13335086  ACCGATTTTCGATTNTTTTTCATCATGGCGCACAAGCTCNNNRNNNTNNNRRRRRNNNNNNNNNTTAACTGGGGGTCCTC  ts-1.fa
13335086  ACCGATTTTCGATTCTTTTTCATCATGGCGCACAAGCTCNNNRNNNNNNNRRRRRNNNNNNNNNTTAACTGGGGGTCCTC  tsu-1.fa
13335086  ACCGATTTTCGATTNTTTTTCATCATGGCGCACAAGCTNNNNRNNNTNNNRRRRRNNNNNNNNNTTAACTGGGGGTCCTC  van-0.fa
 
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGTCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  chr4.fa
13335166  CAAAGCTCATGTGGTTGNNNNNCAACAAAGAACTCTTGTCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  bay-0.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGNCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGNN  bor-4.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGNCAAACTCGTATCCAGGCTCTGTACAAACCGAANNNNNNNNN  br-0.fa
13335166  CAAAGCTCATGTGGTTGTATTCCNNNNNNNANCNNNNNNNAAACTCGTATCCAGGCTCTGTACAAACCGNACAATATGNN  bur-0.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGNCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  c24.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGTCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  col-0.fa
13335166  CAAAGCTCATGTGGTTGTATTCNNNNNNNNANNTCNNNNCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATANNNN  cvi-0.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGTCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  est-1.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCNTGTCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATNNN  fei-0.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGTCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  got-7.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGNCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  ler-1.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGTCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  lov-5.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGTCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  nfa-8.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGTCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  rrs-10.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGTCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  rrs-7.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGNCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  sha.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAANAAAGAACTCTTGNCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  tamm-2.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGTCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  ts-1.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGNCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  tsu-1.fa
13335166  CAAAGCTCATGTGGTTGTATTCCAACAAAGAACTCTTGTCAAACTCGTATCCAGGCTCTGTACAAACCGAACAATATGCA  van-0.fa
 
13335246  TTGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  chr4.fa
13335246  TTGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCNACATTC  bay-0.fa
13335246  NNNNAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATNNNNNNNNNNANNNN  bor-4.fa
13335246  NNNNNNNNNNNNNACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  br-0.fa
13335246  NNNNNGTTATATCNCAAGCAGNTNNANCACGAAGAATCAAGCAANTGATCCACNGAAGTTACAATGAGATTCCTACATNC  bur-0.fa
13335246  TTGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  c24.fa
13335246  TTGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  col-0.fa
13335246  NNNNNNNNATATNANNNNNNNNNNNNNCACGAANNNNNNNGCAAANNNNCCACAGANNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
