Arabidopsis SNP Sequence Viewer

Chromosome : chr4 Coordinates : 13048519 - 13050873


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
13048519  GAGAGAGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGCT  chr4.fa
13048519  GNGAGAGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGNT  bay-0.fa
13048519  NNNNNNGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGCT  bor-4.fa
13048519  NNNNNAGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGCT  br-0.fa
13048519  NNNNNAGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGCT  bur-0.fa
13048519  NNNNNAGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGCT  c24.fa
13048519  NNNAGAGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGCT  col-0.fa
13048519  GNNNNNGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGCT  cvi-0.fa
13048519  NNNNNAGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGCT  est-1.fa
13048519  NNNNNAGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGNT  fei-0.fa
13048519  GAGAGAGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGNT  got-7.fa
13048519  NNNNNNNNNATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGCT  ler-1.fa
13048519  NNNNNNNNNNNGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGNT  lov-5.fa
13048519  NNNNNNNNNNTGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGCT  nfa-8.fa
13048519  GAGAGAGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGNT  rrs-10.fa
13048519  NNNNNNNNGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGNT  rrs-7.fa
13048519  NNNNNNNNGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCNNNNN  sha.fa
13048519  NNNNNAGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGNT  tamm-2.fa
13048519  NNNNNNNAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGNT  ts-1.fa
13048519  NNNNNAGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGCT  tsu-1.fa
13048519  GAGAGNGAGATGGCTATGTCTCAGGTGGTGAACACGTACCCGCTTTCGAACTACAGCTTCGGAACTAAGGAACCCAAGNT  van-0.fa
 
13048599  GGAAAAGGACACCTCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTCTTTCCTTCTTTCTCTTTTTT  chr4.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTCTNNNNNNNNNNNNNNNNNNN  bay-0.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTCTNNNNNNNNNNNNNNNNNNN  bor-4.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTNNNNNNNNNNNNNNNNNNNNN  br-0.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTCNNNNNNNNNNNNNNNNNNNN  bur-0.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTCNNNNNNNNNNNNNNNNNNNN  c24.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTCTNNNNNNNNNNNNNNNNNNN  col-0.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTCTNNNNNNNNNNNNNNNNNNN  est-1.fa
13048599  GGAAAAGGACACCTCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTCTTNNNNNNNNNNNNNNNNNN  got-7.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTCTNNNNNNNNNNNNNNNNNNN  ler-1.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTCTNNNNNNNNNNNNNNNNNNN  lov-5.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTCTNNNNNNNNNNNNNNNNNNN  rrs-10.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTCNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTNNNNNNNNNNNNNNNNNNNNN  sha.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTCTNNNNNNNNNNNNNNNNNNN  tsu-1.fa
13048599  GGAAAAGGACACCNCCGTCGCCGACCGGCTCGCTCGTATGAAAATCAAGTACGATTCCTCNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
13048679  GTTTTCTTCTTATAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTAG  chr4.fa
13048679  RNNNNNTTCTTATAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTAG  bay-0.fa
13048679  RNNNNNNNNNNNTAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTNNNNN  bor-4.fa
13048679  RNNNNNNNNTTATAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTNNN  br-0.fa
13048679  RNNNNNNTCTTATAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCNNNN  bur-0.fa
13048679  RNNNNNTTCTTATAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTAG  c24.fa
13048679  RNNNNNNNNTTATAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTAG  col-0.fa
13048679  RNNNNNNNNTNATAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTNG  cvi-0.fa
13048679  RNNNNNNNNNNNNAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTAG  est-1.fa
13048679  RNNNNNNNNTTATAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTNNN  fei-0.fa
13048679  RNNNNNTTNTTNTAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTAG  got-7.fa
13048679  RNNNNNNNNTTATAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTNN  ler-1.fa
13048679  RNNNNNNNNTTATAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTAG  lov-5.fa
13048679  RNNNNNNNNNNNNNNCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTNNN  nfa-8.fa
13048679  RNNNTNTTCTTATAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTAG  rrs-10.fa
13048679  RNNNTNNNNNNNTAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTNN  rrs-7.fa
13048679  RNNNNNNNNTTATAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTAG  sha.fa
13048679  RNNNNNTTCTTATAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTAG  tamm-2.fa
13048679  RNNNNNTTNTTNTAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTAN  ts-1.fa
13048679  RNNNNNNNNNNNTAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTAG  tsu-1.fa
13048679  RNNNNNNNNTTATAGCTACTGCTGGAGAAGATGCCTGAGAATTGAAAACCCTAGAAATCTCCAGGCTTTTACATTCTTAG  van-0.fa
 
