Arabidopsis SNP Sequence Viewer

Chromosome : chr4 Coordinates : 13346760 - 13348791


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
13346760  TCGGAGACGATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  chr4.fa
13346760  TCGGAGACGATGAGCGAAACCGAANCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  bay-0.fa
13346760  TCGGAGACGATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  bor-4.fa
13346760  TCGGAGACGATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  br-0.fa
13346760  TCGGAGACGATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCANCGATTNCNNNNNNNNNNNNTTCTGA  bur-0.fa
13346760  TCGGAGACGATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  c24.fa
13346760  TCGGAGACGANNNNNNAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  col-0.fa
13346760  TCGGAGACGATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGNAACTGTTTCTGA  cvi-0.fa
13346760  TCGGAGACGATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  est-1.fa
13346760  TCGGAGACNATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  fei-0.fa
13346760  TCGGAGACGATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  got-7.fa
13346760  TCGGAGACGATGAGCGAAACCGAANCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAANCTGTTTCTGA  ler-1.fa
13346760  TCGGAGACGATGAGCGAAACCGAANCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAANCTGNTTCTGA  lov-5.fa
13346760  TCGGAGACGATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  nfa-8.fa
13346760  TCGGAGACGATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  rrs-10.fa
13346760  TCGGAGACGATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTNCAGCGATTGAGACTGAAACTGTTTCTGA  rrs-7.fa
13346760  TCGGAGACGATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  sha.fa
13346760  TCGGAGACGATGAGCGAAACCGAANCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGCGANTNNNNNTGTTTCTGA  tamm-2.fa
13346760  TCGGAGACGATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  ts-1.fa
13346760  TCGGAGACGATGAGCGAAACCGAAGCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  tsu-1.fa
13346760  TCGGAGACGATGAGCGAAACCGAANCAACCGGCGTTACCGATGATTCGGCTCCAGCGATTGAGACTGAAACTGTTTCTGA  van-0.fa
 
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCAGAGAAATGGGTGGGTGATT  chr4.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCAGAGAAATGGGTNGGTGATT  bay-0.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCAGAGAAATGGGTNGGTGATT  bor-4.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCAGNNAAATGGGTGGGTGATT  br-0.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGANGGAGCNNNNNNNNNNNNNNNNGATT  bur-0.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCNNNNNNATGGGTNGGTGATT  c24.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGNGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCNNNNNNNNNNNNGGGTGATT  col-0.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGNAGNAGNGAAATGGGTGGGTGATT  cvi-0.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCAGAGAAATGGGTNGGTGATT  est-1.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCNNNNNNNNNNNNNNNNNATT  fei-0.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCAGNGAAATGGGTNGGTGATT  got-7.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGNAGNAGNGAAATGGGTNGGTGATT  ler-1.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGNAGNANNNNNATGNGTGGGTGATT  lov-5.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCAGNGAAATGGGTNGGTGATT  nfa-8.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCAGAGAAATGGGTNGGTGATT  rrs-10.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCAGNGAAATGGGTNGGTGATT  rrs-7.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCAGNGAAATGGGTNGGTGATT  sha.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCAGAGAAATGGGTNGGTGATT  tamm-2.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCAGNNNNNTGNGTNGGTGATT  ts-1.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCAGNGAAATGGGTGGGTGATT  tsu-1.fa
13346840  TGCGATGGAGCATACAGCGATCGGAGTGGTTGAATCGGTGGAAGGAGCCATAGAAGGAGCAGNGAAATGGGTNGGTGATT  van-0.fa
 
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  chr4.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  bay-0.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  bor-4.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  br-0.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCNNNNNNNCNNNNNNNCTCAGTTC  bur-0.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  c24.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  col-0.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  cvi-0.fa
13346920  TGCNACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  est-1.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  fei-0.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  got-7.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  ler-1.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  lov-5.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  nfa-8.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  rrs-10.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  rrs-7.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  sha.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAANNCNNNNNCTCTCAGTTC  tamm-2.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  ts-1.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  tsu-1.fa
13346920  TGCAACGGACGGTGAAGGAATCGAAGGATACCGCAATGCGTTCTGCTCGTTCCCTCCGTGAAAATTCTACCTCTCAGTTC  van-0.fa
 
13347000  CGCTCTATACAGGTTAGTTAATCTCTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTTACCAAAAAACATTT  chr4.fa
13347000  CGCTCTATACAGGTTAGTTAATCTCTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTNACCAAAAAACATTT  bay-0.fa
13347000  CGCTCTATACAGNNNNNNNNNNNNNNNNNNNNTTCACCAAACAATTTTTGCGAATCGAGATTGTTTANCAAAAAACATTT  bor-4.fa
13347000  CGCTCTATACAGGTTNGTTANTCTNTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTNNNNNAAAAAACATTT  br-0.fa
13347000  CGCTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
13347000  CGCTCTATACAGGTTAGTTAATCTCTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTTANCAAAAAACATTT  c24.fa
13347000  CGCTCTATACAGGTTAGTTAATCTCTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTTACCAAAAAACATTT  col-0.fa
13347000  CGCTCTATACAGNNNNNNTAATCNNNNNTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTNNNNNNNNNACATTT  cvi-0.fa
13347000  CGCTCTATACAGGTTAGTTAATCTCTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTNANCAAAAAACATTT  est-1.fa
13347000  CGCTCTATACAGGTTNGTTAATNTCTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTTANCAAAAAACATTT  fei-0.fa
13347000  CGCTCTATACAGGTTAGTTAATCTCTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTTACCAAAAAACATTT  got-7.fa
13347000  CGCTCTATACAGGTTAGTTAATCTCTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTNACCAAAAAACATTT  ler-1.fa
13347000  CGCTCTATACAGGTTAGTTAATCTCTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTTACCAAAAAACATTT  lov-5.fa
13347000  CGCTCTATACAGGTTAGTTAATCTCTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTTANCAAAAAACATTT  nfa-8.fa
13347000  CGCTCTATACAGGTTNGTTAATCTCTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTTACCAAAAAACATTT  rrs-10.fa
13347000  CGCTCTATACAGGTTAGTTAATCTCTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTTACCAAAAAACATTT  rrs-7.fa
13347000  CGCTCTATACAGGTTANTTAATCTCTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTTACCAAAAAACATTT  sha.fa
13347000  CGCTCTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
13347000  CGCTCTATACAGGTTAGTNAATCTCTCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTTACCAAAAAACATTT  ts-1.fa
13347000  CGCTCTATACAGGTTAGTTAATNTCNCTTTTGTTCACCAAACAATTTTTGCGAATCGAGATTGTTTACCAAAAAACATTT  tsu-1.fa
13347000  CGCTCTATACAGGTTAGTTAATCTCTCTTTTGTTCACCANNNNNNNNGNNNGAATCGAGATTGTTTACCAAAAAACATTT  van-0.fa
 