13335246  NTGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  est-1.fa
13335246  NNNNAGTTATATCACAAGCAGTNAAATCACGAAGAATCAAGCAAATGANCCACAGAAGTTACAATGAGATTCCTACATTC  fei-0.fa
13335246  TNGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  got-7.fa
13335246  TTGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  ler-1.fa
13335246  TTGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  lov-5.fa
13335246  TTGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  nfa-8.fa
13335246  TTGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  rrs-10.fa
13335246  TTGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  rrs-7.fa
13335246  TTGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  sha.fa
13335246  TNGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCNAATGATCCACAGAAGTTACAANGAGATTCCTACATTC  tamm-2.fa
13335246  TTGAAGTTATATCACAAGCAGTTANATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  ts-1.fa
13335246  TNGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  tsu-1.fa
13335246  TTGAAGTTATATCACAAGCAGTTAAATCACGAAGAATCAAGCAAATGATCCACAGAAGTTACAATGAGATTCCTACATTC  van-0.fa
 
13335326  ATGACTGTGTTGCAGATGGAAACAGAACATGATAACAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  chr4.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGAANNNNNNNANAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  bay-0.fa
13335326  NNNACTGTGTTGCAGATGGAAACAGAANNNNNNNNNNAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  bor-4.fa
13335326  ATGACTGTGTTGCAGATGGAAACANNNNNNNNNNNNAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTNTTC  br-0.fa
13335326  NNNNNTGTGTTGCAGATGGAAACANNNNNNNNNNNNNNNNNATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  bur-0.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGANNNNNNNNNNAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  c24.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGAACANNNNAACAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  col-0.fa
13335326  NNGACTGTGTTGCAGATGGAAACNNNNNNNNNNNNNNNNNNNTACGTTTGGTTNNNNNTTACCTCTTCTTGCGTTTNTTC  cvi-0.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGAANNNNNNNACAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  est-1.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGANNNNNNNNNNAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTNTTC  fei-0.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGANNNNNNNNACAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  got-7.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGNNNNNNNNNNNAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  ler-1.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGANNNNNNNNACAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  lov-5.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGANNNNNNNNACAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  nfa-8.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGAANNNNNNNNNAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  rrs-10.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGAACANNNNNNNAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  rrs-7.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGNNNNNNNNNNCAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  sha.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGNNNNNNNNNNNAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  tamm-2.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGANNNNNNNNNNAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  ts-1.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGAANNNNNNNACAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  tsu-1.fa