13048759  ATCATGATCTCGATGTTTTCTAAATGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTAAAGGAATAA  chr4.fa
13048759  ATCATGNTCTCGATGTTTTCTAAATGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTAAAGGAATAA  bay-0.fa
13048759  NNNNNNNNCTCGANGTNTNNNNNNNGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGNNNNNNNNCNNNNNNNNNN  bor-4.fa
13048759  NNNNNNNTCNNNNNNNNNNNNNNNNNNNCNNCTGCTTTCTCGCTGCTGCTGAATTTACTAGCNNNNNNNCNNNNNNNNNN  br-0.fa
13048759  NNNNNNNTCTCGATGTTTTCTAAATGCTTNTCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTAANGNAATAA  bur-0.fa
13048759  ATCATGNTCTCGATGTTTTCTAAATGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTAAANGAATAA  c24.fa
13048759  NTCNTGNTCTCGATGTTTTCTAAATGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTAAAGGAATAA  col-0.fa
13048759  NNCNNNNTCNNNNNNNNNNNNNNNNNNNNATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTAANNNNNTAA  cvi-0.fa
13048759  ANNNNNNNNTCGATGTTTTCTAAATGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTNNNNNNNNNNNNNA  est-1.fa
13048759  NNNNNNNTCTCGATGTTTTCTAAATGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTNCTTANNNNNNNAA  fei-0.fa
13048759  ATNNNNNNNTCGATGTTTTCTAAATGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTAANNNNNNAA  got-7.fa
13048759  NNNNNNNTCTCGATGTTTTCTAAATGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTAAAGGAATAA  ler-1.fa
13048759  NNNNNNNTCTCGATGTTTTCTAAATGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTAAAGGAATAA  lov-5.fa
13048759  NNNNNNNNNTCGATGTTTTCTAAATGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTAANNNNNNAA  nfa-8.fa
13048759  NTNNNNNNNTCGATGTTTTCTAAATGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTAANNNNNTAA  rrs-10.fa
13048759  NNNNNNNNNTCGATGTTTTCTAAATGCTTNTCTGCTTTCTCGCTGCTGCTGAANNNNNNNNNNNCTCCTTANNNNNNNNA  rrs-7.fa
13048759  NNNNNNNTCTCGATGTTTTCTAAATGCTTNTCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTAAAGNAATAA  sha.fa
13048759  NTCNTGNTCTCGATGTTTTCTAAATGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTAAANGAATAA  tamm-2.fa
13048759  NNNNNNNNNTCGATGTTTTCTAAATGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCNNNNNNNNNNNNNNA  ts-1.fa
13048759  NNNNNNNNCTCGATGTTTTCTAAATGCTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTANNNNNNNAA  tsu-1.fa
13048759  ATCATGNTCTCGATGTTTTCTAAATGNTTATCTGCTTTCTCGCTGCTGCTGAATTTACTAGCTTCTCCTTAAAGGNATAA  van-0.fa
 
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATTGTTAGAACAACTTCTTCCA  chr4.fa
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATTGTTAGAACAACTTCTTCCA  bay-0.fa
13048839  NCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATTNNNNNNNCAACTTCTTCCA  bor-4.fa
13048839  TCTTTTGGCCATTTTACACAACTTNAAGGTTTCAAAACTACAACTTGGTGGTACATATATTGTTAGAACAACTTCTTCCA  br-0.fa
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACNTATATTNTTAGAACAACTTCTTCCA  bur-0.fa
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATTNNNNNNACAACTTCTTCCA  c24.fa
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATTGTTAGAACAACTTCTTCCA  col-0.fa
13048839  TCTTTTGGCCATTTTACACAANTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATNNNNNNNACAACTTCTTCCA  cvi-0.fa
13048839  TCTTTTGGCCATTTTACACAACTTNAAGGTTTCAAAACTACAACTTGGTGGTACATATATTNNNNNNACAACTTCTTCCA  est-1.fa
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATTNTTAGAACAACTTCTTCCA  fei-0.fa
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATTGTTNGAACAACTTCTTCCA  got-7.fa
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATTGTTAGAACAACTTCTTCCA  ler-1.fa
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATTGTTAGAACAACTTCTTCCA  lov-5.fa
13048839  TCTTTTGGCCATTTTACACAACTTNAAGGTTTCAAAACTACAACTTGGTGGTACATATATTGNNAGAACAACTTCTTCCA  nfa-8.fa
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATTGTTAGAACAACTTCTTCCA  rrs-10.fa
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATNNNNNNNACAACTTCTTCCA  rrs-7.fa
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATTNTTAGAACAACTTCTTCCA  sha.fa
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATTGTTAGAACAACTTCTTCCA  tamm-2.fa
13048839  TCTTTTGGCCATTTTACACAACTTNAAGGTTTCAAAACTACAACTTGGTGGTACATATNNNNNNNNNNCAACTTCTTCCA  ts-1.fa
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATNNNNNGAACAACTTCTTCCA  tsu-1.fa
13048839  TCTTTTGGCCATTTTACACAACTTTAAGGTTTCAAAACTACAACTTGGTGGTACATATATTGTTAGAACAACTTCTTCCA  van-0.fa
 