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGTAAGCTATAATTTCTAGAAATGAGCTCGATTCAGAACA  chr4.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGTAAGCTATNNNNTCTAGAAATGAGCTCGATTCAGAACA  bay-0.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGNAAGCTANNNNNNNTAGAAATGAGCTCGATTCAGAACA  bor-4.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATNNNNNNAGCTNNNNNNNNNNNAAATGAGCTCGATTCAGAACA  br-0.fa
13347080  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGTAAGCTATANNNNNNNNAAATGAGCTCGATTCAGAACA  c24.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCNTAAGCTATAATTTCTAGAAATGAGCTCGATTCAGAACA  col-0.fa
13347080  TCAGGATTTCAAACCATGGATNTGGTGGAATTTAGTATNNNNNNNNNNNNNNNNNNNNNNAATGAGCTCGATTCAGAACA  cvi-0.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGNAANNNNNNNNNNNNNNAAATGAGCTCGATTCAGAACA  est-1.fa
13347080  TCAGNATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGTAAGCTNNNNNNNNNNNNNNTGAGCTCGATTCAGAACA  fei-0.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGTAAGNNNNNNNNNNNNGAAATGAGCTCGATTCAGAACA  got-7.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGTAAGCTATANNNNNNNGAAATGAGCTCGATTCAGAACA  ler-1.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGTAAGCTATAANNNNNNGAAATGAGCTCGATTCAGAACA  lov-5.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGTAAGCTATAANNNNNNGAAATGAGCTCGATTCAGAACA  nfa-8.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGTAAGCTANNNNNNNNAGAAATGAGCTCGATTCAGAACA  rrs-10.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGTAAGCNNNNNNNNNNAGAAATGAGCTCGATTCAGAACA  rrs-7.fa
13347080  TCAGNATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGTNAGCTATANNNNNNNNAAATGAGCTCGATTCAGAACA  sha.fa
13347080  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGTAAGCTNNNNNNNNNNGAAATGAGCNCGATTCAGAACA  ts-1.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGTAAGCNNNNNNNNNNNGAAATGAGCTCGATTCAGAACA  tsu-1.fa
13347080  TCAGGATTTCAAACCATGGATATGGTGGAATTTAGTATCTCGNAAGCTATAANNNNNNGAAATGAGCTCGATTCAGAACA  van-0.fa
 
13347160  GATATTTCTCCAATTAGCAGTTTTATGTATTGAATGGTGCTAGTTTTTGTTCATATGGGTAAAATCTTGTTGAATCATAC  chr4.fa
13347160  GATATTTCTCCAATTAGCAGTTTTATGTATTGAATGGTGCTNGTTTTTGTTCATATGGGTAAAATCTTGTTGAATCATAC  bay-0.fa
13347160  GATATTTCTCCAATTAGCAGTTTTATGTATTGNATGGTGCTAGTTTTTGTTCATATGGGTAAAATCTTGTTGAATCATNC  bor-4.fa
13347160  GATNTTTCTCCAATTAGCAGTTTNATGTATNGAATGGTGCTAGTTTTTGTTNNNNNNNNNAAAATCTTGTTGAATCNNNN  br-0.fa
13347160  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
13347160  GATATTTCTCCAATTAGCAGTTTTATGTNTTGAATGGTGCTAGTTTTTGTTCATATGGGTAAAATCTTGTTGAATCATAC  c24.fa
13347160  GATATTTCTCCAATTAGCAGTTTTATGTATTGAATGGTGCTNGTTTTTGTTCATATGGGTAAAATCTTGTTGAATCATAC  col-0.fa
13347160  GNNNNNNCTCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAAATCTTGTTGAANNNNNN  cvi-0.fa
13347160  GATATTTCTCCAATTAGCAGTTTTATGTATTGAATGGTGCTAGTTTTTGTTCNNANGGGTAAAATCTTGTTGAANNNNNN  est-1.fa
13347160  GATATTTCTCCAATTAGCAGTTNTATGTATTGNATGGTGCTAGTTTTTGTTCATATGGGTAAAATCTTGTTGAATNNNNN  fei-0.fa
13347160  GATATTTCTCCAATTAGCAGTTTTATGTATTGAATGGTGCTAGTTTTTGTTCATATGGGTAAAATCTTGTTGAATCNNNN  got-7.fa
13347160  GATATTTCTCCAATTAGCAGTTTTATGTATTGAATGGTGCNAGTTTTTGTTCATATGGGTAAAATCTTGTTGAATCATAC  ler-1.fa
13347160  GATATTTCTCCAATTAGCAGTTTTATGTATTGAATGGTGCNAGTTTTTGTTCATATGGGTAAAATCTTGTTGAATCATAC  lov-5.fa
13347160  GATATTTCTCCAATTAGCAGTTTTATGTATTGAATGGTGCTAGTTTTTGTTCATATGGGTAAAATCTTGTTGAATCNNNN  nfa-8.fa
13347160  GATATTTCTCCAATTAGCAGTTTTATGTATTGAATGGTGCTNGTTTTTGTTCATATGGGTAAAATCTTGTTGAATCATAC  rrs-10.fa
13347160  GATATTTCTCCAATTAGCAGTTTTATGTATTGAATGGTGCTNGTTTTTGTTCATATGGGTAAAATCTTGTTGAATCNTAN  rrs-7.fa
13347160  GATATTTCTCCAATTAGCANTTTTATGNANNNNNTGGTGCTAGTTTTTGTTNNNNNNGGTAAAATCTTGTTGAATCATNN  sha.fa
13347160  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNN  tamm-2.fa
13347160  GATATTTCTCCAATTAGCAGTNNNNNNTATTGAATGGTGCTAGTTTTTGTTNNNNNGGGTAAAATCTTGTTGAATCNTNN  ts-1.fa
13347160  GATATTTCTCCAATTAGCAGTTTTATGTATTGAATGGTGCTAGTTTTTGTTCATATGGGTAAAATCTTGTTGAATNNNNN  tsu-1.fa
13347160  GATATTTCTCCAATTAGCAGTTTNATGTATTGNATGGTGCTAGTTTTTGTTCNTATGGGTAAAATCTTGTTGAATCATAC  van-0.fa
 