13335326  ATGACTGTGTTGCAGATGGAAACAGANNNNNNNNNNAAAAAATACGTTTGGTTGATACTTACCTCTTCTTGCGTTTATTC  van-0.fa
 
13335406  TCTTCTCAAAGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTACACTGTCAATATCATCCAGCAAC  chr4.fa
13335406  TCTNNNNNNNGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTACACTGTCAATATCATCCAGCAAC  bay-0.fa
13335406  TCNNNNNAAAGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTACACTGTCAATATCATCCAGCAAC  bor-4.fa
13335406  TCTNNNNNNNGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTNNNNNNTCAATATCATCCAGCAAC  br-0.fa
13335406  TCTTNNNNNNNNNACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGNNNNNNNNTNTCAATATCATCCAGCAAC  bur-0.fa
13335406  TCTNNNNNNAGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTACACTGTCAATATCATCCAGCAAC  c24.fa
13335406  TCTNNNNNNAGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTACACTGTCAATATCATCCAGCAAC  col-0.fa
13335406  TCNNNNNNNNNAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTANNNNNNNNTCAATATCATCCAGCAAC  cvi-0.fa
13335406  TCTTCNNNNAGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTANNNNNTCAATATCATCCAGCAAC  est-1.fa
13335406  TCNNNNNNNAGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTNNNNNNNCAATATCATCCAGCAAC  fei-0.fa
13335406  TNNNNNNNNNGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTACNCTGTCAATATCATCCAGCAAC  got-7.fa
13335406  TCTNNNNNNAGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATNNNNNNNTCAATATCATCCAGCAAC  ler-1.fa
13335406  TCTTNNNNNAGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTACACTGTCAATATCATCCAGCAAC  lov-5.fa
13335406  TCTTNNNNNAGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTACACTGTCAATATCATCCAGCAAC  nfa-8.fa
13335406  TCTNNNNNNNGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATNNNNNNNNNNNTNCNNNCCAGCAAC  rrs-10.fa
13335406  TCNNNNNNNAGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTACACTGTCAATATCATCCAGCAAC  rrs-7.fa
13335406  TCTNNNNNNAGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTACANNNNCAATATCATCCAGCAAC  sha.fa
13335406  TNNNNNNNNNGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTANACTGTCAATATCATCCAGCAAC  tamm-2.fa
13335406  TCTTNNNNNAGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTACNNNNNCAATATCATCCAGCAAC  ts-1.fa
13335406  TCNNNNNNNAGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTACNCTGTCAATATCATCCAGCAAC  tsu-1.fa
13335406  TCTTNNNNNNGAGACGAATTGGGTCAGAGCCTTCTAAGCATGCGGCATAAAGTATTACACNGTCAATATCATCCAGCAAC  van-0.fa
 
13335486  ATGATCAGAGAGGGTAGATACATCATTCATATTGATAGGAGATAATCATATCAAAGTTCAATTTTTTGGCTGAAATCAAG  chr4.fa
13335486  ATGATCAGAGAGGGTAGATACATCATTCATATTGATANNNNNNNNNNNNANNNNNNNTCAATTTTTTGGCTGAAATCAAG  bay-0.fa
13335486  ATGATCAGAGAGGGTAGATACATCATTNATNTTNNNNNNNNNNNNNNNNNNNNNNNNTCAATTTTTTGGCTGAAATCAAG  bor-4.fa
13335486  ATGATCAGAGAGGGTAGATACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTTTTTGGCTGAAANCNNG  br-0.fa
13335486  ATGANCAGAGAGGGTAGATACATNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNTCAATTTTTTGGCTGAANNNNNN  bur-0.fa
13335486  ATGATCAGAGAGGGTAGATACATCNTTCATATTNATNNNNNNNNNNCANNNNNNNNTTCAATTTTTTGGCTGAAATCAAG  c24.fa
13335486  ATGATCAGAGAGGGTAGATACATCATTCATATTGATAGGNNNNNNNCATATCAANGTTCAATTTTTTGGCTGAAATCAAG  col-0.fa
13335486  ATGATCAGAGAGGGTAGATACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTTTTTGNNNNNNNNNNNN  cvi-0.fa
