Arabidopsis SNP Sequence Viewer

Chromosome : chr4 Coordinates : 13388765 - 13390191


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
13388765  CCATTTTATGTGCTTTCTGAGTTCAGATGAGCTGATCAAGACGGCCAAGTACATTGCAACGCCGGGAAGGGGCATTTTGG  chr4.fa
13388765  NNNTNNNNTGTGCTTTNNGRGTTRNGATGNGCRGNTRNANACGGCCAAGTACATTGCAACGCCGGGAANNNNCATTTTNN  bay-0.fa
13388765  CCATNNNNNNTGCTTTNNGRGTTRNGATGAGCRGNTRNAGACGGCCAAGTACATTGCAACGCCGGGAANNNNCANNNNNN  bor-4.fa
13388765  NNNNNNNNNNNNNTTTNTNRNNTRNNNTGNGNRGNTRNANACGGCCAAGTACATTGCAACGCCGGGAANNNNCATTTTNN  br-0.fa
13388765  CCANNNNNNNNNNNNNNNNRGNNRNNNNGNGNRGNNRNANACGGCCAAGNACATTGCAACGNNNNNNNNNNNNNNNTTNN  bur-0.fa
13388765  CCATTTTNTGTGCTTTCNGRGTTRNGATGNGCRGNNRNAGACGGCCAANNNNNNNNNAACGCCGGGAANNNNCATTTTNN  c24.fa
13388765  CCATTTTNTGNGCNNNNNGRGTTRNNATGAGNRGATRNAGACGGCCAAGTACATTGCAACGCCGGGAANNNNCATTTTNG  col-0.fa
13388765  NNNNNNTNTNNGNTTTNNGRNTNRNGNTGNGCRGNTRNAGACGGCCAAGTACATTGCAACGCCGGGAAGGGGCATTTTNN  cvi-0.fa
13388765  NNNNNNNATGTGCTTTNNGRGTTRAGATGAGCRGNTRNAGACGGCCAAGTACATTGCAACGCCGGGAANNNNCANNNNNN  est-1.fa
13388765  CCNTNNTNTGTGCTTTNTGRGNNRNNNTGNGCRGNTRNANACGGCCAAGTACATTGCAACGCCGGGAANNNNCANTTNNG  fei-0.fa
13388765  CCATNNNNNNTGCTTTNNGRGTTRNGATGAGCRGNTRNAGACGGCCAAGTACATTGCAACGCCGGNNNNNNNCATTTTNN  got-7.fa
13388765  CCATTTTNTGTGCTTTNNNRGTNRNNNTGNGCRGNNRNNNACGGCCAAGTACATTNCAACGCCGGGAANNNNCANNNNNN  ler-1.fa
13388765  CCATTTTNTGTGCTTTNNGRGNNRNNATGNGCRGNNRNNNACGGCCAAGTACATTGCAACGCCGGGAANGGGCATNNNNN  lov-5.fa
13388765  CCATTTNATGTGCTTTCTGRGTTRNGATGNGCRGNTRNAGACGGCCAAGTACATTGCAACGCCGGGAANNNNCATTTTNN  nfa-8.fa
13388765  CCATTTTNTGTGCTTTCNGRGTTRAGATGAGCRGANRNAGACGGCCAAGTACATTGCAACGCCGGGAANGGGCATTTTNN  rrs-10.fa
13388765  CCATTTTATGTGCTTTCTGRGTTRNGATGAGCRGATRNAGACGGCCAAGTACATTGCAACGCCGNNNNNNNNCATTTTNN  rrs-7.fa
13388765  CCATTTTNTGTGCTTTNNGRNTNRNNATGNGNRGNNRNANACGGCCAAGTACATTGCAACGCCGGGANNNNNCATTTTNN  sha.fa
13388765  CCATTTTATGTGCTTTNNGRGNTRNGNTGNGNRNNNRNNNACGGCCAAGTACATTNCAACGCCGGGAANGGGCATTTTNN  tamm-2.fa
13388765  CCATNNNNNNTGCTTTNNGRGTTRNGATGNGCRGATRNAGACGGCCAAGTACATTGCAACGCCGGGAANGGGCATTTNNN  ts-1.fa
13388765  NNNTTTTATGTGCTTTCTGRGTTRAGATGAGCRGNTRNAGACGGCCAAGTACATTGCAACGCCGGGAANNNNCATTTTNG  tsu-1.fa
13388765  CCATTTTATGTGCTTTNTGRGTNRNGATGAGCRGNTRNAGACGGCCAAGTACATTGCAACGCCGGGAANNNNNNNNNNNN  van-0.fa
 
13388845  CGGCAGATGAGAGCACAGAAACCATTGGGAAACGATTCGCCGGAATCAATGTTGAGAACACTGAGTCCAACCGCCAAGCT  chr4.fa
13388845  NRGNNGATGAGAGCACAGAAACCATTGGGAAACGATTNGNCRGRNTCAATGTTGANRRRRRRRRRRRRAACCGCCAANCT  bay-0.fa
13388845  CRGNNGATGAGAGCACAGAAACCATTGGGAAACGATTNGCCRGRNTCAATGTTGAGRRRRRRRRRRRRAACCGCCAAGCT  bor-4.fa
13388845  NRGNNGATGAGNNNNNAGAAANNNNNNNNNNNNNNNNNNNNRNRNNCAATGTTNNNRRRRRRRRRRRRAACCGCCAANCN  br-0.fa
13388845  NRNNNNNNNNNNNNNNNNNNNCCATTGGGAAACGANTNGNCRNRNTNAATGTTNNNRRRRRRRRRRRRNNCCGCCAAGNN  bur-0.fa
13388845  NRNNNGATGAGAGCACAGAAACCATTGGGAAACGATTNGCCRNRNTCAATGTTGAGRRRRRRRRRRRRAACCGCCAAGCT  c24.fa
13388845  CRGNNGATGAGAGCACAGAAACCATTGGGAAACGATTNGCCRGRNTCAATGTTGAGRRRRRRRRRRRRAACCGCCAAGCT  col-0.fa
13388845  CRGNNGATGAGNNNNNAGAAACCATTGGGAAACGATTNNNCRNRNNCAATGTTNNNRRRRRRRRRRRRAACCGCCAAGCT  cvi-0.fa
13388845  NRNNNGATGAGAGCACAGAAACCATTGGGAAACGATTNGCCRGRATCAATGTTGAGRRRRRRRRRRRRAACCGCCAAGCT  est-1.fa
13388845  CRGCNGATGAGANNNNAGAAACCATTGGGAANCGATTNNNNRNRNNCAATGTTGNNRRRRRRRRRRRRAACCGCCAAGNT  fei-0.fa
13388845  CRGNNGATGAGAGCACAGAAACCATTGGGAAACGATTNGCCRGRNNCAATGTTGAGRRRRRRRRRRRRAACCGCCAAGCT  got-7.fa
13388845  NRNNNGATGAGANCACAGAAACCATTGGGAAACGATTNGNCRNRNNCAATGTTNNNRRRRRRRRRRRRAACCGCCAANCT  ler-1.fa
13388845  NRNNNGATGAGNNNNNAGAAACCATTGGGAAACGATTNGNCRNRNNCAATGTTGNNRRRRRRRRRRRRAACCGCCAANCT  lov-5.fa
13388845  CRGNNGATGAGAGCACAGAAACCATTGGGAAACGATTNGCCRGRNNCAATGTTGAGRRRRRRRRRRRRAACCGCCAAGCT  nfa-8.fa
13388845  CRGNAGATGAGAGCACAGAAACCATTGGGAAACGATTNGCCRGRATCAATGTTGAGRRRRRRRRRRRRAACCGCCAAGCT  rrs-10.fa
13388845  NRGNNGATGAGAGCACAGAAACCATTGGGAAACGATTNGCCRGRNTCAATGTTGAGRRRRRRRRRRRRAACCGCCAAGCT  rrs-7.fa
13388845  NRNNNGATGAGAGCACAGAAACCATTGGGAAACGATTNGNNRNRNNCAATGTTGNNRRRRRRRRRRRRAACCGCCAAGCT  sha.fa
13388845  NRNNNNNTGAGNNNNNAGAAACCATTGGGAAACGATTNGNCRNRNNCAATGTTGANRRRRRRRRRRRRAACCGCCAANCT  tamm-2.fa
13388845  CRGNNGATGAGAGCACAGAAACCATTGGGAAACGATTNGCCRGRANCAATGTTGAGRRRRRRRRRRRRAACCGCCAAGCT  ts-1.fa
13388845  CRGNAGATGAGAGCACAGAAACCATTGGGAAACGATTNGCCRGRNTCAATGTTGAGRRRRRRRRRRRRAACCGCCAAGCT  tsu-1.fa
13388845  NRGNNGATGAGAGCACAGAAACCATTNGGNANNNNNNNNNNRNRNNCAATGTTGNNRRRRRRRRRRRRAACCGCCAAGCT  van-0.fa
 
