Arabidopsis SNP Sequence Viewer

Chromosome : chr4 Coordinates : 13344953 - 13346023


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGAAGAGGATGAAGAGAATAATC  chr4.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGAAGANGATGAAGAGAATAATC  bay-0.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGAAGANGATGAAGAGAATAATC  bor-4.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGANNNNNNNNNAGAGAATAATC  br-0.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGNNNNNATGACCCCGANGCNGANGCGGATGACGANNNNNNNNNNNAGAATAATC  bur-0.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGANNNNGATGAAGAGAATAATC  c24.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGNTGCGGATGACGAAGANGATGAAGAGAATAATC  col-0.fa
13344953  NCNNNNNGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGANNNNNNNNAAGAGAATAATC  cvi-0.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGANNNNNNNGAAGAGAATAATC  est-1.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGAAGANGNTGAAGAGAATAATC  fei-0.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGANNNNGATGAAGAGAATAATC  got-7.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGANNNNNNNNNNGAGAATAATC  ler-1.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGANNNNNNNGAAGAGAATAATC  lov-5.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGAAGNNNNNNNAGAGAATAATC  nfa-8.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGAAGANNNNGAAGAGAATAATC  rrs-10.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGANNNNGATGAAGAGAATAATC  rrs-7.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGAAGANNNNGAAGAGAATAATC  sha.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGANGCGGATGACGANNNNNNNGAAGAGAATAATC  tamm-2.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGAAGANNNNGAAGAGAATAATC  ts-1.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGANNNNNNNGAAGAGAATAATC  tsu-1.fa
13344953  AATAGCAGTTTACGAGTTCTCACCGAGATGAGATGACCCCGAGGCCGATGCGGATGACGAAGANGATGAAGAGAATAATC  van-0.fa
 
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  chr4.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  bay-0.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  bor-4.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  br-0.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  bur-0.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  c24.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  col-0.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACNTTCTCATTACTT  cvi-0.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  est-1.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTNCANCANCTTCCACATTCTCATTACTT  fei-0.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  got-7.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCNCATTCTCATTACTT  ler-1.fa
13345033  CGCTGAACGGCCATGGAAAAGNGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  lov-5.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  nfa-8.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  rrs-10.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  rrs-7.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  sha.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  tamm-2.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  ts-1.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  tsu-1.fa
13345033  CGCTGAACGGCCATGGAAAAGAGAACCTTCTCTCGCTCACATTACTGTTCCTTGCATCATCTTCCACATTCTCATTACTT  van-0.fa
 
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  chr4.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  bay-0.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  bor-4.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  br-0.fa
13345113  NCGTTGATCTCTNGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  bur-0.fa
13345113  ACGTTGATCTCTAGNGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  c24.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCANCATCAGGAGGGAGTTCATATCGGCA  col-0.fa
13345113  NCGTTGATCTCTAGNGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  cvi-0.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  est-1.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  fei-0.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  got-7.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  ler-1.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTNTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  lov-5.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  nfa-8.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  rrs-10.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  rrs-7.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  sha.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  tamm-2.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  ts-1.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  tsu-1.fa
13345113  ACGTTGATCTCTAGAGTTCTTGTTCTCGGTCTTACAGGATTAACCTTGGTCTCATCATCAGGAGGGAGTTCATATCGGCA  van-0.fa
 
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCTTACACGGCATCTCTTTAG  chr4.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTAG  bay-0.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTAG  bor-4.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTAG  br-0.fa
13345193  CACGGGACATGAACTGTGAAGCTCGANNNNNNNNGNNNNNNNNCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTAG  bur-0.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTAG  c24.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTAG  col-0.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTNG  cvi-0.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTNTGCRRRRRRRRRRRCTCTTTAG  est-1.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTAG  fei-0.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTAG  got-7.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTAG  ler-1.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTAG  lov-5.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTAG  nfa-8.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTAG  rrs-10.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTAG  rrs-7.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTNTGCRRRRRRRRRRRCTCTTTAG  sha.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTGCTNTANACCGGATGTGAAACTTGTNCRRRRRRRRRRRCTCTTTAG  tamm-2.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTNG  ts-1.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTNTGCRRRRRRRRRRRCTCTTTNG  tsu-1.fa
13345193  CACGGGACATGAACTGTGAAGCTCGAGCCACGGTACTATACACCGGATGTGAAACTTGTGCRRRRRRRRRRRCTCTTTAG  van-0.fa
 