13335486  ATGATCAGAGAGGGTAGATACATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCAATTTTTTGGCTGAAATCNNN  est-1.fa
13335486  ATGNTCAGAGAGGGTAGATACATNNNNNNNNNNNNNNNNNNNNNNNCATNNNNNNNNTCAATTTTTTGGCTGAAATCAAG  fei-0.fa
13335486  ATGATCAGAGAGGGTAGATACATCNTNCATATTGATNNNNNNNNNNNNNNNNNNNGTTCAATTTTTTGGCTGAAATCAAG  got-7.fa
13335486  ATGATCAGAGAGGGTAGATACATCNTTCATATTNNNNNNNNNNNNNNNNANNNNNGTTCAATTTTTTGGCTGAAATCANN  ler-1.fa
13335486  ATGATCAGAGAGGGTAGATACATCATTCATATTGATAGNNNNNNNNCATATCANAGTTCAATTTTTTGGCTGAAATCAAG  lov-5.fa
13335486  ATGATCAGAGAGGGTAGATACATCANTCATATTNNNNNNNNNNNNNCNTNNNNNNNNNCAATTTTTTGGCTGAAATCAAG  nfa-8.fa
13335486  ATGATCAGAGAGGGTAGATACATCATTCATATTNATNNNNNNNNNNNNTANNNNNNNTCAATTTTTTGGCTGAAATCAAG  rrs-10.fa
13335486  ATGATCAGAGAGGGTAGATACATNNNNNNTATTGNNNNNNNNNNNNNNNNNNNNNNNTCAATTTTTTGGCTGAAATCAAG  rrs-7.fa
13335486  ATGATCAGAGAGGGTAGATACATCATNCATATTNNNNNNNNNNNNNNNNNNNNNNNNNCAATTTTTTGGCTGAAATCAAG  sha.fa
13335486  ATGATCAGAGAGGGTAGATACATCATNCATANNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTTTTTGGCTGAAATCNNN  tamm-2.fa
13335486  ATGATCAGAGAGGGTAGATACATCATTCATNNNNNNNNNNNNNNNNNANANNNNNNNNCAATTTTTTGGCTNAANTNNNN  ts-1.fa
13335486  ATGATCAGAGAGGGTAGATACATCATNNNNATTGANNNNNNNNNNNNNNNTNNNNNNNNAATTTTTTGGCTGAAATCAAG  tsu-1.fa
13335486  ATGATCAGAGAGGGTAGATACATCATTCATANNNNNNNNNNNNNNNNNNANNNNAGTTCAATTTTTTGGCTGAAATCAAG  van-0.fa
 
13335566  TAAAAAGAGAGAACTAATGGCTTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGTTCTGGGTTTAG  chr4.fa
13335566  TAAAAANAGAGAACTAATGGCTTAATACTTCTACCCNCGAGAAAAATTGACTGTTGAGTGAGGCAAGGNNNNNNNNNNNR  bay-0.fa
13335566  NANNNNNNNNNNNNNAATGGCTTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGTTCTGGGTTNNR  bor-4.fa
13335566  NANNNNNNNNGNNNNNNNGGCTTNATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGNNNNNNGTNNNR  br-0.fa
13335566  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNCNNNNNNNAAATTGACTGTNGAGTGAGGCAAGGNNNNNNGTNNNR  bur-0.fa
13335566  NAANAANAGAGAACTAATGGCTTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGTTCTGNGNNNNR  c24.fa
13335566  NAANAANNNNNAACTAATGGCTTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGTTCNNNNNNNNR  col-0.fa
13335566  NNNNNNNNNNNNNNNNNNNNNNNNATACTTCTNCCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGNNNNNNNNNNNR  cvi-0.fa
13335566  NNNNNNNNGANAACTAATNNNNNNATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGTTCNNNNNTNNR  est-1.fa
13335566  NAANAANNNNNNNNNNNNNNNTTAATACTTCTACCCTCGAGAAAAATTGNCTGTTGAGTGAGGCAAGGNNNNNNNNNNNR  fei-0.fa
13335566  TAANNNNNNAGAACTAATGGCTTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGTTCTGNGNTNNR  got-7.fa
13335566  NNNNNNNNNNNNACTAATGGCTTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGNNNNNNNNNNNR  ler-1.fa
13335566  TAAAAANAGAGAACTAATGGCTTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGTTNNNNNNNNNR  lov-5.fa
13335566  NAANAANAGAGAACTAATGGCTTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGTTCNNNNNTNNR  nfa-8.fa
13335566  NANNNNNNNAGAACTAATGGCTTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGTTCTGGGTNTNR  rrs-10.fa
13335566  NNNNNNNNNAGNNNNNNTGGCTTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGTTCTGGGTTTNR  rrs-7.fa
13335566  NANNNNNNNNNNACTAATGGCNTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGNNNNNNGTNNNR  sha.fa
13335566  NNNNNNNNNNNNNNNAATGGCTTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGNNNNNGNGTNNNR  tamm-2.fa