13388925  TACCGTGAGCTCCTCTTCACTTCCCCTGGCAGTTACCCTTGCCTCTCTGGTGTTATACTCTTCGAGGAAACCCTCTACCA  chr4.fa
13388925  RRCCGTGAGCTNNNRRRRRCRNNNCCTNGCAGTNRNCNTTGCCTCNCRGNTGTTNTRNTCRRRRRRRRRRRRRRRRRNCN  bay-0.fa
13388925  RRNCGTGAGCTNNTRRRRRCRTCCCCTNGCAGTTRCCCTTGCCTCTCRGNTGTTATRNTNRRRRRRRRRRRRRRRRRCCN  bor-4.fa
13388925  RRCCGTGAGCTNNTRRRRRCRTNCCCTNGCAGNTRCCCTTGCCTNTCRGNTGTTATRNNCRRRRRRRRRRRRRRRRRNCN  br-0.fa
13388925  RRNCNNGANNNNNNRRRRRNRNNNNNNNNNNNNNRNNNNNNNNNNNNRNNNGTNNNRNNNRRRRRRRRRRRRRRRRRNNN  bur-0.fa
13388925  RRCCGTGAGCTNCNRRRRRCRTNCCCTNGCAGTTRCCCTTGCCTCTCRGNTGTTATRCNNRRRRRRRRRRRRRRRRRCCN  c24.fa
13388925  RRCCGTGAGCTNCTRRRRRCRTCNCCTNGCAGTTRCCNTTGCCTCTCRGNTGTTATRCTCRRRRRRRRRRRRRRRRRCCN  col-0.fa
13388925  RRCCGTGAGCNNNNRRRRRNRNNNNNNNNNNNNNRNCCTTGCCTCTCRGGNGTTNTRNNCRRRRRRRRRRRRRRRRRNNN  cvi-0.fa
13388925  RRCCGTGAGCTCCNRRRRRCRTCCNNNNNNAGTTRCCNTTGCCTCTCRGNTGTTNNRNNCRRRRRRRRRRRRRRRRRCNN  est-1.fa
13388925  RRCCGTGAGCTNNTRRRRRCRNNNNNNNGCAGNNRNNNTTGCCTCNNRNNNGTTNNRNNNRRRRRRRRRRRRRRRRRNCN  fei-0.fa
13388925  RRCCGTGAGCTNCTRRRRRCRTCNCCTNGCAGNTRCCCTTGCCTCTCRGNTGTNNNRNNNRRRRRRRRRRRRRRRRRNCN  got-7.fa
13388925  RRCCGTGAGCTNNNRRRRRCRTNNNNNNGCAGNNRNNNTTGCCTCTCRGNTGTTANRNNNRRRRRRRRRRRRRRRRRCNN  ler-1.fa
13388925  RRCCGTGAGCTNNNRRRRRNRTNNCCTNGCAGTNRNNNTTGCCTCTCRGNNGTTNNRNNNRRRRRRARRRRRRRRRRCNN  lov-5.fa
13388925  RRCCGTGAGCTNCNRRRRRCRTNNNNNNGCAGTTRCCCTTGCCTCTCRGNTGTTATRNNNRRRRRRRRRRRRRRRRRCCN  nfa-8.fa
13388925  RRCCGTGAGCTNCTRRRRRCRTCNCCTNGCAGTTRCCCTTGCCTCTCRGNTGTTATRNNCRRRRRRRRRRRRRRRRRCCA  rrs-10.fa
13388925  RRCCGTGAGCTNCTRRRRRCRTCNCCTNGCAGNTRCCCTTGCCTCTCRGNTGTTATRNTCRRRRRRRRRRRRRRRRRNCA  rrs-7.fa
13388925  RRCCGTGAGCTNNTRRRRRCRTNNCCTNGCANNNRNNNTTGCCTCTCRNNTGTNATRNNNRRRRRRRRRRRRRRRRRNNN  sha.fa
13388925  RRNNNTGAGCNNNNRRRRRNRNNNNNNNNNNNNNRNNNTTGCCTCTCRNNTGTTATRCTCRRRRRRRRRRRRRRRRRNNN  tamm-2.fa
13388925  RRCCGTGAGCTNCTRRRRRCRTCNCCTNGCAGTTRCCCTTGCCTCTCRGNTGTTATRNTCRRRRRRRRRRRRRRRRRCCA  ts-1.fa
13388925  RRCCGTGAGCTNCTRRRRRCRTCCCCTNGCAGTTRCCCTTGCCTCTCRGNTGTTATRCTNRRRRRRRRRRRRRRRRRCCN  tsu-1.fa
13388925  RRCCGTGAGCTNCTRRRRRCRNCCCCTNGCANTNRCCNTTGCCTCTCRGNTGTTATRCNCRRRRRRRRRRRRRRRRRNNN  van-0.fa
 