13347240  CATTATAACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGACTGTAAT  chr4.fa
13347240  CNTTATAACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGACTGTAAT  bay-0.fa
13347240  NNNNNNNACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGACTGTAAT  bor-4.fa
13347240  NNNNNNNNNTTATTNGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGNNNNNNNTAAT  br-0.fa
13347240  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
13347240  CATTATNACTTATTGGCAATGATCTTAGTCTCTTCCTGGNTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGACTGTAAT  c24.fa
13347240  CATTATAACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGACTGTAAT  col-0.fa
13347240  NNNNNNNACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGANTGTAAT  cvi-0.fa
13347240  NNNTATAACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGACTGTAAT  est-1.fa
13347240  NNNNNNNNNTTNTTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAANACTGTAAT  fei-0.fa
13347240  NNNNNNAACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGACTGTAAT  got-7.fa
13347240  CATTATAACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGACTGTAAT  ler-1.fa
13347240  CATTATAACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGACTGTAAT  lov-5.fa
13347240  NNNTATAACTTATTGGCAATGATCTTNGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGACTGTAAT  nfa-8.fa
13347240  CATTATAACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGACTGTAAT  rrs-10.fa
13347240  CANTATAACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGACTGTAAT  rrs-7.fa
13347240  NNNNNTAACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTNGAAGACTGTAAT  sha.fa
13347240  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
13347240  NNNNNTAACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGACTGTAAT  ts-1.fa
13347240  NNNNNTAACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGTTGTTTAGAAGACTGTAAT  tsu-1.fa
13347240  CNTTATAACTTATTGGCAATGATCTTAGTCTCTTCCTGGGTTCTGATTCTGCTTCAAATGGNTGTTTAGAAGACTGTAAT  van-0.fa
 
13347320  GTATCGCTGAGGCATTCTTGATTATTCTCTAAACAATGTTTTTATATGATATCAGATATTCATGTAGCTTAATGATGTGT  chr4.fa
13347320  GTATCGCTGAGGCATTCTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCATGTAGCTTAATGATGTGT  bay-0.fa
13347320  GTATCGCTGAGGCATTCTTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCATGNAGCTTAATGATGTGT  bor-4.fa
13347320  GTATCGCTGAGGCATTCTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTTAATGATGTGT  br-0.fa
13347320  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
13347320  GTATCGCTGAGGCATTCTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCANGTAGCTTAATGATGTGT  c24.fa
13347320  GTATCGCTGAGGCANNNNNNNTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCATGTAGCTTAATGATGTGT  col-0.fa
13347320  GTATCGCTGAGGCATTCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAATGATGTGT  cvi-0.fa
13347320  GTATCGCTGAGGCATTCTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTAATGATGTGT  est-1.fa
13347320  GTATCGCTGAGGCATTCTTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGCTTAATGATGTGT  fei-0.fa
13347320  GTATCGCTGAGGCATTCTTGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTAGCTTAATGATGTGT  got-7.fa
13347320  GTATCGCTGAGGCATTCTTGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCATGTAGCTTAATGATGTGT  ler-1.fa
13347320  GTATCGCTGAGGCATTCTTGATTATTNTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCATGTAGCTTAATGATGTGT  lov-5.fa
13347320  GTATCGCTGAGGCATTCTTGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCATGTAGCTTAATGATGTGT  nfa-8.fa
13347320  GTATCGCTGAGGCATTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCATGTAGCTTAATGATGTGT  rrs-10.fa
13347320  GTATCGCTGAGGCATTCTTGATTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCATGTAGCTTAATGATGTGT  rrs-7.fa
13347320  GTATCGCTGAGGCATTCTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGTAGCTTAATGATGTGT  sha.fa
13347320  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
13347320  GTATCGCTGAGGCATTCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTAGCTTAATGATGTGT  ts-1.fa
13347320  GTATCGCTGAGGCATTCTTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATGTNGCTTAATGATGTGT  tsu-1.fa
13347320  GTATCGCTGAGGCATTCTTGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGCTTAATGATGTGT  van-0.fa
 