13335566  NNNNAANNNNNNNNNAATGGCTTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGTTCTGNGNTTNR  ts-1.fa
13335566  NNNNNNNNGAGAACNAATGGCTTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGTTCTGGNNNNNR  tsu-1.fa
13335566  NANNNNNNNNNNNNNAATGGCTTAATACTTCTACCCTCGAGAAAAATTGACTGTTGAGTGAGGCAAGGTTCNGGGTNNNR  van-0.fa
 
13335646  GGTTTTAGGTTAAACCTTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGATG  chr4.fa
13335646  NNNTTTNNNNNNNNNNNTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGACN  bay-0.fa
13335646  NNNNNNNNNNNNNNNNTTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGATG  bor-4.fa
13335646  NNNTNNNNNNNNNNNNNNAAAACCCAGACAATGGAACACTAAGTTGNGACTTATTCTTGTCACACCAAGCCGCATAGATG  br-0.fa
13335646  NNNTTNNNNNNNNNNNNNNAAACCCAGACAANNNNNNNNTNANNTNAGACTTATTCTTGTCACACCAAGCCGCATNGATG  bur-0.fa
13335646  NNNTNNNNNNNNNNNNTTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGATG  c24.fa
13335646  NNNNNNNNNNNNNNNNNTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGATG  col-0.fa
13335646  NNNNNNNNNNNNNNNNNNNNAACCCAGACAATGGAACACTAAGTTGNNNNNNATTCTTGTCACACCAAGCCGCATAGATG  cvi-0.fa
13335646  NNNNNNNNNNNNNNNNNTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGACG  est-1.fa
13335646  NNNNNNNNNNNNNNNNNNNAAACCCAGACAATGGAACACTAAGTTGAGNCTTATTCTTGTCACACCAAGCCGCATAGATG  fei-0.fa
13335646  NNNNNNNNNNNNNNNNNTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGATG  got-7.fa
13335646  NNNTNNNNNNNNNNNNTTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGATG  ler-1.fa
13335646  NNNTNNNNNNNNNNNNTTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATNNNCN  lov-5.fa
13335646  NNNTTNNNNNNNNNNNTTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGNCN  nfa-8.fa
13335646  NNNTNNNNNNNNNNNCTTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGATG  rrs-10.fa
13335646  NNNTNNNNNNNNNNNNTTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGACG  rrs-7.fa
13335646  NNNNNNNNNNNNNNNNNNAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGACG  sha.fa
13335646  NNNTNNNNNNNNNNNNTTNANACCCAGACNATGGAACACTAAGTTGNGACTTATTCTTGTCACACCAAGCCGCATAGATG  tamm-2.fa
13335646  NNNTTTNNNNNNNNNNNTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGATG  ts-1.fa
13335646  NNNNNNNNNNNNNNNNNTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGACG  tsu-1.fa
13335646  NNNNNNNNNNNNNNNNTTAAAACCCAGACAATGGAACACTAAGTTGAGACTTATTCTTGTCACACCAAGCCGCATAGACG  van-0.fa
 
13335726  ACTGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCTAAAATTTCCAATTTTTTTCAAATCAACGAAACG  chr4.fa
13335726  NNNGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCNANNANTTNNNNNNNTTTTCAAATCAACGAAACG  bay-0.fa
13335726  ACTGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCNAAAATTNNNNNNNNNNNNCAAATCAACGAAACG  bor-4.fa
13335726  ACTGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCNNNNNNAATTTNNNNNNNNTTTCAAANCAACGAAACG  br-0.fa
13335726  ACTGAATCGTTTCCAATTCTAGTAANGGCGAATTTTCATNNNNNNNNNNNNNNNNNNNNNNNTTTCAAATCAACGAAACG  bur-0.fa
13335726  ACTGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCNAAAATTTNNNNNNNNTTTCAAATCAACGAAACG  c24.fa
13335726  ACTGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCNANNANNNNNNNNNNNTTTCAAATCAACGAAACG  col-0.fa
13335726  ACTGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGAAACG  cvi-0.fa
13335726  ANTGNATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTNCNNCNANNANTTNNNNNNNNNTTCAAATCAACGAAACG  est-1.fa
13335726  ACTGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCNAAAATNNNNNNNNNNNTTCAAATCAACGAAACG  fei-0.fa