13389005  GAAAACCTCTGATGGCAAACCCTTCGTCGATCTCCTCATGGTCCGTCTCGGAAAAAGCAAACTCCAGCTCTAGTCTTAGT  chr4.fa
13389005  GAAAANCRNRGNNGGCAAACCCTTCGNRGARCTCCTCATGGTCCGTCTCGGAAAAAGCAAACTCCAGCTCTAGTCTTAGT  bay-0.fa
13389005  GAAAACCRCRGNTGGCAAACCCTTCGTRGARCTCCTCATGGTCCGTCTCGGAAAAAGCAAACTCCAGCTCTAGTCTTAGT  bor-4.fa
13389005  GAAAANNRCRGNNGGCAAACCCTTCGTRGARCTCCTCATGGTCCGTCTCGGAAAAAGCAAACTCCAGCTCTAGTCTTANT  br-0.fa
13389005  NAAANNNRNRNNNGGCAAANCCTTNGNRNARCNCNTCATGGTCCGTCTCGGAAAAAGCANNNNNNNNNNNNNNNNNNNNN  bur-0.fa
13389005  GAAAACCRCRNNTGGCAAACCCTTCGNRGARCTCCTCATGGTCCGTCTCGGAAAAAGCNAACTCCAGCTCTAGTCTTAGT  c24.fa
13389005  GAAAACCRCRGATGGCAAACCCTTCGNRGARCTCCTCATGGTCCGTCTCNGAAAAAGCAAACTCCAGCTCTAGTCTTAGT  col-0.fa
13389005  GAAAACCRNRNANGGCAAACCCTTCGNRGARCTCCTCATGGTCCGTCTCGGAAAAAGCAAACTCNAGCTCTAGTCTTAGT  cvi-0.fa
13389005  GAAAACCRCRGANGGCAAACCCTTCGTRGARCTCCTCATGGTCCGTCTCGGAAAAAGCAAACTCCAGCTCTAGTCTTAGT  est-1.fa
13389005  GAAAANNRNRNNNGGCAAACCCTTCGNRGARCTCCTCATGGTCCGTCNCGGAAAAANNNNNNNNNNNNNCTNGNCTTAGT  fei-0.fa
13389005  GAAAACCRCRGNTGGCAAACCCTTCGTRGARCTCCTCATGGTCCGTCTCGGAAAAAGCAAACTCCAGCTCTAGTCTTAGT  got-7.fa
13389005  GAAAACCRNRNNNGNCAAACCCTTCGNRGARCTCCTCATGGTCCGTCTCGGAAAANGCAAACTCCAGCTCTAGTCTTAGT  ler-1.fa
13389005  GAAAANCRNRGNNGNCAAACCCTTCNNRGARCTCCTCATGGTCCGTCTCGGAAAAAGCAAACTCCAGCTCTAGTCTTAGT  lov-5.fa
13389005  GAAAACCRCRGNNGGCAAACCCTTCGNRGARCTCCTCATGGTCCGTCTCGGAAAAAGCAAACTCCAGCTCTAGTCTTAGT  nfa-8.fa
13389005  GAAAACCRCRGATGGCAAACCCTTCGTRGARCTCCTCATGGTCCGTCTCGGAAAAAGCAAACTCCAGCTCTAGTCTTAGT  rrs-10.fa
13389005  GAAAACCRCRGATGGCAAACCCTTCGTRGARCTCCTCATGGTCCGTCTCGGAAAAAGCAAACTCCAGCTCTAGTCTTAGT  rrs-7.fa
13389005  GAAAACCRNRGNNGGCAAACCCTTCGNRGARNTNCTCATGGTCCGTCTCGGAAAAAGCAAACTCCAGCTCTAGTCTTAGT  sha.fa
13389005  GAAAANCRNRGNNGGCAAACCCTTCGNRGARCTCCTCATGGTCCGTCTCGGANNNNNNAAACTCCAGCTCTAGTCTTAGT  tamm-2.fa
13389005  GAAAACCRNRGANGGCAAACCCTTCGTRGARCTCCTCATGGTCCGTCTCGGAAAAAGCAAACTCCAGCTCTAGTCTTAGT  ts-1.fa
13389005  GAAAACCRCRGATGGCAAACCCTTCGTRGARCTCCTCATGGTCCGTCTCGGAAAAAGCAAACTCCAGCTCTAGTCTTAGT  tsu-1.fa
13389005  GAAAACCRNRNATGGCAAACCCTTCGNRGARCTCCTCATGGTCCGTCTCGGAAAAAGCAAACTCCAGCTCTAGTCTTAGT  van-0.fa
 
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGGAACTTACTGTTTCAGTTTGGATCTGATTTT  chr4.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGGAACTTNNNRNNNCNGNNNNNNNNNNNNTTT  bay-0.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGGAACTNNNNRNTNNNNNTTGNNNNNNNTTTT  bor-4.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGNCATGACCCNNNNNNNNNNNNNNRNNNNNGTTTNNNNNNNNNNNT  br-0.fa
13389085  NATTGGGTCCNAGAGTTGCAGAGTTGAAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNT  bur-0.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGGAACTTNNNRNTNCNGTTTGGNNNNGATTTT  c24.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGGAACTTNNNRNTNCNGTTTGNNNNNNNTTTT  col-0.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGNANNNNNNNRNNNNNNNTTGNNNNNNNNTTT  cvi-0.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGGAANNNNNNRNTNNNNNTTGNNNNNNNNNTT  est-1.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGNCCCAAATGGAACTTNNNRNNNCNGNNNNNNNNNNNNTTT  fei-0.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGGAACTTNNNRNNNCAGTTTGNNNNNNNNTTT  got-7.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGNTGAAGCTCTTGACATGACCCAAATGGAACTTNNNRNNNNNNNTTGNNNNNNNNTTT  ler-1.fa
13389085  CATTGGGTCCAAGAGTTGCNGAGTTGAAGNNNNNGACATGACCCAAATGGAACTTNNNRNNNNNNNNNNNNNNNNNNTTT  lov-5.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGGAACTTNNNRNNNCAGTTTGNNNNNGATTTT  nfa-8.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGGAACNTNNNRTTNCNGTTTGNNNNNNNNTTT  rrs-10.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGGAACTTNNNRTTNCAGTTTGNNNNNNNTTTT  rrs-7.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGGAACNNNNNRNNNNNNNNNNNNNNNNNNTTT  sha.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGGAACTTNNNRNNNNNNNNNGGNTNNNNNTTT  tamm-2.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGGAACTTNNNRNTTCNGTTTGNNNNNNNNTNT  ts-1.fa
13389085  CATTGGGTCCAAGAGTTGCAGNGTTGAAGCTCTTGACATGACCCAAATGGAACTTNNNRNNNCNGNNNNNNNNNNNTTTT  tsu-1.fa
13389085  CATTGGGTCCAAGAGTTGCAGAGTTGAAGCTCTTGACATGACCCAAATGGAANNNNNNRNNNCNGNNNNNNNNNNNNTTT  van-0.fa
 
13389165  TCTTTGGATCAGGAGAACGGTGTTATCCCCGGAATCAAAGTGGACAAGGGTTTGGTTGATCTAGCAGGGACCAACGGCGA  chr4.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATCNNRGNARRRRRRGRGRRRRRRRRRRRRRRNGNTCTAGCAGGRACCAARGNCGA  bay-0.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATCNNRNNARRRRRRARNRRRRRRRRRRRRRRNGATCTAGCAGGRACCAARGNCGA  bor-4.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATNNCRGGARRRRRRGRGRRRRRRRRRRRRRRTGNTCTAGCAGGRACCAARGNCGA  br-0.fa
13389165  TCTTTGGATCAGGAGNNNNNNGNTATCNNRNGNRRRRRRNRNRRRRRRRRRRRRRRNNNTCTNGCNGNRANCANRNNCGA  bur-0.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATCNCRGGARRRRRRARGRRRRRRRRRRRRRRNNNTCTAGCAGNRACCAARGNCGA  c24.fa
13389165  TCTTTGGATCAGGAGAANGGTGTTATCNNRGGARRRRRRGRGRRRRRRRRRRRRRRNGNTCTAGCAGGRACCAARGNCGA  col-0.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATNNNRGGARRRRRRGRGRRRRRRRRRRRRRRNNNTCTAGCAGGRACCAARGNCGA  cvi-0.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATCNCRGGARRRRRRGRGRRRRRRRRRRRRRRNNATCTAGCANNRACCAARGNCGA  est-1.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATNNCRGNARRRRRRGRNRRRRRRRRRRRRRRNNNTCTAGCAGGRACCNARGNCGA  fei-0.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATCNCRGGARRRRRRGRGRRRRRRRRRRRRRRTGNTCTAGCAGGRACCAARGNNGA  got-7.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATCNCRGGARRRRRRGRGRRRRRRRRRRRRRRNNNTCTAGCNGNRACCANRNNCGA  ler-1.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATNNNRGGARRRRRRGRGRRRRRRRRRRRRRRNNNTCTAGCAGGRACCAARNNCGA  lov-5.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATCNCRGGARRRRRRGRGRRRRRRRRRRRRRRTGNTCTAGCAGGRACCAARGNCGA  nfa-8.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATCNCRGGARRRRRRGRGRRRRRRRRRRRRRRTGNTCTAGCAGGRACCAARGNCGA  rrs-10.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATCNCRGGARRRRRRGRGRRRRRRRRRRRRRRTGATCTAGCAGGRACCAARGNCGA  rrs-7.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATNNNRGGARRRRRRGRNRRRRRRRRRRRRRRNNNTCTAGCANGRACCAARGNCGA  sha.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATCNCRGGARRRRRRGRGRRRRRRRRRRRRRRNNNTCTAGCNNGRACCNARGNCGA  tamm-2.fa
13389165  TNTTTGGATCAGGAGAACGGTGTTATCNNRGNARRRRRRGRGRRRRRRRRRRRRRRTGNTCTAGCAGGRACCAARGNCGA  ts-1.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATCNCRGGARRRRRRGRGRRRRRRRRRRRRRRTGATCTAGCAGGRACCAARGGCGA  tsu-1.fa
13389165  TCTTTGGATCAGGAGAACGGTGTTATCNCRNNNRRRRRRGRGRRRRRRRRRRRRRRTNNTCTAGCAGGRACCANRGNCGA  van-0.fa
 