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGATGTATGTATATGTCTTCGTCTTCTCTCATACAATC  chr4.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGNNNNNNNTATATGTCTTCGTCTTCTCTCATACAATC  bay-0.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGNNNNNNNTATATGTCTTCGTCTTCTCTCATACAATC  bor-4.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGNNNNNNNNNTATGTCTTCGTCTTCTCTCATACAATN  br-0.fa
13347400  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGANNNNNNTATATGTCTTCGTCTTCTCTCATACAATC  c24.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGATGTNTGTATATGTCTTCGTCTTCTCTCATACAATC  col-0.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTNNNNNNNNNNNNNNGTCTTCGTCNTCTCTCNNNNNNNN  cvi-0.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGNNNNNNNNATATGTCTTCGTCTTCTCTCATACANTC  est-1.fa
13347400  GATATGGAGTAGNCCCTATCTGGCTGAAATCACAGTTCCATTAGANNNNNNNATATGTCTTCGTCTTCTCTCATACAATC  fei-0.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGNNNNNNNTATATGTCTTCGTCNTCTCTCATACAATC  got-7.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGANNNNNNTATATGTCTTCGTCTTCTCTCATACAATC  ler-1.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGATGTNTGTATATGTCTTCGTCTTCTCTCATACAATC  lov-5.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGATGTNTGTATATGTCTTCGTCTTCTCTCATACAATC  nfa-8.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGANNNNNNTATATGTCTTCGTCTTCTCTCATACAATC  rrs-10.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGATGTNTGTATATGTCTTCGTCNTCTCTCATACAATC  rrs-7.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGNNNNNNNTATATGTCTTCGTCNTCTCTCATACAATC  sha.fa
13347400  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGANNNNNNNATATGTCNTCGTCTTCTCTCATACAATC  ts-1.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTANNNNNNNNTATATGTCTTCGTCTTCTCTCATACAANC  tsu-1.fa
13347400  GATATGGAGTAGACCCTATCTGGCTGAAATCACAGTTCCATTAGANNNNNNNATATGTCTTCGTCTTCTCTCATNNNNNN  van-0.fa
 
13347480  TTACATTTGATTCTGAAATTGCAGGATTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  chr4.fa
13347480  TTACATTTGATTCTGAAATTGCANGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  bay-0.fa
13347480  TTACATTTGATTCTGAAATTGCAGGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  bor-4.fa
13347480  TNNNNNNNNNTTCTGAAATTGCANGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTNCTTCAG  br-0.fa
13347480  NNNNNNNNNNTTCTGAAATNGCNNGRTTTCATTCCACATGCTTTGACTCAGTATAANACCTATNAGANTGCTTTCTNNNN  bur-0.fa
13347480  TTACATTTGATTCTGAAATTGCANGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  c24.fa
13347480  TTACATTTGATTCTGAAATTGCAGGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  col-0.fa
13347480  NNNNNNNNNNNNNNNNNNNNNNNNNRNNNCATTCCACATGCTTTGACTCAGTATNNNNNNNNNNANNNNNNNNNNNNNNN  cvi-0.fa
13347480  TTNNNNNNGATTCTGAAATTGCANGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  est-1.fa
13347480  TTACATTTNATTCTGAAATTGCAGGRTNNCATTCCACATGCTTTGACTCAGTATAAGACCTATNAGAATGCTTTCTTCAG  fei-0.fa
13347480  TTACATTTGATTCTGAAATTGCAGGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  got-7.fa
13347480  TTACATTTGATTCTGAAATTGCANGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  ler-1.fa
13347480  TTACATTTGATTCTGAAATNNNANGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  lov-5.fa
13347480  TTACATTTGATTCTGAAATTGCNNGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  nfa-8.fa
13347480  TTACATTTGATTCTGAAATTGCAGGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  rrs-10.fa
13347480  TTACATTTGATTCTGAAATTGCAGGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  rrs-7.fa
13347480  TTACNTTTGATTCTGAAATTGCANGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  sha.fa
13347480  NNNNNNNNNATTCTGAAATTGCANNRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  tamm-2.fa
13347480  TTACNNNNGATTCTGAAATTGCANGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATNNNNNNTTCAG  ts-1.fa
13347480  TTACATTTNATTCTGAAATTGCAGGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  tsu-1.fa
13347480  NNNNATTTGATTCTGAAATTGCAGGRTTTCATTCCACATGCTTTGACTCAGTATAAGACCTATGAGAATGCTTTCTTCAG  van-0.fa
 
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  chr4.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  bay-0.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  bor-4.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  br-0.fa
13347560  NNNNNTNNNNNNNNTCTTGCAGCCAATTTTCGTGANANNNNNATACTNNNNNNNNACTGTAATGCTTAGGAACGAGTATN  bur-0.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  c24.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  col-0.fa
13347560  TNNNNNNNNNGGNATCTTGCAGCCAATTTTCGTGAAAAAGTTNNNNNNNNNNNNNNNNNTAATGCTTAGGAACNNNNNNN  cvi-0.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  est-1.fa
13347560  TANAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  fei-0.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  got-7.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  ler-1.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  lov-5.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  nfa-8.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  rrs-10.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  rrs-7.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  sha.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATN  tamm-2.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  ts-1.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGTAGACTACTGTAATGCTTAGGAACGAGTATT  tsu-1.fa
13347560  TAAAGTTACAGGTATCTTGCAGCCAATTTTCGTGAAAAAGTTATACTGGNAGACTACTGTAATGCTTAGGAACGAGTATT  van-0.fa
 