13345273  CTTCACTTCCTTTGTCAAAATCATCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  chr4.fa
13345273  CTTCACTTCCTTTGTCAAAARCANCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  bay-0.fa
13345273  CTTCACTTCCTTTGTCAAAARCATCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  bor-4.fa
13345273  CTTCACTTCCTTTGTCAAAARCNNCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  br-0.fa
13345273  CTTCACTTCCTTNGTCAAAARNNNCCAAACAAATCGAGCANTGCAATGATTCACTTATCTTAACCGTTGGGAGATTANCC  bur-0.fa
13345273  CTTCACTTCCTTTGTCAAAARCANCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  c24.fa
13345273  CTTCACTTCCTTTGTCAAAARCANCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  col-0.fa
13345273  CNTCNCTTCCTTTGTCAAANRCANCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  cvi-0.fa
13345273  CTTCACTNCCTTTGTCAAAARCANCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  est-1.fa
13345273  CTTCACTTCCTTTGTCAAAARCANCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  fei-0.fa
13345273  CTTCACTTCCTTTGTCAAAARCANCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  got-7.fa
13345273  CTTCACTTCCTTTGTCAAAARCNNCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTANCC  ler-1.fa
13345273  CTTCACTTCCTTTGTCAAAARCANCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTANCC  lov-5.fa
13345273  CTTCACTTCCTTTGTCAAAARCANCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  nfa-8.fa
13345273  CTTCACTTCCTTTGTCAAAARCANCCANNCAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  rrs-10.fa
13345273  CTTCACTNCCTTTGTCAAAARCATCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  rrs-7.fa
13345273  CTTCACTTCCTTTGTCAAAARCNNCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  sha.fa
13345273  CTTCACTTCCTTTGTCAAAARCATCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTANCC  tamm-2.fa
13345273  CTTCACTTCCTTTGTCAAAARCNNCCAAACAAATCGAGCACTGCAATGATTCNNNNNNNNCNNNNNNNGGGAGATTATCC  ts-1.fa
13345273  CTTCACTTCCTTTGTCAAAARCATCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  tsu-1.fa
13345273  CTTCACTTCCTTTGTCAAAARCANCCAAACAAATCGAGCACTGCAATGATTCACTTATCTTAACCGTTGGGAGATTATCC  van-0.fa
 
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  chr4.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  bay-0.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  bor-4.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  br-0.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGNATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  bur-0.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  c24.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  col-0.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  cvi-0.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCANTATCAGCTAGNTGTTCAAGCAAATGGTCTAAACT  est-1.fa
13345353  ACNACNNNNNNNNANNNNNNNGNNNTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  fei-0.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  got-7.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  ler-1.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  lov-5.fa
13345353  ACAACTTCTTTACGTGCTGGAGGACTCCCGTGCCTGATTGAATCATTATCAGCTAGANGTTCAAGCAAATGGTCTAAACT  nfa-8.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  rrs-10.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  rrs-7.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  sha.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  tamm-2.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  ts-1.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  tsu-1.fa
13345353  ACAACTTCTTTACGTGCTGGAAGACTCCCGTGCCTGATTGAATCATTATCAGCTAGATGTTCAAGCAAATGGTCTAAACT  van-0.fa
 