13048919  ACGATCTGTGTTTTTTTTTTGTGAACAAAGAACAGCTATAGGCTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  chr4.fa
13048919  ACGATCTGTNNTRRTTTTRTRTGAACAAAGAACAGCTATAGGCTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  bay-0.fa
13048919  ACGATCTGNNNNRRNTTTRTRNNNACAAAGAACAGCTATANGCTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  bor-4.fa
13048919  ACGATCTGNNNNRRNNTTRNRTNNACAAAGAACAGCTATAGNCTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  br-0.fa
13048919  ACGATCTGTNNNRRNNTTRNRNGNACAAAGAACAGNNNNNNNNNNTTTAAATTTCCAGTGAATGNTTTGATTAGGGAACA  bur-0.fa
13048919  ACGATCTGTNNNRRTTTTRNRTNNACAAAGAACAGCTATANGCTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  c24.fa
13048919  ACGATCTGNNNNRRNTTTRTRNNNACAAAGAACAGCTATAGGCTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  col-0.fa
13048919  ACGATCNNNNNNRRNNNNRNRNNNACAAAGAACAGCTATNNNNTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  cvi-0.fa
13048919  ACGATCTGNNNNRRNTNTRNRNNNACAAAGAACAGCNNNNNNNTNTTTAAATTTNCAGTGAATGATTTGATTAGGGAACA  est-1.fa
13048919  ACGATCNNNNNNRRTTTNRTRNNNACAAAGAACAGCTATAGGCTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  fei-0.fa
13048919  ACGATCTGTNNNRRNNTTRNRNNNACAAAGAACAGCTANNNNNNATTTAAATTNCCAGTGAATGATTTGATTAGGGAACA  got-7.fa
13048919  ACGATCNNNNNNRRTNTTRNRNNNACAAAGAACAGCTATNGGCTATTTAAATTTCCAGTGAATGNTTTGATTAGGGAACA  ler-1.fa
13048919  ACGATCTGTNNNRRNNTTRNRNNNACAAAGAACAGCTATAGGCTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  lov-5.fa
13048919  ACGNTCNNNNNNRRNNNNRNRNNNACAAAGAACAGCTATNGGCTATTTAAATTTCCAGTGAATGATTTGATTNGGGAACA  nfa-8.fa
13048919  ACGATCTGTNNNRRTNTTRTRNNNACAAAGAACAGCTATAGGCTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  rrs-10.fa
13048919  ACGATCTGTNNNRRNNTTRTRNNNACAAAGAACAGCTATAGNCTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  rrs-7.fa
13048919  ACGATCTNNNNNRRNTTNRNRTNNACAAAGAACAGCTATAGGCTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  sha.fa
13048919  ACGATCNNNNNNRRNNNTRNRNNNACAAAGAACAGCTATAGGCTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  tamm-2.fa
13048919  ACGATCTGTNNNRRNNNNRNRNNNACAAAGAACAGCTNNNNNNNNTTTAAATTTCCAGTGNATGATTTGATTAGGGAACA  ts-1.fa
13048919  ACGATCTGTNNTRRTTNTRTRNNNNCNAAGAACAGCTATAGGCTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  tsu-1.fa
13048919  ACGATCTGTNNTRRTTTTRTRTNNACAAAGAACAGCTATAGGCTATTTAAATTTCCAGTGAATGATTTGATTAGGGAACA  van-0.fa
 
13048999  GATATAGCTACTGTATATGTTATACAATACTTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATACATGAAGTC  chr4.fa
13048999  GATATANNNNNNNNNNNNNNNNNNNNNNNCTTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  bay-0.fa
13048999  GATATAGCNNNNNNNNNNNNNNNNNNNNNNNTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  bor-4.fa
13048999  GATATAGCTACNNNNNNNNNNNNNNNNNNNTTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  br-0.fa
13048999  GATANNNNNNNNNNNNNNNNNNNNNNNNNCTTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  bur-0.fa
13048999  GATATAGCTANNNNNNNNNNNNNNNNNNNNTTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  c24.fa
13048999  GATATAGCTACTGTNNNNNNNNNNNNNNNCTTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  col-0.fa
13048999  GATATANNNNNNNNNNNNNNNNNNNNNNNNTTTAGNTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  cvi-0.fa
13048999  GATATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  est-1.fa
13048999  GATATAGCTANNNNNNNNNNNNNNNNNNNCTTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  fei-0.fa
13048999  GATATAGCNNNNNNNNNNNNNNNNNNNNNCTTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  got-7.fa
13048999  GATATAGCTANNNNNNNNNNNNNNNNNNNNNTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  ler-1.fa
13048999  GATATAGNNNNNNNNNNNNNNNNNNNNNNCTTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  lov-5.fa
13048999  GATATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  nfa-8.fa
13048999  GATATANNNNNNNNNNNNNNNNNNNNNNNNNTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  rrs-10.fa
13048999  GATATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  rrs-7.fa
13048999  GATATAGCTNNNNNANNNNNNNNNNNNNNCTTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  sha.fa
13048999  GATATAGCTACTGTATANNNNNNNNNNNNCTTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  tamm-2.fa
13048999  GATATANNNNNNNNNNNNNNNNNNNNNNNNNNTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  ts-1.fa
13048999  GATATAGCNANNNNNNNNNNNNNNNNNNNNNTTNGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  tsu-1.fa
13048999  GATATAGCNANNNNNNNNNNNNNNNNNNNCTTTAGTTTTGCAAGTAAAGTCTCATGCTTTTTACATGGATNCATGAAGTC  van-0.fa
 