13347640  TTAGATCAAACTGAGATATAACAGATAGCTGCCACAAAACTTTTATATATACTTGTAGTGCATCTTATAGTGTTCTGAAA  chr4.fa
13347640  TTAGATCAAACTGAGATATAACAGATAGCTGCCNCNNNNNNNNNNNNNNNNCTTGTAGTGCATCTTATAGTGTTCTGAAA  bay-0.fa
13347640  TTAGATCANACTGAGATATAACAGATANCTNCCNCAAANNNNNNNNNNNNNNNNNTAGTGCATCTTATAGTGTNCTGAAA  bor-4.fa
13347640  TTAGANNNNNNNNNNATATNACNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTGCATCTTATAGTGTTNTGAAA  br-0.fa
13347640  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNAGTGCATCTTATAGTNNNNNNAAA  bur-0.fa
13347640  TTAGATCAAACTGAGATANAACAGATAGCNGCCACANNNNNNNNNNNNNNNNNNGTAGTGCATCTTATAGTGTTCTGAAA  c24.fa
13347640  TTAGATCAAACTGAGATATAACAGATAGCTGCCACAAAACTTTNNNNNNNACTTGTAGTGCATCTTATAGTGTTCTGAAA  col-0.fa
13347640  NNNNNNNNNNNNNNNNNNNNNCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCATCTTATAGNNNNNNNAAA  cvi-0.fa
13347640  TTAGATNNNNNNNAGATATAACAGATAGCNNNNACNNNNNNNNNNNNNNNNNNNNNAGTGCATCTTATAGTGTTCTGAAA  est-1.fa
13347640  TTAGATCNNNNNGAGATATAACAGATNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTAGTGCATCTTATAGTGTTNTGAAA  fei-0.fa
13347640  TTAGATCAAACTGAGATATAACAGATAGCTGCCACAAAACTTNNNNNNNNNNNTGTAGTGCATCTTATAGTGTTCTGAAA  got-7.fa
13347640  TTAGATCAAACTGAGATATAACAGATAGCTGCCNNNNNNNNNNNNNNNNNNNNTGTAGTGCATCTTATAGTGTTCTGAAA  ler-1.fa
13347640  TTAGATCAAACTGAGATATAACAGATNGCTGCCNNNNNNNNNNNNNNNNNNNTTGTAGTGCATCTTATAGTGNNNNNNNN  lov-5.fa
13347640  TTAGATCAAACTGAGATATAACAGATAGCTGCCNCAAANNNNNNNNNNNNNNNTGTAGTGCATCTTATAGTGTTCTGAAA  nfa-8.fa
13347640  TTAGATCAAACTGAGANNNNNCAGATAGCTGCCNNNNNNNNNNNNNNNNNNNNTGTAGTGCATCTTATAGTGTTCTGAAA  rrs-10.fa
13347640  TTAGATCAAACTGAGATATAACAGATAGCNNNNNCNNNNNNNNNNNNNNNNNTTGTAGTGCATCTTATAGTGTTCTGAAA  rrs-7.fa
13347640  TTAGATCAAACTGAGATATAACAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGTGCATCTTATAGTGTTCTGAAA  sha.fa
13347640  NNNNNNNNNNNNNNNNNNNNNCAGATAGCTGCCNNNNNNNNNNNNNNNNNNNNNNTAGTGCATCTTATAGTGTTCTGAAA  tamm-2.fa
13347640  TTAGATCAAANTGAGATATAACAGATAGCNGCCNNNNNNNNNNNNNNNNNNNTTGTAGTGCATCTTATAGTGTTCTGAAA  ts-1.fa
13347640  TTAGATCAAACTGAGATATAACAGATAGCNNNNNCAAANNNNNNNNNNNNNNNNNNAGTGCATCTTATAGTGTTCTGAAA  tsu-1.fa
13347640  TTAGATCAAACTGAGATATAACAGATAGCTGCCACAANNNNNNNNNNNNNNNNNGTAGTGCATCTTATAGTGTNCTGAAA  van-0.fa
 
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  chr4.fa
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  bay-0.fa
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  bor-4.fa
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  br-0.fa
13347720  CTAGAATCTTCNNNNNNNNCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTNGTTATCCTCGCAGACGAATTGATATA  bur-0.fa
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  c24.fa
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  col-0.fa
13347720  CTNGAATCTTCATGTCANTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  cvi-0.fa
13347720  CTAGAATCTTCATGTCANTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  est-1.fa
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  fei-0.fa
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  got-7.fa
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  ler-1.fa
13347720  NNNANNNNNNNNNNNCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  lov-5.fa
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  nfa-8.fa
13347720  CNAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  rrs-10.fa
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  rrs-7.fa
13347720  CTAGAATCTTCATGTCATTCCGATTANNNNNNNNNNNTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  sha.fa
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTNTTGTTATCCTCGCAGACGAATTGATATA  tamm-2.fa
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  ts-1.fa
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  tsu-1.fa
13347720  CTAGAATCTTCATGTCATTCCGATTAATCAATCCTCGTATCCTCTGCTGCTTTTGTTATCCTCGCAGACGAATTGATATA  van-0.fa
 
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTACTC  chr4.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTACTC  bay-0.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTACTC  bor-4.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACNNNNNNTC  br-0.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATNGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGNATNACNNNNNNNN  bur-0.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTACTC  c24.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTNCTC  col-0.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCNNNNNTC  cvi-0.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTANTC  est-1.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGNTTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCNNNNNNC  fei-0.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTACTC  got-7.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTACTC  ler-1.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTACTC  lov-5.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTACTC  nfa-8.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTACTC  rrs-10.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCNACTC  rrs-7.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTNCTC  sha.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTACTC  tamm-2.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCNACTC  ts-1.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTACTC  tsu-1.fa
13347800  CGCAAAAGAGCATCCGGCTGCTGCTATTGGGATTGGTGTCGCTGCTAGTCTCGTTCTGATGCGAGGTATAACCTCTACTC  van-0.fa
 