13345433  GGATCCAACAAAGTAATCTCCAATTGCAGAAAGAGAAGTATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  chr4.fa
13345433  GGATCCAACAAAGTAATCTCCANTNNCNGAAAGAGAAGTATTGTTCCGGTTTTGATTCAANCTCGTTGAACCCTGAACAA  bay-0.fa
13345433  GGATCCAACAAAGTAATCTCCAATTGCNGAAAGAGAAGTATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  bor-4.fa
13345433  GGATCCAACAAAGTAATCTCCAATTGCAGAAANAGAAGTNTTGTTCCGGTTTTGATTCAAACTCGTTGAACCNNNNNNNN  br-0.fa
13345433  GGATCCAACAAAGTAATCTCNNNNNNNNNNNNNNNNNNNATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  bur-0.fa
13345433  GGATCCAACAAAGTAATCTCCAATTGCAGAAAGAGAAGTATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  c24.fa
13345433  GGANCCAACAAAGTAATCTCCAATTGCNGAAAGAGAAGTATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  col-0.fa
13345433  GGATCCAACAAAGTAATCTCCAATNGCAGANNGAGAAGNATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  cvi-0.fa
13345433  GGATCCAACAAAGTAATCTCCAATTGCNGAAAGAGAAGTATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  est-1.fa
13345433  GGATCCAACAAAGTAATCTCCAATTGCNGAAAGNNNNNNNTTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAANAA  fei-0.fa
13345433  GGATCCAACAAAGTAATCTCCAATTGCAGAAAGAGAAGTATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  got-7.fa
13345433  GGATCCAACAAAGTAATCTCCANTNNCNGAAAGAGAAGTATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  ler-1.fa
13345433  GNATCCAACAAAGTAATCTCCANTTGCAGAAAGAGAAGTATTGTTCCGGTTTTGNTTCAAACTCGTTGAACCCTGAACAA  lov-5.fa
13345433  GGATCCAACAAAGTAATCTCCAATTGCNGAAAGAGAAGTATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  nfa-8.fa
13345433  GGATCCAACAAAGTAATCTCCAATTGCNGAAAGAGAAGTATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  rrs-10.fa
13345433  GGATCCAACAAAGTAATCTCCAATTGCNGAAAGAGAAGTATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  rrs-7.fa
13345433  GGATCCAACAAAGTAATCTCCAATTGCNGAAAGAGAAGTNTTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  sha.fa
13345433  GGATCCAACAAAGTAATCTCNNNNNNNNNNNNNNNNNGTATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  tamm-2.fa
13345433  GGATCCAACAAAGTAATCTCCAATTGCAGAAAGAGAAGTATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  ts-1.fa
13345433  GGATCCAACAAAGTAATCTCCAATTGCNGAAAGAGAAGTATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  tsu-1.fa
13345433  GGATCCAACAAAGTAATCTCCANTTGCAGAAAGAGAAGTATTGTTCCGGTTTTGATTCAAACTCGTTGAACCCTGAACAA  van-0.fa
 
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACTCAGAAGCAATCCCTGCACGAATACCCTGAAGCAACTGC  chr4.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRNGCACGAATRCCRTGAAGCAACTGC  bay-0.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRCCRTGAAGCAACTGC  bor-4.fa
13345513  GNNNNNNNNNNTTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRCCRNGAAGCAACTGC  br-0.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGANNNNNNNNTNNNNNNRRRRRRRRRRRRRRNGCACGAATRCCRNGAAGCAACNGC  bur-0.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRCCRNGAAGCAACTGC  c24.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRCCRNGAAGCAACTGC  col-0.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRCCRNGNAGCAACTGC  cvi-0.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRCCRTGAAGCAACTGC  est-1.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRCCRTGAAGCAACTGC  fei-0.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRCCRTGAAGCAACTGC  got-7.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRNGCACGAATRCCRNGAAGCAACTGC  ler-1.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRNGCACGAATRCCRNGAAGCAACTGC  lov-5.fa
13345513  CAGCNGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRCCRNGAAGCAACTGC  nfa-8.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRCCRTGAAGCAACTGC  rrs-10.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRCCRTGAAGCAACTGC  rrs-7.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRNCRTGAAGCAACTGC  sha.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTTTCANNNRRRRRRRRRRRRRRTGCACGAATRCCRNGAAGCAACTGC  tamm-2.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRCCRNGAAGCAACTGC  ts-1.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRCCRTGAAGCAACTGC  tsu-1.fa
13345513  CAGCTGATTGATTTAACAGGTCTCGATCCGAGCTCTCATACRRRRRRRRRRRRRRTGCACGAATRCCRNGAAGCAACTGC  van-0.fa
 