13389245  GACCACTACTCAAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGTATTACGAGGCAGGAGCCCGGTTTGCTAAATGGC  chr4.fa
13389245  NACCACNRRNNNAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGNATTACGAGGCAGGAGCNCGGTTTGCRNAATGGC  bay-0.fa
13389245  GACCACNRRTCAAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGTATTACGAGGCAGGAGCCCGGTTTGCRAAATGGC  bor-4.fa
13389245  GACCACNRRTNNAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGTATTACGAGGCAGGAGCCCGGTTTGCRAAATGGC  br-0.fa
13389245  NACCNCNRRNNNNNGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGTATTACGAGGCNNNNNNNCGGTTTNNRNNNTGGC  bur-0.fa
13389245  GACCACNRRTCAAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGTATTACGAGGCAGGAGCCCGGTTTGCRAAATGGC  c24.fa
13389245  GACCACNRRTCNAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGNATTACGAGGCAGGAGCCCGGTTTGCRAAATGGC  col-0.fa
13389245  GACCACNRRTNNAGGTCTAGACTCGCTTGGTGCACGGTGTCAGNNNNNNNNNNAGGCAGGAGCCCGGTTTGCRAAATGGC  cvi-0.fa
13389245  GACCACNRRTCNAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGNATTACGAGGCAGGAGCCCGGTTTGCRAAATGGC  est-1.fa
13389245  GACCACNRRNNNAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGNATTACGAGGCAGGAGCCCGGTTTGNRANATGGC  fei-0.fa
13389245  GACCACNRRTCAAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGNATTACGAGGCAGGAGCCCGGTTTGCRAAATGGC  got-7.fa
13389245  NACNACNRRNNNAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGNATTACGAGGCAGGAGCCCGGTTTGCRAANTGGC  ler-1.fa
13389245  NACNACNRRNCNAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGTATTACGAGGCAGGAGCCCGGTTTGCRNANTGGC  lov-5.fa
13389245  GACCACNRRTCNAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGTATTACGAGGCAGGAGCCCGGTTTGCRAAATGGC  nfa-8.fa
13389245  GACCACNRRTCNAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGTATTACGAGGCAGGAGCCCGGTTTGCRAAATGGC  rrs-10.fa
13389245  GACCACNRRTCAAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGTATTACGAGGCAGGAGCCCGGTTTGCRAAATGGC  rrs-7.fa
13389245  GACCACNRRNNNAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGTATTACGAGGCAGGAGCCCGGTTTGCRAAATGGC  sha.fa
13389245  GACCACNRRTCNAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGNNNNACGAGGCAGGAGCCCGGTTTGCRAAATGGC  tamm-2.fa
13389245  NACNACNRRTCAAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGNATTACGAGGCAGGAGCCCGGTTTGCRAAATGGC  ts-1.fa
13389245  GACCACNRRTCAAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGTATTACGAGGCAGGAGCCCGGTTTGCRAAATGGC  tsu-1.fa
13389245  GACCACNRRTCNAGGTCTAGACTCGCTTGGTGCACGGTGTCAGCAGTATTACGAGGCAGGAGCCCGGTTTGCRAAATGGC  van-0.fa
 
13389325  GTGCATTCTTCAAGATTGGGGCCACCGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGTGCTAGCCCGCTATGCC  chr4.fa
13389325  GTGCARTCRTCAAGATTNRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACNNNNNNNAGCTAGCNCNRRRRRRR  bay-0.fa
13389325  GTGCARTCRNCAAGATTGRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGTGCTAGCCCGRRRRRRR  bor-4.fa
13389325  GTGCARTCRTCAAGANTNRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGTGCTAGCCCGRRRRRRR  br-0.fa
13389325  GTGCNRNNRNNNAGANNGRRRRRRRRNANCCAAGCGNNNNNNNNNTCCAAGAGGACGCCNGGGTNNNNNNNCNRRRRRRR  bur-0.fa
13389325  GTGCARNCRTCAAGATTGRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGTGCTAGCCCGRRRRRRR  c24.fa
13389325  GTGCARTCRTCAAGATTNRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGTGCTAGCCCGRRRRRRR  col-0.fa
13389325  GTGCARTCRNCNAGATTGRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAANAGGACGCCAGGGTGCTAGCCCGRRRRRRR  cvi-0.fa
13389325  GTGCARNCRTCAAGATTGRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGAGCTAGCCCGRRRRRRR  est-1.fa
13389325  GTGCARNCRNCAAGATTGRRRRRRRRGAGCCAAGCGTTCTNTCCATCCAAGAGGACGCCAGGGTGCTAGCCCGRRRRRRR  fei-0.fa
13389325  GTGCARTCRTCNAGATTGRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGTGCTAGCCCGRRRRRRR  got-7.fa
13389325  GTGCNRTCRTCNAGATTGRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGTGCTAGCCCGRRRRRRR  ler-1.fa
13389325  GTGCARNCRTCNAGATTNRRRRRRRRGNGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGTGCTAGCCCGRRRRRRR  lov-5.fa
13389325  GTGCNRTCRTCAAGATTGRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGTGCTAGCCCGRRRRRRR  nfa-8.fa
13389325  GTGCARTCRTCAAGATNGRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGTGCTAGCCCGRRRRRRR  rrs-10.fa
13389325  GTGCARTCRTCAAGATTGRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGAGCTAGCCCGRRRRRRR  rrs-7.fa
13389325  GTGCARNCRNCNAGATTNRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGTGCTAGCCCGRRRRRRR  sha.fa
13389325  GTGCNRNCRTCNAGATTGRRRRRRRRGAGCCAAGCGTTNNNNCCATCCAAGAGGACGCCANGGTGCTAGCNCGRRRRRRR  tamm-2.fa
13389325  GTGCARTCRTCAAGATTGRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGTGCTAGCCCGRRRRRRR  ts-1.fa
13389325  GTGCARTCRTCAAGATTGRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGAGCTAGCCCGRRRRRRR  tsu-1.fa
13389325  GTGCARTCRTCNAGATTGRRRRRRRRGAGCCAAGCGTTCTCTCCATCCAAGAGGACGCCAGGGTGCTAGCCCGRRRRRRR  van-0.fa
 