13335726  ACTGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCNAAAATTTNNNNNNNNNTTCAAATCAACGAAACG  got-7.fa
13335726  ACTGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCNAAAATTTCCAATTTTTTTCAAATCAACGAAACG  ler-1.fa
13335726  NCTGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCNAAAATTTCCANTTTTTTTCAAATCAACGAAACG  lov-5.fa
13335726  NNNNNNNCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCNNNNNTTNNNNNNNNNTTTCAAATCAACGAAACG  nfa-8.fa
13335726  ACTGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCNAAAATTTNNNNNNNNNTTCAAATCAACGAAACG  rrs-10.fa
13335726  ANTGNATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCNAAAATTNNNNNNNNTTTTCAAATCAACGAAACG  rrs-7.fa
13335726  ACTNNNTCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCNNNNNNNATNNNNNNNNNNNTTCAAATCAACGAAACG  sha.fa
13335726  ACTGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCNAAAATTTNNNNNNNNTTTCAAATCNACGAAACG  tamm-2.fa
13335726  ACTGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGNNNNNNNAATTNNNNNNNNNNTTCAAATCAACGAAACG  ts-1.fa
13335726  ACTGAATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCNAAAATTTNNNNNNNNTTTCAAATCAACGAAACG  tsu-1.fa
13335726  ANTGNATCGTTTCCAATTCTAGTAAAGGCGAATTTTCATTTGCAGCNAAAATTTNNNNNNNNTTTCAAATCNACGAAACG  van-0.fa
 
13335806  ATTACGATTTCAGAAACGCTTAAAGTGAGAAAACGAAGCTTACAGAGCGAGCTCGCGTGCGGCTCGAGGACTGCTTAATC  chr4.fa
13335806  ATTACGATTTCAGAAACGCTTAAAGTGAGAAAACGAAGCTTACAGAGCGANNNNNNGTGCGGCTCGAGGACTGCTTAATC  bay-0.fa
13335806  ATTACGATTTCAGAAACGCTTAAAGTGAGAAAACGAAGCTTACAGAGCNNNNNCGCGTGCGGCTCGNGGACTGCTTAATC  bor-4.fa
13335806  ATTACGATTTCAGAAACGCTNAAAGTGAGAAAACGAAGCTTACAGANNNNNNNNNCGTGCGGNTCGAGGACTGCTTAATC  br-0.fa
13335806  ATTACGANTTCAGAAACGNNNNNNNNNAGAAAACGAAGCNNNNNNNNNNNNNNNNNNNGCGGCTCGNGGACTGCTTNATC  bur-0.fa
13335806  ATTACGATTTCAGAAACGCTNAAAGTGAGAAAACGAAGCTTACANNNNNNNNNNNNGTGCGGCTCGNGGACTGCTTAATC  c24.fa
13335806  ATTACGATTTCAGAANCNNTNAAAGTGAGAAAACGAAGCTTACAGAGCGAGNTNGCGTGCGGCTCGAGGACTGCTTAATC  col-0.fa
13335806  ATTACGATTTCAGAAACGCNNNNNNNNNNGNNNNNNNNCTTACAGAGCGAGNTCGCGTGCGGCTCGAGGACTGCTTAATC  cvi-0.fa
13335806  ATTACGATTTCAGAAACGCTTAAAGTGAGAAAACGAAGCTTACAGAGCGANNNNNCGTGCGGCTCGNGGACTGCTTAATC  est-1.fa
13335806  NTTACGATTNNAGAAACNNNNNNAGTGAGAAAANGAAGCTTACAGAGCNNNNNNNNNTGCGGCTCGAGGACTGCTTAATC  fei-0.fa
13335806  ATTACGATTTCAGAAACGCTTAAAGTGAGAAAACGAAGCTTACAGAGCGANNNNNNNTGCGGCTCGNGGACTGCTTAATC  got-7.fa
13335806  ATTACGATTTCAGAAACGCTTAAAGTGAGAAAACGAAGCTTACAGANNNNNNNNNNNTGCGGCTCGNGGACTGCTTAATC  ler-1.fa
13335806  ATTACGATTTCAGAAACGCTTAAAGTGAGAAAACGAAGCTTACAGAGCNNNNNNNNNNGCGGCTCGAGGACTGCTTAATC  lov-5.fa
13335806  ATTACGATTTCAGAAACGCTTAAAGTGAGAAAACGAAGCTTACAGAGCNNNNNNNNGTGCGGCTCGAGGACTGCTTAATC  nfa-8.fa
13335806  ATTACGATTTCAGAAACGCTTAAAGTGAGAAAACGAAGCTTACAGAGCGAGCTCGNGTGCGGCTCGAGGACTGCTTAATC  rrs-10.fa
13335806  ATTACGATTTCAGAAACGCTTAAAGTGAGAAAACGAAGCTTACAGAGCNNNNNNNNGTGCGGCTCGNGGACTGCTTAATC  rrs-7.fa
13335806  ATTACGATTTCAGAAACGCTTAAAGTGAGAAAACGAAGCTTACAGAGNNNNNNNNNNNGCGGCTCGNGGACTGCTTAATC  sha.fa
13335806  ATTACGATTTCAGAAACGCTNAAAGTGAGAAAACGAAGCTTACANNNNNNNNNNNNNNGCGGNTCGAGGACTGCTTAATC  tamm-2.fa
13335806  ATTACGATTTCAGAAACGCTTAAAGTGAGAAAACGAAGCTTACAGAGCGAGNNNNNGTGCGGCTCGAGGACTGCTTAATC  ts-1.fa
13335806  ATTACGATTTCAGAAACGCTTAAAGTGAGAAAACGAAGCTTACAGAGCGAGNTCGCGTGCGGCTCGAGGACTGCTTAATC  tsu-1.fa
13335806  ATTACGATTTCAGAAACGCTTAAAGTGAGAAAACGAAGCTTACAGAGCGAGNTCGCGTGCGGCTCGAGGACTGCTTAATC  van-0.fa
 