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCTCTGTCTAAATCAATCTCTCTACCTTGTTG  chr4.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCTCNRRRRRAANCAATCTCTCTACCTTGTTG  bay-0.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCTCTRRRRRAANCAATCTCTCTACCTTGTTG  bor-4.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGANNNNNACTCNCNRRRRRNNNCAATCTCTCTACCTTGTTG  br-0.fa
13345593  AATNTAGTAGCTGAGCTTCTCCGTCTCCNNNNNNNNNTAGACTCAAACTCNCNRRRRRNNNNANNNNNNNNNCCTTGTTG  bur-0.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCTCNRRRRRANNCAATCTCTCTACCTTGTTG  c24.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCTCTRRRRRAANCAATCTCTCTACCTTGTTG  col-0.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGNATAGACTCAAACTCNNNRRRRRNNNNNNNNNNNNTNCCTTGTTG  cvi-0.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCNCTRRRRRNNNCAATCTCTCTACCTTGTTG  est-1.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGNTAGACTCAAACTCNCNRRRRRNNNNAATCTCTCTACCTTGTTG  fei-0.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCTCTRRRRRNNTCAATCTCTCTACCTTGTTG  got-7.fa
13345593  AATATAGTAGCTGAGCTTCTNCGTCTCCTCCTAAGGATAGACTCAAACTCNCNRRRRRNNNCAATCTCTCTACCTTGTTG  ler-1.fa
13345593  AATATAGTAGCTGAGCTTCTNCGTCTCCTCCTAAGGATAGACTCAAACTCNCNRRRRRNNNCAATCTCTCTACCTTGTTG  lov-5.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCTCTRRRRRNANCAATCTCTCTACCTTGTTG  nfa-8.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCTCTRRRRRAANCAATCTCTCTACCTTGTTG  rrs-10.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCTCTRRRRRNNNCAATCTCTCTACCTTGTTG  rrs-7.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCTNNRRRRRNNTCAATCTCTCTACCTTGTTG  sha.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCTCNRRRRRNNTCAATCTCTCTACCTTGTTG  tamm-2.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCNCTRRRRRNNNCAATCTCTCTACCTTGTTG  ts-1.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCTCNRRRRRANNCAATCTCTCTACCTTGTTG  tsu-1.fa
13345593  AATATAGTAGCTGAGCTTCTCCGTCTCCTCCTAAGGATAGACTCAAACTCTCNRRRRRNNTCAATCTCTCTACCTTGTTG  van-0.fa
 
13345673  CCTGTGGCGATGACGACGATGATGATGTCGATCAATATCGACGCTGTCATTTCCATCAACATCATCAGATACATTGACCT  chr4.fa
13345673  CCTGTGGCGATGACGNNNNNGATGATGTNNNNNNATATCGACGCTGTCATTTCCATCAACATCATCAGATACATTGACCT  bay-0.fa
13345673  CCTGTGGCGATGACGNCGATGATGATGTCGANCAATATCGACGCTGTCATTTCCATCAACATCATCAGATACATTGACCT  bor-4.fa
13345673  CCTGTGGCGATGACGACGATGATGATNNNNNNNAATATCGACGCTGTCATTTCCATCAACANCATCAGATACATTGACCT  br-0.fa
13345673  CCTGTGGCGATGACGNNNNNGATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCNANNNNNNNNNNNNNNNNNNNNN  bur-0.fa
13345673  CCTGTGGCGATGACGACGATGATGATGTCGNNNNNTATCGACGCTGTCATTTCCATCAACATCATCAGATACATTGACCT  c24.fa
13345673  CCTGTGGCGATGACGNCGATGATGATGTCGNNCAATATCGACGCTGTCATTTCCATCAACATCATCAGATACATTGACCT  col-0.fa
13345673  CCTGTGGCGATGACGACGANGATGATNNNNNNNNNNNNCGACGCTGTCATTTCCATCAACANNNNNNNNNNCATTGNNNN  cvi-0.fa
13345673  CCTGTGGCGATGACGACGATGATGATGNNNNNCAATATCGACGCTGTCATTTCCATCAACATCATCAGATACATTGACCT  est-1.fa
13345673  CCTGTGGCGATGACGACGATGATGATGTNNNNNNNNATCGACGCTGTCATTTCCATCAACNNNNNNAGATACATTGACCT  fei-0.fa
13345673  CCTGTGGCGATGACGNNNNNGATGATGTNNNNNNATATCGACGCTGTCATTTCCATCAACANCATCAGATACATTGACCT  got-7.fa
13345673  CCTGTGGCGATGACGACGANGATGATGTNNNNNNNTATCGACGCTGNCATTTCCATCAACATCATCAGATACATTGACCT  ler-1.fa
13345673  CCTGTGGCGATGACGACGANGATGATGTNNNNNNNNATCGACGCTGTCATTTCCATCAACANCATCAGATACATTGACCT  lov-5.fa
13345673  CCTGTGGCGATGACGACGATGATGATGTCGNNCAATATCGACGCTGTCATTTCCATCAACATCATCAGATACATTGACCT  nfa-8.fa
13345673  CCTGTGGCGATGACGNCGATGATGATGTCGANCAATATCGACGCTGTCATTTCCATCAACATCATCAGATACATTGACCT  rrs-10.fa
13345673  CCTGTGGCGATGACGACGATGATGATGNNNNNNAATATCGACGCTGTCATTTCCATCAACATCATCAGATACATTGACCT  rrs-7.fa
13345673  CCTGTGGCGATGACGACGATGATGATNNNNNNNAATATCGACGCTGTCATTTCCATCAANNNNNNCAGATACATTGACCT  sha.fa
13345673  CCTGTGGCGATGACGACGANGANGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCNNNNNNNNNNNNNNNNNNNNNCT  tamm-2.fa
13345673  CCTGTGGCGATGACGACGATGATGATGTCGANCAATATCGACGCTGTCATTTCCATCAACATCATCAGATACATTGACCT  ts-1.fa
13345673  CCTGTGGCGATGACGNCGATGATGATGTCGATCAATATCGACGCTGTCATTTCCATCAACATCATCAGATACATTGACCT  tsu-1.fa
13345673  CCTGTGGCGATGACGNCGATGATGATGTNNNNNNNTATCGACGCTGTCATTTCCATCAACATCATCAGATACATTGACCT  van-0.fa
 