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGATTATCTCTTTCTTGTTTTCTTAATGGGGTGTTGCAGCTA  chr4.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGATRNTNTCTTTCTNNNNNTCTTAATGGGGTGTTGCAGCTA  bay-0.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGNNRNNNNNNNNNNNNNNTTNTTAATGGGGTGTTGCAGCTA  bor-4.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGNNRNNNNNNNNNNNNNNNTCTTAATGNGGTGTTGCAGCTA  br-0.fa
13049079  TGGAATTTGATAGCTCNTACTTAAGACATTCTGGAGTCTGNTRNNNNNNNNNNNNNNNNNTTAATGGGGTGTTGCAGCTA  bur-0.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGNNRNNNNNNNNNNNNNNTTCTTAATGGGGTGTTGCAGCTA  c24.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGNTRNNNNNNNNNNNNNTTTCTTNATGGGGTGTTGCAGCTA  col-0.fa
13049079  TGGAATTTGATAGCTCNTACTTAAGACATTCTGGAGTCTNNNRNNNNNNNNNNNNNNNTNTTAATGGGGTGTTGCAGCTA  cvi-0.fa
13049079  TGGAATTTGATAGCTCNTACTTAAGACATTCTGGAGTCTGNNRNNNNNNNNNNNNNNNNNTTAATGGGGTGTTGCAGCTA  est-1.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGNNRNNNNNNNNNNNNNNNNNTTAATGGGGTGTTGCAGCTA  fei-0.fa
13049079  TGGAATTTGATAGCTCNTACTTAAGACATTCTGGAGTCTGNNRNNNNNNNNNNNNTTTTNTTAATGGGGTGTTGCAGCTA  got-7.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGNNRNNNNNNNNNNNNNNNNNTTAATGGGGTGTTGCAGCTA  ler-1.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGNTRNNNNNNNNNNNNNNNTCTTAATGGGGTGTTGCAGCTA  lov-5.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGNNRNNNNNNNNNNNNNNNTCTTAATGGGGTGTTGCAGCTA  nfa-8.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGNTRNNNNNNNNNNNNTTTTCTTAATGGGGTGTTGCAGCTA  rrs-10.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGNNRNNNNNNNNNNNNTTTTCTTAATGGGGTGTTGCAGCTA  rrs-7.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTNNNRNNNNNNNNNNNNNNNNCTTAATNGGGTGTTGCAGCTA  sha.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGNTRNNNNNNNNNNNNNNTTCTTAATGNGGTGTTGCAGCTA  tamm-2.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGNNRNNNNNNNNNNNNTTTTCTTAATGGGGTGTTGCAGCTA  ts-1.fa
13049079  TGGAATTTGATAGCTCTNACTTAAGACATTCTGGAGTCTGNNRNNNNNNNNNNNNNNNNNTTAATGGGGTGTTGCAGCTA  tsu-1.fa
13049079  TGGAATTTGATAGCTCTTACTTAAGACATTCTGGAGTCTGNTRNNNTCNNNNNNNNNTTCTTAATGGGGTGTTGCAGCTA  van-0.fa
 
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  chr4.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  bay-0.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  bor-4.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  br-0.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGNTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  bur-0.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  c24.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  col-0.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  cvi-0.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  est-1.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  fei-0.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  got-7.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  ler-1.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  lov-5.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  nfa-8.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  rrs-10.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  rrs-7.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  sha.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  tamm-2.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  ts-1.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  tsu-1.fa
13049159  TATGAAAGAGGGCATGAGGACTAGCGTTGAAGGGATTCTACTGGTATGATAATTTTCGATCTGCTCTACTTGTTATCCAA  van-0.fa
 
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  chr4.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  bay-0.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  bor-4.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  br-0.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  bur-0.fa
13049239  CTCTTCTGTAGTTTTCTCTGTNTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  c24.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  col-0.fa
13049239  CTCTTCTGTAGTTTTCTCTGTNNNNNNNNNNNTNNNNNNNTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  cvi-0.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTNTNNNNNGNTCGGTGGTACAGTTATGTGGTTCAAGACTTGA  est-1.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  fei-0.fa
13049239  CTCTTCTGTNGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  got-7.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  ler-1.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  lov-5.fa
13049239  CTCTTCTGTNGTTTTCTCNGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  nfa-8.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  rrs-10.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  rrs-7.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  sha.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  tamm-2.fa
13049239  CTCTTCTNNNNNNTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  ts-1.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  tsu-1.fa
13049239  CTCTTCTGTAGTTTTCTCTGTGTTGTTTAACTGCCCACTGTCTTAAAATCGGTGGTACAGTTATGTGGTTCAAGACTTGA  van-0.fa
 
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  chr4.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  bay-0.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  bor-4.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTNTTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  br-0.fa
13049319  GTGGCCATACTGTCATATACANAATGCCACTGAAGNGTCACTTTATNNNNNNNNNNNTNNNNNGTTCTCTGTAAATATGT  bur-0.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  c24.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  col-0.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  cvi-0.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTNNTTGTACTTAATCGTAGCGTTCTNNANNNNNNNNN  est-1.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  fei-0.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  got-7.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  ler-1.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTNNNNNNNNNTGTAGCGTTCTCTGTAAATATGT  lov-5.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  nfa-8.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  rrs-10.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  rrs-7.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  sha.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTNNNNNTNATTNNNGCGTTCTCTGTAAATATGT  tamm-2.fa
13049319  GTGGCCATACTGTCATNNNNNNNNNNNANNNNNNNNNTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  ts-1.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATNTGT  tsu-1.fa
13049319  GTGGCCATACTGTCATATACATAATGCCACTGAAGTGTCACTTTATTTGTACTTAATCGTAGCGTTCTCTGTAAATATGT  van-0.fa
 