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  chr4.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  bay-0.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  bor-4.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCNNNNNNAGAAATAGTCGGCGTACGGAGAGCGCTTCTA  br-0.fa
13335886  GGCCGCNCTTATCAATCTTCGGCATCGGGACATCTNTCACNTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  bur-0.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  c24.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCNTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  col-0.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  cvi-0.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  est-1.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  fei-0.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCNCCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  got-7.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  ler-1.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  lov-5.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  nfa-8.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCNCCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  rrs-10.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCNCCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  rrs-7.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  sha.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  tamm-2.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCNCCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  ts-1.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  tsu-1.fa
13335886  GGCCGCTCTTATCAATCTTCGGCATCGGGACATCTTTCACCTCCTCCGCGGAAATAGTCGGCGTACGGAGAGCGCTTCTA  van-0.fa
 
13335966  GTCGGAGAGAGAAATAGCCGTAGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  chr4.fa
13335966  GTCGGAGAGAGAAATAGCCGTAGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  bay-0.fa
13335966  GTCGGAGAGAGAAATAGCCGTAGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  bor-4.fa
13335966  GTCGGAGAGAGAAATAGCCGTNGTGAAGACGANGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTNGGCCG  br-0.fa
13335966  GTCGGAGAGAGAAATNGCCGTAGTGAAGACGATGACGAACGTTNATTTCCCNNNNNNNNGGAAACCAAGTTCGTTGGCCG  bur-0.fa
13335966  GTCGGAGAGAGAAATAGCCGTAGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  c24.fa
13335966  GTCGGAGAGAGAAATNGCNGTNGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  col-0.fa
13335966  GTCGGAGAGAGAAATNGCCGTAGTGAAGACGATGACGAACGTTTNTTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  cvi-0.fa
13335966  GTCGGAGAGAGAAATNGCCGTAGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  est-1.fa
13335966  GTCGGAGAGAGAAATNGCNGTNNNNANNNNNNNGACGAACGTTTATTTCCCGTTCGCNGGGAAACCAAGTTCGTTGGCCG  fei-0.fa
13335966  GTCGGAGAGAGAAATAGCCGTAGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  got-7.fa
13335966  GTCGGAGAGAGAAATNGCNGTNGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  ler-1.fa
13335966  GTCGGAGAGAGAAATNGCCGTAGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  lov-5.fa
13335966  GTCGGAGAGAGAAATNGCCGTAGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  nfa-8.fa
13335966  GTCGGAGAGAGAAATAGCCGTAGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  rrs-10.fa
13335966  GTCGGAGAGAGAAATAGCCGTAGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  rrs-7.fa
13335966  GTCGGAGAGAGAAATAGCCGTAGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  sha.fa
13335966  GTCGGAGAGAGAAATAGCCGTAGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  tamm-2.fa