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGATTACTCATCATTCCAAGCAAGATTGGA  chr4.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGATTGGR  bay-0.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGATTGGR  bor-4.fa
13345753  CATCATTATCCACACCAAACTCTGNCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGNTTGGR  br-0.fa
13345753  NNTCATNNNNNNNNNNNNNNNNTGTCCTCCNAAACCTTCTACGTCTACNAGGARTNCTCRRRRRRRRRRGCAAGNTNNGR  bur-0.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGNTTGGR  c24.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGATTGGR  col-0.fa
13345753  NATCATTATCCNCACCAAACNNTNNNNNNNNNAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGATNGGR  cvi-0.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGNTTGGR  est-1.fa
13345753  CATCATTATCCACACCAAACTCTNTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGATTGGR  fei-0.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGATTGGR  got-7.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGNTTGGR  ler-1.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGNTTGGR  lov-5.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGATTGGR  nfa-8.fa
13345753  CATNATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGNTTGGR  rrs-10.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGNTTGGR  rrs-7.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGATTGGR  sha.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGNTTNGR  tamm-2.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGATTGGR  ts-1.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGATTGGR  tsu-1.fa
13345753  CATCATTATCCACACCAAACTCTGTCCTCCTAAACCTTCTACGTCTACGAGGARTACTCRRRRRRRRRRGCAAGATTGGR  van-0.fa
 