13049399  GTTCTCTACCCAATGTATCATTTAAAACTTGGCAGAGATATAGATCTGTGTGATATTTTGATTGAAGTCATCTACTTCCT  chr4.fa
13049399  GTTCTCTACCCAANGTATCATTTAAAACTTGGCAGAGATATAGATCTGTGTGATATTTTGATTGAAGTCATCTACTTCCT  bay-0.fa
13049399  GTTCTCTACCCAANGTATCATTTAAAACTTGGCAGAGATATAGATNTGTGTGATATTTTGATTGAAGTCATCTACTTCCT  bor-4.fa
13049399  GTTCTCTACCCAATGTNTCATTTAAAACTTGGCAGAGATATAGANCTGTGTGATATTTTGATTGAAGTCATCTACTTCCT  br-0.fa
13049399  GTTCTCTACCCAANNNNNNNTTTAAAACTTGGCAGAGATATAGANCTGTGTGATATTTTGATTGAAGTCATCTACTTCCT  bur-0.fa
13049399  GTTCTCTACCCAATGTATCATTTAAAACTTGGCAGAGATATAGATNTGTGTGATATTTTGATTGAAGTCATCTNCTTCCT  c24.fa
13049399  GTTCTCTACCCAATGTATCATTTAAAACTTGGCAGAGATATAGATCTGTGTGATATTTTGATTGAAGTCATCTACTTCCT  col-0.fa
13049399  GTTCTCTACCCAATNTATCATTTAAAACTTGGCAGAGATATANNNNNNTGTGATATTTTGATTGAAGTCATCTACTTCCT  cvi-0.fa
13049399  NNTCTCTACCCAANNNNNCNTTNAAAACTTGGCAGAGATATAGNNNNNNGTGATATTTTGATTGAAGTCATCTNCTTCCT  est-1.fa
13049399  GTTCTCTACCCNNNNNNTCATTTAAAACTTGGCAGAGATATAGATCTGTGTGATATTTTGATTGAAGTCNNNNNCTTCCT  fei-0.fa
13049399  GTTCTCTACCCAATNTATCATTTAAAACTTGGCAGAGATATAGATNTGTGTGATATTTTGATTGAAGTCATCTNCTTCCT  got-7.fa
13049399  GTTCTCTACCCAATGTNTCATTTAAAACTTGGCAGAGATATAGATNTGTGTGATATTTTGATTGAAGTCATCTACTTCCT  ler-1.fa
13049399  GTTCTCTACCCAATGTATCATTTAAAACTTGGCAGAGATATAGATCTGTGTGATATTTTGATTGAAGTCATCTACTTCCT  lov-5.fa
13049399  GTTCTCTACCCAANNNNNNATTTAAAACTTGGCAGAGATATAGATCTGTGTGATATTTTGATTGAAGTCNNNNNCTTCCT  nfa-8.fa
13049399  GTTCTCTACCCAATGTATCATTTAAAACTTGGCAGAGATATAGATCTGTGTGATATTTTGATTGAAGTCATCTACTTCCT  rrs-10.fa
13049399  GTTCTCTACCCAATGNATCATTTAAAACTTGGCAGAGATATAGATNTGTGTGATATTTTGATTGAAGTCATCTACTTCCT  rrs-7.fa
13049399  GTTCTCTACCCAANNNNTCATTTAAAACTTGGCAGAGATATAGATCTGTGTGATATTTTGATTGAAGTCATCTACTTCCT  sha.fa
13049399  GTTCTCTACCCAATGTATCATTNAAAACTTGGCAGAGATANAGATCTGTGTGATATTTTGATTGAAGTCATCTACTTCCT  tamm-2.fa
13049399  GTTCTCTACCCAATGTANCATTTAAAACTTGGCAGAGATATAGATNTGTGTGATATTTTGATTGAAGTCATCTNCTTCCT  ts-1.fa
13049399  GTTCTCTACCCAANGTNTCATTTAAAACTTGGCAGAGATATAGATNTGTGTGATATTTTGATTGAAGTCATCTACTTCCT  tsu-1.fa
13049399  GTTCTCTACCCAATGTATCATTTAAAACTTGGCAGAGATATAGATCTGTGTGATATTTTGATTGAAGTCATCTNCTTCCT  van-0.fa
 
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  chr4.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  bay-0.fa
13049479  TTTCTAGNTGNNNNNNNCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  bor-4.fa
13049479  TTTCTAGNTNNNNNNNNNANCACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  br-0.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  bur-0.fa
13049479  TTTCTAGTTGCCATCNCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  c24.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  col-0.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  cvi-0.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  est-1.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  fei-0.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  got-7.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  ler-1.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  lov-5.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  nfa-8.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  rrs-10.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  rrs-7.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  sha.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  tamm-2.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  ts-1.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  tsu-1.fa
13049479  TTTCTAGTTGCCATCTCCAACACAATTTTGTACTGATTGGGTAACCTTATATTACGAAGAAGCTCGAATCACATAAGTGG  van-0.fa
 
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGTCATAAAAGT  chr4.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGTCATAAAAGT  bay-0.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGTCATAAAAGT  bor-4.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGNNNNNNAAAAGT  br-0.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGTCATAAAAGT  bur-0.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGTCATAAAAGT  c24.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGTCATAAAAGT  col-0.fa
13049559  ATTAATCTGNNNNNNNTATATAGNCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAANNNNNATAAAAGT  cvi-0.fa
13049559  ATTAATCTGACNTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGNCATAAAAGT  est-1.fa
13049559  ATTAATCTGANCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGTCATAAAAGT  fei-0.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGNNNNAAAAGT  got-7.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGANTCATAAAAGT  ler-1.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGTCATAAAAGT  lov-5.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGTCATAAAAGT  nfa-8.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGTCATAAAAGT  rrs-10.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGTCATAAAAGT  rrs-7.fa
13049559  ATTAATCTGACCTTAATATATNGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGTCATAAAAGT  sha.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGTCATAAAAGT  tamm-2.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAANNNNCATAAAAGT  ts-1.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGNCATAAAAGT  tsu-1.fa
13049559  ATTAATCTGACCTTAATATATAGTCACAAGCTTTATGGATCCAATGAACTTAACCTGCACTTAATAAGAGTCATAAAAGT  van-0.fa
 