13335966  GTCGGAGAGAGAAATAGCCGTAGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  ts-1.fa
13335966  GTCGGAGAGAGAAATAGCCGTAGTGAAGACGATGACGAACGTTTATTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  tsu-1.fa
13335966  GTCGGAGAGAGAAATNGCCGTAGTGAAGACGATGACGAACGTTTNTTTCCCGTTCGCAGGGAAACCAAGTTCGTTGGCCG  van-0.fa
 
13336046  GAGCGAATCAACCAATGTAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  chr4.fa
13336046  GAGCGAATCAACCAATGTAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  bay-0.fa
13336046  GAGCGAATCAACCAATGTAAANCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGANAAGTAACAGAGGTTCGAAG  bor-4.fa
13336046  GAGCGAATCAACCAATGTNAANCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGNNNNNNNNNNNNNNNNNNN  br-0.fa
13336046  GAGCGAATCAACCAATGTAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  bur-0.fa
13336046  GAGCGAATCAACCAATGTAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  c24.fa
13336046  GAGCGAATCAACCAATGTAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  col-0.fa
13336046  GAGCGAATCAACCAATNNNNNNNNNNTAGAACGGTGAGAATCNGGTGAAACATTACTGGAGAAGNAACAGAGGTTCGAAG  cvi-0.fa
13336046  GAGCGAATCAACCAATGTAAATCCNATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  est-1.fa
13336046  GAGCGAATCAACCAATGNAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  fei-0.fa
13336046  GAGCGAATCAACCAATGTAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  got-7.fa
13336046  GAGCGAATCAANCAATGTAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  ler-1.fa
13336046  GNNTNNNTCAACCAATGTAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  lov-5.fa
13336046  GAGCGAATCAACCAATGTANATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  nfa-8.fa
13336046  GAGCGAATCAACCAATGTAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  rrs-10.fa
13336046  GAGCGAATCAACCAATGTAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  rrs-7.fa
13336046  GAGCGAATCAACCAATGTAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  sha.fa
13336046  GAGCGAATCAACCAATGTAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  tamm-2.fa
13336046  GAGCGAATCAACCAATGTAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  ts-1.fa
13336046  GAGCGAATCAACCAATGNAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  tsu-1.fa
13336046  GAGCGAATCAACCAATGTAAATCCTATAGAACGGTGAGAATCTGGTGAAACATTACTGGAGAAGTAACAGAGGTTCGAAG  van-0.fa
 
13336126  AAGAACGTAAGCAAAGCGGCGAGAAGGT   chr4.fa
13336126  AAGAACGTAAGCNAAGCGGCGAGAAGGT   bay-0.fa
13336126  AAGAACGTAAGCAAAGCGGCGAGAAGGT   bor-4.fa
13336126  NNNNNNNNNNNNNNNNCGGCGAGANGGN   br-0.fa
13336126  AAGANNNNNNNCAAAGCGGCGAGAAGGT   bur-0.fa
13336126  AAGAACGTAAGCAAAGCGGCGAGAAGGT   c24.fa
13336126  AAGAACGTAAGCNAAGCGGCGAGAAGGT   col-0.fa
13336126  AAGAACGTNAGCAAAGCGGCGAGAAGGT   cvi-0.fa
13336126  AAGAACGTAAGCAAAGCGGCGAGAAGGT   est-1.fa
13336126  AAGAACGTAAGCAAAGCGGCGAGAAGGT   fei-0.fa
13336126  AAGAACGTAAGCAAAGCGGCGAGAAGGT   got-7.fa
13336126  AAGAACGTAAGCAAAGCGGCGAGAAGGT   ler-1.fa
13336126  AAGAACGTAAGCAAAGCGGCGAGAAGGT   lov-5.fa
13336126  AAGAACGTAAGCAAAGCGGCGAGAAGGT   nfa-8.fa
13336126  AAGAACGTAAGCAAAGCGGCGAGAAGGT   rrs-10.fa
13336126  AAGAACGTAAGCAAAGCGGCGAGAAGGT   rrs-7.fa
13336126  AAGAACGTAAGCAAAGCGGCGAGAAGGT   sha.fa
13336126  AAGAACGTAAGCNAAGCGGCGAGAAGGT   tamm-2.fa
13336126  AAGAACGTAAGCAAAGCGGCGAGAAGGT   ts-1.fa
13336126  AAGAACGTAAGCAAAGCGGCGAGAAGGT   tsu-1.fa
13336126  AAGAACGNAAGCAAAGCGGCGAGAAGGT   van-0.fa
 
visited.