13389405  ATCATCTGCCAGGAGAATGGACTTGTCCCGATCGTCGAGCCAGAGGTGCTGACAGGTGGGAGCCACGACATCAAGAAATG  chr4.fa
13389405  RRRRRRRRRRRRRRRRRTGGNCTRGTCCCRATCGTCGAGCCAGAGGTGCTGACAGGTGGGAGCCACGACRRCAAGAANRR  bay-0.fa
13389405  RRRRRRRRRRRRRRRRRTGGACTRGTCCCRATCGTCGAGCCAGAGGTGCTGACAGGTGGGAGCCACGACRRCAAGAAARR  bor-4.fa
13389405  RRRRRRRRRRRRRRRRRNGGNCTRGTCCCRATCGTCGAGCNNANNNNGCTGACAGGTGGGAGCCACGACRRCAAGNAARR  br-0.fa
13389405  RRRRRRRRRRRRRRRRRNNNNNNRNTNNNRNNNGTCGAGCCAGAGNNNNNNNNNNNNNNNAGCCACGNNRRNNNNNNNRR  bur-0.fa
13389405  RRRRRRRRRRRRRRRRRTGGNCTRNNCCCRATCGTCGAGCCAGAGGTGCTGACAGGTGGGAGCCACGNCRRCAAGAANRR  c24.fa
13389405  RRRRRRRRRRRRRRRRRTGGNCTRGTCCCRATCGTCGAGCCAGAGGTGCTGACAGGTGGGAGCCACGACRRCAAGAAARR  col-0.fa
13389405  RRRRRRRRRRRRRRRRRNNGNNNRGNCCCRATCGTCGAGCCAGAGGTGNTGACAGGTGGGAGCCACGNCRRCNANANARR  cvi-0.fa
13389405  RRRRRRRRRRRRRRRRRTGGACTRNTCCCRATCGTCGAGCCAGAGGTGCNGACAGGTGGGAGCCACGACRRCAAGAAARR  est-1.fa
13389405  RRRRRRRRRRRRRRRRRTGNNCTRNTNCCRATCGTCGAGCCAGAGGTGCTGACAGGTGGGAGCCACNACRRCNAGAAARR  fei-0.fa
13389405  RRRRRRRRRRRRRRRRRTGGNCTRNTCCCRATCGTCGAGCCAGAGGTGCTGACAGGTGGGAGCCACGACRRCAAGAAARR  got-7.fa
13389405  RRRRRRRRRRRRRRRRRNGNNNTRNNNCNRNTCGTCGAGCCAGAGGTGCTGACAGGTGGGAGCCACGNCRRCNAGAANRR  ler-1.fa
13389405  RRRRRRRRRRRRRRRRRTNNNNNRNNNCCRNNCGTCGAGCCAGAGGTGCTGACAGGTGGGAGCCACGNCRRCNAGAAARR  lov-5.fa
13389405  RRRRRRRRRRRRRRRRRTGGNCTRNTCCCRATCGTCGAGCCAGAGGTGCTGACAGGTNGGAGCCACGACRRCAAGAAARR  nfa-8.fa
13389405  RRRRRRRRRRRRRRRRRTGGNCTRNTCCCRATCGTCGAGCCAGAGGTGCTGACAGGTGGGAGCCACGACRRCAAGAAARR  rrs-10.fa
13389405  RRRRRRRRRRRRRRRRRTGGACTRNTCCCRATCGTCGAGCCAGAGGTGCTGACAGGTGGGAGCCACGACRRCAAGAAARR  rrs-7.fa
13389405  RRRRRRRRRRRRRRRRRTGNNCTRGTCCNRNTCGTCGAGCCAGAGGTGCTGACAGGTGGGAGCCACNACRRNNAGNNARR  sha.fa
13389405  RRRRRRRRRRRRRRRRRTGGNCTRGTNCCRNTCGTCGAGCCAGAGGTGCTGACAGGTGGGAGCCACGNCRRCNAGANARR  tamm-2.fa
13389405  RRRRRRRRRRRRRRRRRTGGNCTRGTCCCRATCGTCGAGCCAGAGGTGCTGACAGGTNGGAGCCACGACRRCAAGAAARR  ts-1.fa
13389405  RRRRRRRRRRRRRRRRRTGGACTRNTCCCRATCGTCGAGCCAGAGGTGCTGACAGGTGGGAGCCACGACRRCAAGAAARR  tsu-1.fa
13389405  RRRRRRRRRRRRRRRRRTGGNCTRNTCCCRATCGTCGAGCCAANNNNNNNNNCAGGTGGGAGCCACGACRRCAAGAANRR  van-0.fa
 
13389485  TGCGGCGGTGACTGAGACGGTTCTTGCTGCCGTGTTCAAGGCCTTGAACTACCACCATGTCCTCCTCGAAGGCACTCTGC  chr4.fa
13389485  NGCRNNGGTGANNNNNNNRNTTCTTGCTNNNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  bay-0.fa
13389485  NGCRNCGGTGNNNNNGACRGTTCTTGCTGCCRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  bor-4.fa
13389485  NNCRNNNGNNNNNNNNNNRNNTCTTGCTGCNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  br-0.fa
13389485  NNNRNNNNNNNNNNNNNNRNTNNNNNNTNNNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  bur-0.fa
13389485  NGCRGCGGTGNNNNNGNNRNNTCTTGCTGNNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  c24.fa
13389485  NNCRGCGGTGANNNNNNCRNTTNTTGCTGNNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  col-0.fa
13389485  NNCRGCGGTGACNNNNNCRGTTCTTGCTGCCRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  cvi-0.fa
13389485  NGCRNCGGTGNNNNNGNCRGTTCTTGCTGNNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  est-1.fa
13389485  TNCRGCGGTGACTGNGNNRNNTNTTGCTGNNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  fei-0.fa
13389485  TGCRGCGGTGNNNNNNNCRGNTNTTGCTGCNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  got-7.fa
13389485  NGNRNNGGTGNNNNNNNNRNNTNTTGCTGNNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  ler-1.fa
13389485  NGCRGCGNTNNNNNNNNNRNNTNTTGCTGNNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  lov-5.fa
13389485  NGCRGCGGTGANNNNGNCRGTTCTTGCTGCNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  nfa-8.fa
13389485  TGCRGCGGTGANNNNGNNRGTNNTTGCTGCCRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  rrs-10.fa
13389485  TNCRNNGGTGANNNNNACRGTTCTTGCTGCCRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  rrs-7.fa
13389485  NNCRGNGGTGANNNNNNNRNTTCTTGCTNNNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  sha.fa
13389485  NNCRNCGGTGANNNNNNNRNNNNTTGCTNNNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  tamm-2.fa
13389485  TGCRGCGGTGANNNNGNCRGTTNTTGCTGNNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  ts-1.fa
13389485  TGCRGCGGTGACTGNGNCRGTTCTTGCTGCCRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  tsu-1.fa
13389485  TGCRNCGNTNNNNNNGNCRGTTCTTGCTGCNRRRRRRNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  van-0.fa
 