13049639  GAAGGGTGCCATTTATTGATGCATCTTATTGTTCCGTTTCTTTCATTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  chr4.fa
13049639  GAAGGGTGCCATTTATTGATGCATCTTATTGTTCCGTTTCTTTCATTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  bay-0.fa
13049639  GAAGGGTGCCATTTATTGATGCATCTTATTGTTCCGTTTCTTTCATTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  bor-4.fa
13049639  GAAGGGTGCCATTTATTGANNNNNNTTATTGTTNCGTTTCTTTCNTTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  br-0.fa
13049639  GAAGGGTGCCATTTATTGNTGCNTCTTATTGTTCCGTTTCTTTCATTGTTTGTATGCACCATTGCCCTTCNAAGCTTTAA  bur-0.fa
13049639  GAAGGGTGCCATTTATTGATGCATCTTATTGTTCCGTTTCTTTCNTTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  c24.fa
13049639  GAAGGGTGCCATTTATTGATGCATCTTATTGTTCCGTTTCTTTCNTTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  col-0.fa
13049639  GAAGGGTGCCATTTATTNNNNNNNCTTATTGNNNNNNNTNNNNNNNNGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  cvi-0.fa
13049639  GAAGGGTGCCATTTATTGNNNNNNCTTATTGTTCCGTTTCTTTCATTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAN  est-1.fa
13049639  GAAGGGTGCCATTTATTGATGCNTCTTATTGTTCCGTTTCTTTCNTTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  fei-0.fa
13049639  GAAGGGTGCCATTTATTGATNCATCTTATTGTTCCGTTTCTNNNNNNGTTTGTATGCACCATTGCCCTTCCAAGCTTTNA  got-7.fa
13049639  GAAGGGTGCCATTTATTGATNCATCTTATTGTTCCGTTTCTTTCATTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  ler-1.fa
13049639  GAAGGGTGCCATTTATTGATGCATCTTATTGTTCCGTTTCTTTCATTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  lov-5.fa
13049639  GAAGGGTGCCATTTATTGATGCATCTTATTGTTCCGTTTCTTTCATTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  nfa-8.fa
13049639  GAAGGGTGCCATTTATTGATGCATCTTATTGTTCCGTTTCTTTCNTTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  rrs-10.fa
13049639  GAAGGGTGCCATTTATTGATGCATCTTATTGTTCCGTTTCTTTCNTTGTTTGTATGCACCATTGCCCTTCCAAGCTTTNA  rrs-7.fa
13049639  GAAGGGTGCCATTTATTGATNCATCTTATTGTTCCGTTTCTTTCNTTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  sha.fa
13049639  GAAGGGTGCCATTTATTGATGCATCTTATTGTTCCGTTTCTTTCATTGTTTGTATGCNCCATTGCCCTTCCAAGCTTTAA  tamm-2.fa
13049639  GAAGGGTGCCATTTATTGATGCATCTTATTGTTCCGTTTNTNNCNTTGTTTGTATGCACCATTGCCCTTCCAAGCTTNNN  ts-1.fa
13049639  GAAGGGTGCCATTTATTGATGCATCTTATTGTTCCGTTTCTTTCATTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  tsu-1.fa
13049639  GAAGGGTGCCATTTATTGATGCATCTTATTGTTCCGTTTCTTTCATTGTTTGTATGCACCATTGCCCTTCCAAGCTTTAA  van-0.fa
 
13049719  TATTTTCCCATGGAGTATCATATGCTTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGATTTGATT  chr4.fa
13049719  TATTTTCCCATGGAGTATCATATGCTTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTNGATTTRNNT  bay-0.fa
13049719  TATTTTCCCATGGAGTATCANATGCNTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGNNNNRNNN  bor-4.fa
13049719  TATTTTCCCATGGAGTATCANATGCTTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGATTNRNNN  br-0.fa
13049719  TATTTTCCCATGGAGTATCATANGNTTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTNGATNNRNNN  bur-0.fa
13049719  TATTTTCCCATGGAGTATCANATGCTTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGATTNRNNN  c24.fa
13049719  TATTTTCCCATGGAGTATCATATGCTTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGATTNRNNT  col-0.fa
13049719  TATTTTCCCATGGAGTATCATATGCNTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGNTNNRNNN  cvi-0.fa
13049719  TATTTTCCCATGGAGTATCNNNNNCTTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGNTNNRNNN  est-1.fa
13049719  TATTTTCCCATGGAGTATCATATGCTTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGNTNNRNNN  fei-0.fa
13049719  TATTTTCCCATGGAGTATCATANNNNNNAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGNNNNRNNN  got-7.fa
13049719  TATTTTCCCATGGAGTATCATATGCTTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGANNNRNNN  ler-1.fa
13049719  TATTTTCCCATGGAGTATCATATGCTTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGATNNRNNN  lov-5.fa
13049719  TATTTTCCCATGGAGTATCATATGCNTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGATNNRNNN  nfa-8.fa
13049719  TATTTTCCCATGGAGTATCATATGCTTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGANNTRNNN  rrs-10.fa
13049719  TATTTTCCCATGGAGTATCATANNNNNNAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGANNNRNNN  rrs-7.fa
13049719  TATTTTCCCATGGAGTATCANATGCNTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGATNNRNNN  sha.fa
13049719  TATTTTCCCATGGAGTATCATATGCTTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGATNNRNNN  tamm-2.fa
13049719  NNNNTTCCCATGGAGTATNNNNNNNNNCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCNAATTTGNNNNRNNN  ts-1.fa
13049719  TATTTTCCCATGGAGTATCATATGCTTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTNATNTGNNNTRNNN  tsu-1.fa
13049719  TATTTTCCCATGGAGTATCANATGCNTCAAATAATTTGCGTTTGAGTCTAGCAATTACTACCACCTAATTTGATTNRNNN  van-0.fa
 