13347880  TCTTATCACTTTTACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACATCTGTTTTACTTATATGTGT  chr4.fa
13347880  TCTTATCACTTTTACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACATCTNNNNNNNTNNNNNNNNN  bay-0.fa
13347880  TCTTNTCACTTTNACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACANNNNNNNNNNNNNTNNNNNN  bor-4.fa
13347880  TCTTATCACTNTTACAACTNACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
13347880  NNNTNTCACTTTTACAACTTACNNNNNNNNNNNGNNNNNNNGCATCCAAATGGTNTNNCNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
13347880  TCTTATCACTTTTACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACATNNNNNNNNNNNNNNNNNGT  c24.fa
13347880  TCTTATCACTTTTACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACATCTGTTTTACTTATATGNGT  col-0.fa
13347880  TCTTATCNNNNNNNCAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
13347880  TCTTANCACTTTTACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACANNNNNNNNNNNNNNNNNNNN  est-1.fa
13347880  TCTTNTCANTTTTACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
13347880  TCTTATCACTTTTACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACATCNNNNNNNNNNNNNNNNNN  got-7.fa
13347880  TCTTATCACTTTTACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACATNNNNNNNNNNNNNNNNNNN  ler-1.fa
13347880  TCTTATCACTTTTACAACTNACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACATCTGTNNNNNNTATANNNNN  lov-5.fa
13347880  TCTTATCACTTTTANAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACATCTNNNNTACTTANNNNNNN  nfa-8.fa
13347880  TCTTATCACTTTTACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACANNNNNNNNNNNNNNNNNNNN  rrs-10.fa
13347880  TCTTATCACTTTTACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACNTNNNNNNNANNNNNNNNNNN  rrs-7.fa
13347880  TCTTNTCACTTTTACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTANNNNNNNNNNNNNNNNNNNNNN  sha.fa
13347880  TCTTATCACTTTTACNACTTACAANNNNNCNTCGCGTAGGAGCATCCAAATGGTATTACNNNNNNNNNANTNNNNNNNNN  tamm-2.fa
13347880  TCTTNTCACTTTTACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACATCNNNNNNNNNNNNNNNNNN  ts-1.fa
13347880  TCTTATCACTTTTACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACANNNNNNNNNNNNNNNNNNNN  tsu-1.fa
13347880  TCTTATCACTTTTACAACTTACAAGATTCCTTCCCGTAGGAGCATCCAAATGGTATTACANNNNNNNNNNNNNNNNNNNN  van-0.fa
 
13347960  CTTGTATGAATTTGGTTTTCTATTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  chr4.fa
13347960  CTTGTATGAATTTGGTTTTCTATTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  bay-0.fa
13347960  NNNGTATGAATTTGGTTTTCTNTTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  bor-4.fa
13347960  NNTGTATGANNNNNGTNTNNNNNTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  br-0.fa
13347960  NNTGTATGAATTTGGTTTTCTNTTGTTCGACTTACAGGCCCAAGAAGNTTCTTGTTTCGTAATACACTAGGCCGATTTCA  bur-0.fa
13347960  CTTGTATGAATTTNGTTTTCTATTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  c24.fa
13347960  CTTGTNTGAATTTGGTTTTCTATTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  col-0.fa
13347960  NNNNTNNNNNNNNNNNNNNNNNNNGTTCGACTTACAGGCCCAAGAAGATTNTTGTTTCGTAATACACTAGGCCGATTTCA  cvi-0.fa
13347960  NNTGTATGAATTTNGTTTTCTNTTGTTCGACTTACAGGCCCAAGAAGATTCTNGTTTCGTAATACACTAGGCCGATTTCA  est-1.fa
13347960  NNNGTATGANTTTGGTTTTCTNTTGTTCGACTTACAGGCCCAAGAAGATTNTTGTTTCGTAATACACTAGGCCGATTTCA  fei-0.fa
13347960  NTTGTATGANTTTGGTTTTCTNTTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  got-7.fa
13347960  CTTGTATGANTTTGGTTTTCTNTTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  ler-1.fa
13347960  CTTGTATGAATTTGGTTTNNNNNNNNNNNATTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  lov-5.fa
13347960  NTTGTATGAATTTGGTTTTCTNTTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  nfa-8.fa
13347960  CTTGTATGAATTTGGTTTTCTATTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  rrs-10.fa
13347960  NTTGTATGAATTTGGTTTTCTATTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  rrs-7.fa
13347960  NNNGTATGAATTTGGTTTTCTNTTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  sha.fa
13347960  NNTGTATGAATTTGGTTTTCTATTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  tamm-2.fa
13347960  NTTGTATGANTNNGNTTTTCTNTTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  ts-1.fa
13347960  NNTGTATGAATTTGGTTTTCNATTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  tsu-1.fa
13347960  NNNGTATGAATTTGGTTTTCTNTTGTTCGACTTACAGGCCCAAGAAGATTCTTGTTTCGTAATACACTAGGCCGATTTCA  van-0.fa
 