13389565  TTAAACCTAACATGGTCACTCCCGGCTCCGACAGCCCAAAGGTATCCAAACTAGATGTTGCAATCCGGTTTTGTTTTGGA  chr4.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRNGCCCAAAGGTATCCAANCTAGATGTTGCAATNCGGTTNNNNNNNNNN  bay-0.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRAGCCCAAAGGTATCCAAACTAGATGTTGCAATNCGGTTTNGNTTNNNN  bor-4.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRAGCCCAAAGGTATCCAAACTAGNTGTTGCNATCCGGTTTTGNTTNNNN  br-0.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRANNCCAAAGGTNNNNNNNNTANNNNNNNNNNNNNNGTTTTGTTNNNNN  bur-0.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRAGCCCAAAGGTATCCAAACTAGATGTTNNNNNNCGGTTTTGNTNNNNN  c24.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRAGCCCAAAGGTATCCAAACTAGATGTTGCAATCCGGTTTTGNTTNNNN  col-0.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRNGCCCAAAGGTATCCAAACTAGATGTTGCNNNNCGGTTTTGNNNNNNN  cvi-0.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRAGCCCAAAGGTATCCAAACTAGATGTTGCNATCCGGTTTTGNTTNNNN  est-1.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRAGNCCAAAGGTATCCAAANTAGATGTTGCAATNCGGTTNNNNNNNNNN  fei-0.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRAGCCCAAAGGTATCCAAACTNGATGTTGCAATNCGGTTTTGNTTNNNN  got-7.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRNGNCCAAAGGTATCCAAACTAGATGTTGCAATCCGGTTNNNNNTNNNN  ler-1.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRNNNCCAAAGGTATCCAAACTAGATGTTNNNNNNNGGTTNNNNNTNNNN  lov-5.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRAGCCCAAAGGTATCCAAACTAGATGTTGCAATCCGGTTTTGNTTNNNN  nfa-8.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRAGCCCAAAGGTATCCAAACTAGATGTTGCNNNNCGGTTTTGTTTTNNN  rrs-10.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRAGCCCAAAGGTATCCAAACTAGATGTTGCAATCCGGTTTTGNTTNGNN  rrs-7.fa
13389565  RRRRRRRRRRRRRRRRNACTRRRRRRRRRRRRNNNCCAAAGGTATCCAAACTAGATGTTGCAATCCGGTTTTGNTTNNNN  sha.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRNGNCCAAAGGTATCCAAACTAGATGTTGCAATNCGGTTTTGNTNNNNN  tamm-2.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRAGCCCAAAGGTATCCAAACTAGATGTTGCNATCCGGTTTTGNTTNGNN  ts-1.fa
13389565  RRRRRRRRRRRRRRRRCACTRRRRRRRRRRRRAGCCCAAAGGTATCCAAACTAGATGTTGCNNNNCGGTTTTGNTTNGNN  tsu-1.fa
13389565  RRRRRRRRRRRRRRRRNACTRRRRRRRRRRRRAGCCCAAAGGTATCCAAACTAGATGTTGCNATCCGGTTNNNNNNNNNN  van-0.fa
 
13389645  GTCGTTGTTTTATTGGTCTTATATTTTGAAACTGAAACCACAACCAAACTGTATCGGTGTGATGCTATTTTATTTAAATT  chr4.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNNTTTTGAAACNGAAANNNNNNCCAAACTGTATCGGTNNNNNNNNNNNNNNNNNNNNNN  bay-0.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNNNNNTGAAACNGAAANNNNNNCCAAACTGTATCGGTGTGATGCTNNNNNNNNNNNNNN  bor-4.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAAANNNNNNCCAAACTGTATCGGTNTGNTNNNNNNNNNNNNNNNNN  br-0.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAACTGTATCGGTNTGNNNNNNNNNNNNNNNNNNN  bur-0.fa
13389645  NNNGTTGNNNNNNNNNNNNNNNNNTTTGAAACNGAAACCNCAACCAAACTGTATCGGTGTGATGCTNNNNNNNNNNNNNT  c24.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNATTTTGAAACNGAAACCNCAACCAAACTGTATCGGTGTGATGCNNNNNNNNNNNNNNN  col-0.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAACTGTATCGGNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNGAAACCNNAACCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNCCAAACTGTATCGGTGTGNTNNNNNNNNNNNNNNNNT  fei-0.fa
13389645  NNNNTTGTNNNNNNNNNNNNNNNNNNNNANACNGAAACCNCAACCAAACTGTATCGGTGTGNTGCTANNNNNNNNNNNNN  got-7.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNNNNNNNANACNGAAANNNNNNCCAAACTGTATCGGTGTGNNNNNNNNNNNNNNNNNNN  ler-1.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNNNNTTGAAACNGAAANNNNNNCCAAACTGTATCGGTGTGATGCTNTNNNNNNNNNNTT  lov-5.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNNNTTTGAAACNGAAANNNNNNCCAAACTGTATCGGTGTGNTGCTANNNNNNNNNNNNN  nfa-8.fa
13389645  NNNGTTGTNNNNNNNNNNNNNNNNNNNNNNNNNGAAACCNCAACCAAACTGTATCGGTGTGATGCTATNNNNNNNNNNNN  rrs-10.fa
13389645  NNNGTTGTNNNNNNNNNNNNNNNNNNNGAAACNGAAANNNNNNCCAAACTGTATCGGTGTGATGCTANNNNNNNNNNATT  rrs-7.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNNNNTTGAAACNGNNNNNNNNNNCAAACTGTATCGGTGTGATGCTATNNNNNNNNNNNN  sha.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNNNNNTNANNCNGANNNNNNNNNCAAACTGTATCGGTGTGATGCTANNNNNNNNNNNNT  tamm-2.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACNGAAANNNNNNCCAAACTGTATCGGTGTGATGCTATNNNNNNNNNNNN  ts-1.fa
13389645  NNNGNTGNNNNNNNNNNNNNNNNNNNNNANNNNNNNACCANAACCAAACTGTATCGGTGTGATGCTNNNNNNNNNNNNNN  tsu-1.fa
13389645  NNNNNNNNNNNNNNNNNNNNNNNNNTTGNAACNGAAANNNNNNCCAAACTGTATCGGTGTGNTGCTNTNNNNNNNNNNNN  van-0.fa
 