13049799  TTAGTGATATCTCTCTAACCTAAGATTCTTCTTAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  chr4.fa
13049799  NTNGTGATATCTCTCTAACCTAAGATTCTTCTTAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  bay-0.fa
13049799  NNNNTNNNNNNNNTCTAACCTANNNNTNNNNNNNATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  bor-4.fa
13049799  NTNGTGATATNTCTCTAACCTNNNNNNNNNNNNNNTACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  br-0.fa
13049799  NNNNNGATATCTCTCTAACCTAAGATTCTTCTTAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  bur-0.fa
13049799  NTNGTGATATCTCTCTAACCTAAGATTCTTCTTAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  c24.fa
13049799  NTNGTGATATCTCTCTAACCTAAGATTCTTCTTAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  col-0.fa
13049799  NNNNNNNNNNCTCTCTAACCTANNNNNNNNNNNNNNNCCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  cvi-0.fa
13049799  NNNNNNNNNNNNNNCTAACCNNNNNNNNNNNTTAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  est-1.fa
13049799  NNNGTGATATCTCTCTAACCTAAGATTCTTCNTAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  fei-0.fa
13049799  NNNNNNNNNNNNNNCTAACCTNNNNNNNTNCNTAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  got-7.fa
13049799  NTNGTGATATCTCTCTAACCTAAGATTCTTCTTAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  ler-1.fa
13049799  NTNGTGATATCTCTCTAACCTAAGATTCTTCTTAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  lov-5.fa
13049799  NTNGTNNNNNNNCTCTAACCTANNNNNNNNNNNNATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  nfa-8.fa
13049799  NTNNNNANNNNNNNCTAACCTANGATTCTTCTTAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  rrs-10.fa
13049799  NNNNNNNNNNCTCTCTAACCTAAGATTCTNNNNNATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  rrs-7.fa
13049799  NTNGTGATATCTCTCTAACCTAAGATNNNNNNNAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  sha.fa
13049799  NTNGTGATATCTCTCTAACCTAAGATTCNNNNNAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  tamm-2.fa
13049799  NNNNNNNNNNNTNTCTAACCTANNNNNNNNNNNNNTACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  ts-1.fa
13049799  NNNNNNNNNNNTCTCTAACCTANNNNNCTTCTTAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  tsu-1.fa
13049799  TTAGTGATATCTCTCTAACCTAAGATTCTTCTTAATACCTTATGCTGCTTAACATATTAGGTGCAAGAACACAACCATCC  van-0.fa
 
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  chr4.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  bay-0.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  bor-4.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  br-0.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  bur-0.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  c24.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  col-0.fa
13049879  TNNNNNNNNNNNTNNNNNNNTTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  cvi-0.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  est-1.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  fei-0.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  got-7.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  ler-1.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  lov-5.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  nfa-8.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  rrs-10.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  rrs-7.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  sha.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  tamm-2.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  ts-1.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  tsu-1.fa
13049879  TCATATACTTCTGCTACAAATTGGTAACACATTCTGCAAACTTCCAGGTGGACGCCTGAAGCCTGGTGAAAATGGTATAC  van-0.fa
 
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  chr4.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  bay-0.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  bor-4.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  br-0.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCNACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  bur-0.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  c24.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  col-0.fa
13049959  AGTTACCACCCGTTAGNNNNNNNNNGNNNNNNNNNNNGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  cvi-0.fa
13049959  AGTTACCACCCGTTAGTAATACTTNCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGNGTC  est-1.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  fei-0.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  got-7.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  ler-1.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTN  lov-5.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACANNNNNATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  nfa-8.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  rrs-10.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  rrs-7.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  sha.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  tamm-2.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  ts-1.fa
13049959  AGTTACCACCCGTTAGTAATACTTNCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  tsu-1.fa
13049959  AGTTACCACCCGTTAGTAATACTTTCTACACTGTTATGAGTTTCTTGGCTGCTTAAGTTTTGGGTGTACTATGTTGTGTC  van-0.fa
 