13348040  GAGCGAAGAGGTATATACTATACCAGCTTCAAATTTATTTCTTAACGTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  chr4.fa
13348040  GAGCGAAGAGGNNNNNNNNNNNNCAGCTTCAAATTTATTTCTNAACGTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  bay-0.fa
13348040  GAGCGAAGAGNNNNNNNNNNNNNCAGCTTCAAANNNNNNNNTTAACGTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  bor-4.fa
13348040  GAGCGAAGAGGNNNNNNNNNNNNCAGCTTCAAATTNNNNNNNNNNNNNTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  br-0.fa
13348040  GAGCGAAGAGNNNNNNNNNNNANCAGCTTNAAATTTNNNNNNNNNNNNTGTTATGCTTAGTTGCCCTGGTNTGTNNNNNN  bur-0.fa
13348040  GAGCGAAGAGGTNNNNNNNNNNNCAGCTTCAAATTTATTTCNNNNNNTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  c24.fa
13348040  GAGCGAAGAGGNNNNNNNNNNNNCAGCTTCAAATTTATTTNTTAACGTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  col-0.fa
13348040  GAGCGAAGAGNNNNNNNNNNNNNNNGCTTCAANNNNNTNNNNNNNNNNNNTTATGCTTAGTTGCCCTGGTCTGTGNNNNN  cvi-0.fa
13348040  GAGCGAAGAGNNNNNNNNNNNNNCAGCTTCAAANNNNNNNNNNNNNNNTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  est-1.fa
13348040  GAGCGAAGAGGTANNNNNNNNNNNAGCTTCAAATTTNNNNNNNNACNTTNTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  fei-0.fa
13348040  GAGCGAAGAGNNNNNNNNNNNNNNAGCTTCAAATTNNNNNNNNNNNGTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  got-7.fa
13348040  GAGCGAAGAGGNNNNNNNNNNNNCAGCTTCAAATTTATTTNNNNNNGTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  ler-1.fa
13348040  GAGCGAAGAGGTNNNNNNNNNNNCAGCTTCAAATTTATTTCTTAACGTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  lov-5.fa
13348040  GAGCGAAGAGGTNNNNNNNNNNNNAGCTTCAAATTTATTNNNTANCGTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  nfa-8.fa
13348040  GAGCGAAGAGNNNNNNNNNNTACCAGCTTCAAATTTATTTNTTAACGTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  rrs-10.fa
13348040  GAGCGAAGAGGTNNNNNNNNNNNCAGCTTCAAATTTNNNNCTTAACGTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  rrs-7.fa
13348040  GAGCGAAGAGGNNNNNNNNNNNNNAGCTTCAAATTTNNNNNNNNNNGTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  sha.fa
13348040  GAGCGAAGAGGTNNNNNNNNNNNCAGCTTCAAATTTNNNNNNNNNNNTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  tamm-2.fa
13348040  GAGCGAAGAGGNNNNNNNNNNNCCAGCTTCAAATTTATTNNNNNNCGTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  ts-1.fa
13348040  GAGCGAAGAGNNNNNNNNNNNNNNAGCTTCAAATTTNNNNNNNNNNNTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  tsu-1.fa
13348040  GAGCGAAGAGNNNNNNNNNNNNNNAGCTTCAAATTTNNNNNNNNACGTTGTTATGCTTAGTTGCCCTGGTCTGTGTCCCT  van-0.fa
 
13348120  TCCCTTATTTTTACATCCACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  chr4.fa
13348120  TCCCTTATTTTTACATCCACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  bay-0.fa
13348120  TCCCTTNTTTTTACATCCACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  bor-4.fa
13348120  TNNNNNATTTTTACNNNNACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  br-0.fa
13348120  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGNAGTT  bur-0.fa
13348120  TCCCTTATTTTTACATCCACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  c24.fa
13348120  TCCCTTATTTTTACATCCACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCANGTTCAGGAGTT  col-0.fa
13348120  NNNNNNNNNNNNNNNNNNNCNTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  cvi-0.fa
13348120  TCCCTTNTTTTNACATCCACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  est-1.fa
13348120  NNNNNTATTNNNNNNNCCNCTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  fei-0.fa
13348120  TCCCTTNTTNTTNCATCCACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  got-7.fa
13348120  TCCCTTATTTTTACATCCACTTCAAAATCATCGTCGCTTCAGGNACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  ler-1.fa
13348120  TCCCTNATTTTTACATCCACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  lov-5.fa
13348120  TCCCTTATTTTTACATCNACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  nfa-8.fa
13348120  TCCNNNNTTTTTACATCCACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  rrs-10.fa
13348120  TCCCTTATTTTTACATCCACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  rrs-7.fa
13348120  TCCCTTATTTTTACATCCACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  sha.fa
13348120  TNNNNNATTTTTACNNNNNNNNNNNNNNNNNNNNNNNTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  tamm-2.fa
13348120  TNNNNNATTTTTNCATCCACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  ts-1.fa
13348120  TCCCTTATTTTTACATCCACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  tsu-1.fa
13348120  TCCCTTATTTTTACATCCACTTCAAAATCATCGTCGCTTCAGGCACAATTCTTGAAAGCTGAGAAGCATGTTCAGGAGTT  van-0.fa
 
13348200  AAACATGTCTGTAGACTTGATGAAAAAGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  chr4.fa
13348200  AAACATGNCTGTAGACTTGATGAAAANNNNNNNNNGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  bay-0.fa
13348200  AAACATGTCTGTAGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  bor-4.fa
13348200  AANCATGTCTGNAGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  br-0.fa
13348200  AAACNNNNNNNNNNNNNNNNNGANAANNNNNNNNANNANATTGCTTGAGAGGACGGCTTTNGCAGAGAAGNATATGAAAC  bur-0.fa
13348200  AAACATGTCTGTAGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  c24.fa
13348200  AAACATGTCTGTAGACTTGATGAAAANGGAGAGCANGAAATTGCTTGAGAGGANGGCTTTAGCAGAGAAGGATATGAAAC  col-0.fa
13348200  AAACATGTCTGNNNNCTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  cvi-0.fa
13348200  AAACATGTNNNNNGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  est-1.fa
13348200  AAACATGTCTGTAGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  fei-0.fa
13348200  AAACATGTCTGTAGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  got-7.fa
13348200  AAACATGNCTGTAGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  ler-1.fa
13348200  AAACATGTCTGTAGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  lov-5.fa
13348200  AAACATGTCTGTAGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  nfa-8.fa
13348200  AAACATGTCTGTAGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  rrs-10.fa
13348200  AAACATGTCTGTAGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  rrs-7.fa
13348200  AAACATGTNTGTAGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  sha.fa
13348200  AAACATGTCTGTAGACTTGATGAAAANNNNNNNNAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAANNNNNTGAAAC  tamm-2.fa
13348200  AAACATGTCTGTAGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  ts-1.fa
13348200  AAACATGTCTGTAGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  tsu-1.fa
13348200  AAACATGTCTGTNGACTTGATGAAAANGGAGAGCAGGAAATTGCTTGAGAGGACGGCTTTAGCAGAGAAGGATATGAAAC  van-0.fa
 