13389725  TACATGCCCGGTCCTTACGTAACCACAATCAAATGAATCACAGAGACATCAATACCTCGAAATGCAACGTTAATTTGCTA  chr4.fa
13389725  TACATGCCCGGTCCTTACGTAACCACAANCRRRRRRRRRNNNNAGNCATCAATACCTCGAAATGCAACGTTAATTTGCTA  bay-0.fa
13389725  TACATGCCCGGTCCTTACGTAACCACAATCRRRRRRRRRNCNGAGACATCAATACCTCGAAATGCAACGTTAATTTGCTA  bor-4.fa
13389725  TACATGCCCGGTCCTTACGTAACCACAANNRRRRRRRRRNNNNNNNNATCAANACCTCGAAATGCAACGTTAATTTGCTA  br-0.fa
13389725  NNNATGCCCGGTCCTTACGTAACCACANNCRRRRRRRRRNNNNNNNNNNNNNNNNNTCGAAATGCAACNNNNNNNTGCTN  bur-0.fa
13389725  TACATGCCCGGTCCTTACGTAACCACAANCRRRRRRRRRNCAGAGACATCAATACCTCGAAATGCAACGTTAATTTGCTA  c24.fa
13389725  TACATGCCCGGTCCTTACGTAACCACAANCRRRRRRRRRNCAGAGACATCAATACCTCGAAATGCAACGTTAATTTGCTA  col-0.fa
13389725  NACATGCCCGGTCCTTACGTAACCACANNNRRRRRRRRRNNNNNNNNNNNNNTACCTCGAAATGCAACGTTAATTTGCTA  cvi-0.fa
13389725  NACATGCCCGGTCCTTACGTAACCACAANCRRRRRRRRRNCNGAGACATCAATACCTCGAAATGCAACGTTAATTTGCTA  est-1.fa
13389725  TACATGCCCGGTCCTTACGTAACCANANNNRRRRRRRRRNNANNNNNATCAATACCTCGAAATGCAACGTTAATTTGCTA  fei-0.fa
13389725  TACATGCCCGGTCCTTACGTAACCACAANCRRRRRRRRRNCNNANACATCAATACCTCGAAATGCAACGTTAATTTGCTA  got-7.fa
13389725  NACATGCCCGGTCCTTACGTAACCACAANCRRRRRRRRRNNNNNNNNNTCAANACCTCGAAATGCAACGTTAATTTNCTA  ler-1.fa
13389725  TACATGCCCGGTCCTTACGNAACCACAANCRRRRRRRRRNCNNNNNNATCAANACCTCGAAATGCAACGTTAATTTGCNA  lov-5.fa
13389725  TACATGCCCGGTCCTTACGTAACCACAANCRRRRRRRRRNCNGAGACATCAATACCTCGAAATGCAACGTTAATTTGCTA  nfa-8.fa
13389725  TACATGCCCGGTCCTTACGTAACCACAANCRRRRRRRRRNCANAGNCATCAATACCTCGAAATGCAACGTTAATTTGCTA  rrs-10.fa
13389725  TACATGCCCGGTCCTTACGTAACCACAANCRRRRRRRRRNCNGAGACATCAATACCTCGAAATGCAACGTTAATTTGCTA  rrs-7.fa
13389725  TACATGCCCGGTCCTTACGTAACCACAANCRRRRRRRRRNNNNAGACATCAATACCTCGAAATGCAACGTTAATTTGCTA  sha.fa
13389725  TACATGCCCGGTCCTTACGTAACCACAANCRRRRRRRRRNCANAGNCATCAATACCTCGAAATGCAACGTTAATTTGCTA  tamm-2.fa
13389725  TACATGCCCGGTCCTTACGTAACCACAANCRRRRRRRRRNNAGAGACNTCAANACCTCGAAATGCAACGTTAATTTGCTA  ts-1.fa
13389725  TACATGCCCGGTCCTTACGTAACCACAATCRRRRRRRRRNCNGAGACATCAATACCTCGAAATGCAACGTTAATTTGCTA  tsu-1.fa
13389725  TACATGCCCGGTCCTTACGTAACCACAANCRRRRRRRRRNCNNANNCATCAATACCTCGAAATGCAACGTTAATTTGCTA  van-0.fa
 
13389805  CAAAACGCTAAAATAGTTCTTCTTACAGGTTGCACCGGAACTAATTGCGGAATACACGGTGACTGCTCTGCGCCGCACAG  chr4.fa
13389805  CAAAACGCTAAANNNNNNNNTCTTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRNG  bay-0.fa
13389805  CAAAACGCTAAAATNGNNCNTCTTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  bor-4.fa
13389805  CAAAACGCTANNNNNNNNNNNNTTNCAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  br-0.fa
13389805  NNNNNNNNNNAAATAGNTCTTCTTNCAGGTTGCACCGGAACTAATTGCGGAATANACRRRRRRRRRRRRRRRRRRRRRNN  bur-0.fa
13389805  CAAAACGCTAAAATANNNCTTCTTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  c24.fa
13389805  CAAAACGCTAAAATNGTTCTTCTTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  col-0.fa
13389805  CAAANNNNNNNNNNNNNNNNNNNTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  cvi-0.fa
13389805  CAAAACGCTAAAATANTTCNTCTTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  est-1.fa
13389805  CAAANCGCTAANNNNNNNNNNNNTNCAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  fei-0.fa
13389805  CAAAACGCTAANNNNNNNNNNCTTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  got-7.fa
13389805  CAAAACGCNAAAATNNNNNNNNTTACAGGTTGCACCGGAANTAATTGCGGAATACNCRRRRRRRRRRRRRRRRRRRRRNG  ler-1.fa
13389805  CAAAACGCTAAAATAGTTCTTCTTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAN  lov-5.fa
13389805  CAAAACGCTAAAATAGTTNTTCTTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  nfa-8.fa
13389805  CAAAACGCTAAAATNNNNNNNNTTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  rrs-10.fa
13389805  CAAAACGCTAAAATNNNNNNNNTTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  rrs-7.fa
13389805  CAAAACGCTAAAATANNNNNNCTTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  sha.fa
13389805  CAAAACGCNANNNNNNNNNNTCTTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRNG  tamm-2.fa
13389805  CAAAACGCNAANATNNNNNNNNTTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  ts-1.fa
13389805  CAAAACGCTAAAANANNNNNNNTTACAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  tsu-1.fa
13389805  CAAAACGCTAAANNNNNNNTTCTTNCAGGTTGCACCGGAACTAATTGCGGAATACACRRRRRRRRRRRRRRRRRRRRRAG  van-0.fa
 
13389885  TCCCACCAGCTATTCCGGGAATCGTGTTCCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACTAAATCTAAACGCAATG  chr4.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRCCTCTCAGGCATACAGCGCGAAGANCAAGCGACACTAAANCNRRRRRRAANG  bay-0.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRCCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACTAAATCTRRRRRRAATG  bor-4.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRCCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACNAAANCNRRRRRRAANG  br-0.fa
13389885  NCCCNCNNNNNNNNNCNGGNANCNRRTRCNNCTCAGGCATACAGCGCGAAGAGCAAGCGACACNAAATNNRRRRRRNNNG  bur-0.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRCCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACTAAANCNRRRRRRAANG  c24.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRNCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACNAAANCNRRRRRRAATG  col-0.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRNCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACTAAANCNRRRRRRNANG  cvi-0.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRCCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACTAAANCNRRRRRRAATG  est-1.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRCCTCTCAGGCATACAGCGCGAAGANCAAGCGACACTNNNNNNRRRRRRNNNN  fei-0.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRCCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACTAAATCNRRRRRRAANG  got-7.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRNCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACNNNNNNNRRRRRRNNNN  ler-1.fa
13389885  TCCNACCAGCTATTCCGGGAATCGRRTRNCTCTCAGGCATACAGCGCGAAGANCAAGCGACACNAAANCNRRRRRRNANG  lov-5.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRCCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACTAANNNNRRRRRRNNNG  nfa-8.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRCCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACTAAATCNRRRRRRAATG  rrs-10.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRCCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACTAAANCTRRRRRRAATG  rrs-7.fa
13389885  NCCCACCAGCTATTCCGGGAATCGRRTRNCTCTCAGGCATACNGCGCGAAGAGCAAGCGACACTAAANNNRRRRRRAANG  sha.fa
13389885  TCCCANNNNCTATTCCGGGAATNNRRTRNCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACTAAANNNRRRRRRNANG  tamm-2.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRCCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACNAAANCNRRRRRRAANG  ts-1.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRCCTCTCAGGCATACAGCGCGAAGANCAAGCGACACTAAATCTRRRRRRAATG  tsu-1.fa
13389885  TCCCACCAGCTATTCCGGGAATCGRRTRCCTCTCAGGCATACAGCGCGAAGAGCAAGCGACACTAAANCNRRRRRRAANG  van-0.fa
 