13050039  TGCAGAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  chr4.fa
13050039  TGCAGAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  bay-0.fa
13050039  TGCAGAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  bor-4.fa
13050039  TGCANAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  br-0.fa
13050039  TGCAGAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  bur-0.fa
13050039  TGCANAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  c24.fa
13050039  TGCANAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  col-0.fa
13050039  TGCAGAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  cvi-0.fa
13050039  TGCAGAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  est-1.fa
13050039  TGCAGAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  fei-0.fa
13050039  TGCAGAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  got-7.fa
13050039  TGCAGAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  ler-1.fa
13050039  TNNANAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  lov-5.fa
13050039  TGCAGAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  nfa-8.fa
13050039  TGCAGAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  rrs-10.fa
13050039  TGCAGAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  rrs-7.fa
13050039  TGCANAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  sha.fa
13050039  TGCANAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  tamm-2.fa
13050039  TGCAGAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  ts-1.fa
13050039  TGCAGAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATNCGGCTGCTCTTGTACCTGACTGGACGG  tsu-1.fa
13050039  TGCANAAGCTGATGGTCTGAAAAGAAAGCTGACCAGTAAACTTGGAGGCAATTCGGCTGCTCTTGTACCTGACTGGACGG  van-0.fa
 
13050119  TACTATTCTGGTTTCTTCTTTTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  chr4.fa
13050119  TACTATTCTGGTTTCTNCTTTTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  bay-0.fa
13050119  TACTATTCTGNNNNNNNNNNNTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  bor-4.fa
13050119  TACTATTNNNNNNNNTNCTTNTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  br-0.fa
13050119  TACTATTCTGGTTTCTNNNTTTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  bur-0.fa
13050119  TACTATTCTGGTTTCTNCTTTNTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  c24.fa
13050119  TACTATTCTGGTTNNNNNTTTTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  col-0.fa
13050119  TACTATTNNNNNNNNNNNNNNTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  cvi-0.fa
13050119  TACTATTCTGNNNNNNNNNNNTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  est-1.fa
13050119  TACTATTNNNNNNNNNNNNNNNNCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  fei-0.fa
13050119  TACTATTNNNNNNNNNNNNNTTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  got-7.fa
13050119  TACTATTCTGGTTTNNNNNNNNTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  ler-1.fa
13050119  TACTATTCTGGTTNNNNNNTTTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  lov-5.fa
13050119  TACTATTCTGGNNNNNNNNNNTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  nfa-8.fa
13050119  TACTATTCTGGTTTCTNCTTTTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  rrs-10.fa
13050119  TACTATTCTGGTTNNNNNNNNNTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  rrs-7.fa
13050119  TACTATTCTGNTTTCTTCNTTTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  sha.fa
13050119  TACTATTCTGNTNNCTNNNNNNNNGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  tamm-2.fa
13050119  TACTATTCNNNNNNNNNNNNNTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  ts-1.fa
13050119  TACTATTCTGGTTTCTNCTTTTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  tsu-1.fa
13050119  TACTATTCTGGTTTCNNNNNTTTCGTTGAGTGATAGTGACAAGATATTTAGGGGTAGATAGATGCCTTAAAAGAACTAGG  van-0.fa
 
13050199  TTGGTGTTGCATGTGCTTGCTCTTAAAGCAAACGAGAAGCAATTGAAATTATTTTGGTTATTACACTTAAGCATGCCAGG  chr4.fa
13050199  TTGGTGTTGCATGTGCTTGCTCTTAAAGCAAACGAGAAGCAATTGAAATTATTTTGGTTATTACACTTAAGCATGCCAGG  bay-0.fa
13050199  TTGGTGTTGCATGTGCTTGCTCTTAAAGCAAACGAGAAGCAATTGAAATTNTTTTGGTTATTACACTTAAGCATGCCAGG  bor-4.fa
13050199  TTGGTGTTGCATGTGCTTGCTCTTAAAGCAAACGAGAAGCAATNGANNNNNNNNNNNNNNNNNCACTTAAGCATGCCAGG  br-0.fa
13050199  TTGGTGTTGCNTGTGCTTGCTCTTAAAGCAAACGAGAAGCAATTGAAATTNTTTTGGTTATTACACTTAAGCATGCCAGG  bur-0.fa
13050199  TTGGTGTTGCATGTGCTTGCTCTTAAAGCAAACGAGAAGCAATTGAAATTANTTTGGTTATTACACTTAAGCATGCCAGG  c24.fa
13050199  TTGGTGTTGCATGTGCTTGCTCTTAAAGCAAACGAGAAGCAATTGAAATTATTTTGGTTATTACACTTAAGCATGCCAGG  col-0.fa
13050199  TTGGTGTTGCATGTGCTTGCTCTTAAAGCAAACGAGAAGCAANTGAAANNNNNNNNNNNNTTACACTTAAGCATGCCAGG  cvi-0.fa
13050199  TTGGTGTTGCATGTGCTTGCTCTTAAAGCAAACGAGAAGCAANTGAAATNNNNNNNNNNNNNNCACTTAAGCATGCCAGG  est-1.fa
13050199  TTGGTGTTGCATGTGCTTGCTCTTAAAGCAAACGAGAAGCAATTGAAATTNNNNNNGTTATTACACTTAAGCATGCCAGG  fei-0.fa
13050199  TTGGTGTTGCATGTGCTTGCTCTTAAAGCAAACGAGAAGCAATTGANNNNNTTTTGNNNNNNACACTTAAGCATGCCAGG  got-7.fa
13050199  TTGGTGTTGCATGTGCTTGCTCTTAAAGCAAACGAGAAGCAATTNNNNNNNNNNNNNNNNNNACACTTAAGCATGCCAGG  ler-1.fa
13050199  TTGGTGTTGCATGTGCTTGCTCTTAAAGCAAACGAGAAGCAATTGAAATTA