13345833  CCCCATAGAGACAATGCACGGTCTGTACCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  chr4.fa
13345833  RNNCATAGAGARRRRRRRRRRRRTGNNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  bay-0.fa
13345833  RNCCATAGAGARRRRRRRRRRRRTGNNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  bor-4.fa
13345833  RCNCATAGAGARRRRRRRRRRRRTGNNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  br-0.fa
13345833  RNNNATAGAGARRRRRRRRRRRRTGNNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTNNNNNTGCTACTGCTGCCGCC  bur-0.fa
13345833  RCCCATAGAGARRRRRRRRRRRRTGNNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  c24.fa
13345833  RCNNATAGAGARRRRRRRRRRRRTGNNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  col-0.fa
13345833  RCCNATAGNGARRRRRRRRRRRRTGNACCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  cvi-0.fa
13345833  RCNCATAGAGARRRRRRRRRRRRTGTNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  est-1.fa
13345833  RNCCATAGAGARRRRRRRRRRRRTNNNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCNACTGCTGCCGCC  fei-0.fa
13345833  RCCCATAGAGARRRRRRRRRRRRTGNACCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  got-7.fa
13345833  RNNCATAGAGARRRRRRRRRRRRNGNNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  ler-1.fa
13345833  RNNCATAGAGARRRRRRRRRRRRTGNNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  lov-5.fa
13345833  RCNCATAGAGARRRRRRRRRRRRTGNNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  nfa-8.fa
13345833  RCNCATAGAGARRRRRRRRRRRRTGTNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  rrs-10.fa
13345833  RCCCATAGAGARRRRRRRRRRRRTGTNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  rrs-7.fa
13345833  RNNCATAGAGARRRRRRRRRRRRTGNNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACNGCTGCCGCC  sha.fa
13345833  RNNCATAGAGARRRRRRRRRRRRTGNNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  tamm-2.fa
13345833  RNNCATAGAGARRRRRRRRRRRRTGTNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  ts-1.fa
13345833  RCCCATAGAGARRRRRRRRRRRRTGTNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  tsu-1.fa
13345833  RNCNATAGAGARRRRRRRRRRRRTGTNCCAAAATCAATCTCAGGGTCTTGAACCTCCCTTAGACTGCTACTGCTGCCGCC  van-0.fa
 
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGCAAAAGGGGCATTTGATCTCGGCACCAATAACTGGATTCA  chr4.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGCAARRRRRRCATTTGATCTCGGCACCAATAACTGGATTCR  bay-0.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGCAARRRRRRCATTTGATCTCGGCACCAATAACTGGATTCR  bor-4.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGNAARRRRRRNATTTGATCTCGGCACCAATAACTGGATTCR  br-0.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGNNNNNNNNNRRRRRRNNNTTGATCTCGGCACCAANAACTGGATTCR  bur-0.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGCAARRRRRRCATTTGATCTCGGCACCAATAACTGGATTCR  c24.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGNAARRRRRRCATTTGATCTCGGCACCAATAACTGGATTCR  col-0.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGCAARRRRRRCNTTTGATCTCGGCACCAATAACTGGATTCR  cvi-0.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGCAARRRRRRCANTTGATCTCGGCACCAATAACTGGATTCR  est-1.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGNNNRRRRRRCATTTGATCTCGGCACCAATAACTGGATTCR  fei-0.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGCAARRRRRRCATTTGATCTCGGCACCAATAACTGGATTCR  got-7.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGNANRRRRRRNATTTGATCTCGGCACCAATAACTGGATTCR  ler-1.fa
13345913  ATTAATNTCACGGCTCATTTCCTCGACAAACCCGCTTTGGNNARRRRRRCATTTGATCTCGGCACCAATAACTGGATTCR  lov-5.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCNGCTTTGGCAARRRRRRCATTTGATCTCGGCACCAATAACTGGATTCR  nfa-8.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGCAARRRRRRCATTTGATCTCGGCACCAATAACTGGATTCR  rrs-10.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGNAARRRRRRCATTTGATCTCGGCACCAATAACTGGATTCR  rrs-7.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCNTTGGNNNRRRRRRCNTTTGATCTCGGCACCAATAACTGGATTCR  sha.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGCNNRRRRRRCATTTGATCTCGGCACCAATAACTGGATTCR  tamm-2.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGCAARRRRRRCATTTGATCTCGGCACCAATAACTGGATTCR  ts-1.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGCAARRRRRRCATTTGATCTCGGCACCAATAACTGGATTCR  tsu-1.fa
13345913  ATTAATCTCACGGCTCATTTCCTCGACAAACCCGCTTTGGCAARRRRRRCATTTGATCTCGGCACCAATAACTGGATTCR  van-0.fa
 
13345993  CCATTTGTGAACACATGTGACACCAATACCT   chr4.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   bay-0.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   bor-4.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   br-0.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN   bur-0.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   c24.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   col-0.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   cvi-0.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   est-1.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   fei-0.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   got-7.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN   ler-1.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN   lov-5.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN   nfa-8.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   rrs-10.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   rrs-7.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN   sha.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   tamm-2.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   ts-1.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   tsu-1.fa
13345993  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRT   van-0.fa
 
visited.