13389965  AACAAGCTTGATGTGTTGAAGCCATGGACGCTCACTTTCTCTTTTGGCGGAGCCCTCCAGCAAAGTGCTATCAAGGCTTG  chr4.fa
13389965  AANRRRRRRRRRRRRRRGAAGRRRRRRRRRCNCANTTTCTCTTTTGGCGGNNNNNNCCAGCAAAGTGCTATCAAGGCTTG  bay-0.fa
13389965  AACRRRRRRRRRRRRRRGAAGRRRRRRRRRCTCANTTTCTCTTTTGGCGGAGCCCTCCAGCAAAGTGCTATCAAGGCTTG  bor-4.fa
13389965  AANRRRRRRRRRRRRRRGAAGRRRRRRRRRCNNANTTTCTCTTTTGGCGGAGCCCTCCAGCAAAGTGCTANCAAGGCTTG  br-0.fa
13389965  NNNRRRRRRRRRRRRRRGNNGRRRRRRRRRNNNANTTTCTCTTTTNGCNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
13389965  AACRRRRRRRRRRRRRRGAAGRRRRRRRRRCNCANTTTCTCTTTTGGCGGAGCCCTCCAGCAAAGTGCTATCAAGGCTTG  c24.fa
13389965  AACRRRRRRRRRRRRRRGAAGRRRRRRRRRCTCANTTTCTCTTTTGGCGGAGCCCTCCAGCAANGTGCTATCAAGGCTTG  col-0.fa
13389965  ANCRRRRRRRRRRRRRRGAAGRRRRRRRRRCTCANTTTCTCTTTTGGCGGAGCCCTCCAGCAAANNNNNCNNNNNNNTTG  cvi-0.fa
13389965  AACRRRRRRRRRRRRRRGAAGRRRRRRRRRCNCANTTTCTCTTTTGGCGGAGCCCTCCNGCAAAGTGCTATCAAGGCTTG  est-1.fa
13389965  NNNRRRRRRRRRRRRRRGAAGRRRRRRRRRNNNNNNNNNNCTTTTGGCGGAGCCCTCCAGCAAAGTGCTATCAAGGCTTG  fei-0.fa
13389965  AACRRRRRRRRRRRRRRGAAGRRRRRRRRRCTCACTTTCTCTTTTGGCGGAGCCCTCCAGCAAAGTGCTATCAAGGCTTG  got-7.fa
13389965  NNNRRRRRRRRRRRRRRGAAGRRRRRRRRRCNNANTTTCTCTTTTGGCGGAGCCCTCCAGCAAAGTGCTATCAAGGCTTG  ler-1.fa
13389965  ANNRRRRRRRRRRRRRRGAAGRRRRRRRRRCNNANTTTCTCTTTTGGCGGAGCCCTCCAGCAAAGTGCTATCAAGGCTTG  lov-5.fa
13389965  NNNRRRRRRRRRRRRRRGAAGRRRRRRRRRCTCACTTTCTCTTTTGGCGGAGCCCTCCAGCAAAGTGCTATCAAGGCTTG  nfa-8.fa
13389965  AACRRRRRRRRRRRRRRGAAGRRRRRRRRRCTCANTTTCTCTTTTGGCGGAGCCCTCCAGCAAAGTGCTATCAAGGCTTG  rrs-10.fa
13389965  AACRRRRRRRRRRRRRRGAAGRRRRRRRRRCTCACTTTCTCTTTTGGCGGAGCCCTCCAGCAAAGTGCTATCAAGGCTTG  rrs-7.fa
13389965  AANRRRRRRRRRRRRRRGAAGRRRRRRRRRNTCANTTTCTCTTTTGGCGGAGCCCTCCAGCAAANNNNNCNNNNNNNNTG  sha.fa
13389965  AANRRRRRRRRRRRRRRGAAGRRRRRRRRRNNCANTTTCTCTTTTGGCGGAGCCCTCCAGCAAAGNNNNCNNNNNNNNTG  tamm-2.fa
13389965  AACRRRRRRRRRRRRRRGAAGRRRRRRRRRCTCANTTTCTCTTTTGGCGGAGCCCTCCAGCAAAGNNNNCNNAAGGCTTG  ts-1.fa
13389965  AACRRRRRRRRRRRRRRGAAGRRRRRRRRRCTCANTTTCTCTTTTGGCGGAGCCCTCCAGCAAAGTGCTATCAAGGCTTG  tsu-1.fa
13389965  AACRRRRRRRRRRRRRRGAAGRRRRRRRRRCNCANTTTCTCTTTTNGCGGAGCCCTCCAGCAAAGTGCTATCAAGGCTTG  van-0.fa
 
13390045  GGCCGGTAAGCCCGAGAACGTAGCCAAAGCTCAGGCCAAGTTCCTGACCAGGTGCAAGGCTAACAAGGACGCTACCCTCG  chr4.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGCCRAAGCTCAGGCCARRTTNCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  bay-0.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGCCRAANCTCAGGCCARRTTCCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  bor-4.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGCCRNNNCNNNNNNNNRRNNNCTGNCCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  br-0.fa
13390045  NNNNNGTAAGCCCGAGAACGTANNNRNNNNTNNGNNNNRRNNNCTGACCAGGTGCAAGGCTAACAAGGACGCTANCRRRR  bur-0.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGCCRAAGCTCAGGCCARRTTCCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  c24.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGCCRAAGCTCAGGCCARRTTCCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  col-0.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGNCRAAGCTCAGGCCARRTTCCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  cvi-0.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGCCRAAGCTCAGGCCARRTTCCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  est-1.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGNNRAAGCTCAGNNCARRTTCCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  fei-0.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGCCRAAGCTCAGGCCARRTTCCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  got-7.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGCCRAANCTCAGGCNARRTTNCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  ler-1.fa
13390045  GGCCGGTAAGCCCGAGAACGTNGCCRAANCTCAGGCCARRTTNCTGACCAGGTGCAAGGCNAACAAGGACGCTACCRRRR  lov-5.fa
13390045  GGCCGGTAAGCCCGNGAACGTAGCCRAAGCTCAGGCCARRTTCCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  nfa-8.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGCCRAAGCTCAGGCCARRTTCCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  rrs-10.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGCCRAAGCTCAGGCCARRTTCCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  rrs-7.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGCCRAAGCTCAGGCCARRTTNCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  sha.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGNCRAAGCTCAGGCCARRTTNCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  tamm-2.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGCCRAAGCTCAGGCCARRTTCCTGACCAGGTGCAAGGNTAACAAGGACGCTACCRRRR  ts-1.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGCCRAAGCTCAGGCCARRTTCCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  tsu-1.fa
13390045  GGCCGGTAAGCCCGAGAACGTAGCCRAAGCTCAGGCCARRTTCCTGACCAGGTGCAAGGCTAACAAGGACGCTACCRRRR  van-0.fa
 
13390125  GGAAATACACCGGCTGGGCTTCTGGTGACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAG   chr4.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRANTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAN   bay-0.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAG   bor-4.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAG   br-0.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACNTGGTTGTGATAGNNNNCAN   bur-0.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAG   c24.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAG   col-0.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAN   cvi-0.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGNNNNNNG   est-1.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRANTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAG   fei-0.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAN   got-7.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAG   ler-1.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRANTNGGCCGCTTNTNNNNNNNNGGTTGTGATAGGATACAG   lov-5.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAG   nfa-8.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAG   rrs-10.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAG   rrs-7.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAG   sha.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAG   tamm-2.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAG   ts-1.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATACAG   tsu-1.fa
13390125  RRRRRRRRRRRRRRRRRRRRRRRRRRRACTCGGCCGCTTTCGAGAACTTGGTTGTGATAGGATNNNN   van-0.fa
 
visited.