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCTTTTATTAAGTTATTGACATCATTTATGTTAA  chr4.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCTTTTNNNNNNNNNNNNNNNNNNNNNATGTTAA  bay-0.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNA  br-0.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCTTNNNNNNNNNNNNNNNNNNNNNNNNTGTTAA  c24.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCTTTTATTAAGTNNNNNNNNNCATTTATGTTNA  col-0.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTAA  fei-0.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATNGACGCTCCCACTTCTTTTNNNNNNNNNNNNNNNNNATTTATGTTAA  ler-1.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATNGACGCTCCCACTTCTNNNNNNNNNNNNNNNNNNNNNNTTATGTTAA  lov-5.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCTTTNNNNNNNNNNNNNNNNNNNNNNNTGNNNN  nfa-8.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCTNNNNNNNNNNNNNNNNNNNNNNNNNTGTTAN  rrs-10.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCTTTTATNNNNNNNNNNNNNNNNNNNNTGNNNN  rrs-7.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCTTTTNNNNNNNNNNNNNNNNNNNNNATGNNNN  sha.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTNN  ts-1.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
13348280  GTGGTCTCTCTGAGCTCATGTATGCCCCAACATGGACGCTCCCACTTCTNNNNNNNNNNNNNNNNNNNNNNNNNTGTTAA  van-0.fa
 
13348360  TATGGGTACTACTGTTATATCTATAGGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  chr4.fa
13348360  TNTGGGTACTACTGTNNNNNCTATAGGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  bay-0.fa
13348360  NNTNGGTACTACTGTTNNNNNNNTAGGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  bor-4.fa
13348360  TNTGNGTNCTACTGTNNNNNCTATANGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  br-0.fa
13348360  NNNNNNNNNNNNNNNNNNNNNTATAGGAACTCTGGAAACGANNNNNNNNNNCTTGCTAAGTCCGTCCACAAAGCTGAANG  bur-0.fa
13348360  TNTGGGTACTACTGTTATNTCTATAGGAACTCTGGAAACGATATACNTCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  c24.fa
13348360  TATGGGTACTACTGTTATATCTATAGGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  col-0.fa
13348360  NNNNNNNNNNNNTGNNNNNNNTATAGGAACTCTGGAAACGATNTACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  cvi-0.fa
13348360  NNTGGGTACTACTNNNNNNNNNNNNGGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  est-1.fa
13348360  TNTGGGTACTACTGTNNNNNCTATANGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  fei-0.fa
13348360  NNNNNGTACTACTGNNNNNTCTATAGGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  got-7.fa
13348360  TATGGGTACTACTGTTATATCTATAGGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  ler-1.fa
13348360  TATGGGTACTACTGTTATATCTATAGGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  lov-5.fa
13348360  NNTGGGTACTACTGNNNNNNCTATNGGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  nfa-8.fa
13348360  NNNNNGTACTACTGTTATNTCTATAGGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  rrs-10.fa
13348360  NNTGGGTACTACTGTNNNNNCTATAGGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  rrs-7.fa
13348360  NNTGGGTACTACTGTTATATCTATAGGAACTCTGGAAACGANATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  sha.fa
13348360  NNNNNCNNNNNNNNNNNNNNNTATAGGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  tamm-2.fa
13348360  NNTGGGTACTACTGTTATNNNNATAGGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  ts-1.fa
13348360  NNNNNGTNCTACTGTNNNNNNNATAGGAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  tsu-1.fa
13348360  TNTGGGTACTACTGTNNNNNNNNNAGNAACTCTGGAAACGATATACATCGTCTTGCTAAGTCCGTCCACAAAGCTGAATG  van-0.fa
 
13348440  TGAAGCTGCTGGTAATCTTGAACAAGATTTATTTTTACTCACTTCTCCCTTCTCCCTTCAAATGGTATCTTTGATAATGC  chr4.fa
13348440  TGAAGCNNNAGGNNNNNNNNNNNNNNNNNNNTTTTTACTCACTTCNNNNNTCTCCCTTCAAATGGTATCTTTGATAATGC  bay-0.fa
13348440  TGAAGCNNNAGGNNNNNNNNNNNNNNNNNNNNTTTTACTCACTTCTCCNTTCTCCCTTCAAATGGTATCTTTGATAATGC  bor-4.fa
13348440  TGAAGCNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACNNNNNNNNNNNNNNNTNAANNNNNNNCTTTGATAATGC  br-0.fa
13348440  TNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGTATCTTTGATAATGC  bur-0.fa
13348440  TGAAGCNNNANNNNNNNNNNNNNNNNNNNNNNNTTTACTCACTNNNNNNNNNTCCCTTCAAATGGTATCTTTGATAATGC  c24.fa
13348440  TGAAGCTGCTGGTAATCTTGAACANGANTTNTTTTTACTCACTTCTCCNTTCTCCCTTCAAATGGNATCTTTGATAATGC  col-0.fa
13348440  TGAAGCNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN