Arabidopsis SNP Sequence Viewer

Chromosome : chr4 Coordinates : 18439138 - 18439578


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCACACATATC  chr4.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  bay-0.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  bor-4.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  br-0.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  bur-0.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  c24.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  col-0.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCANATC  cvi-0.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  est-1.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTNGCRCRCATATC  fei-0.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  got-7.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  ler-1.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  lov-5.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  nfa-8.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  rrs-10.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  rrs-7.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCNTATC  sha.fa
18439138  TCTGAAGTCGAACCACCGCAGNAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  tamm-2.fa
18439138  TCTGAAGTCGAACNACNNNNNNNNNNNNNNCAGCCGTGGCTTCCAGNNNNNNNNNNNNNNNNNNNNNTNGCRCRCATATC  ts-1.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  tsu-1.fa
18439138  TCTGAAGTCGAACCACCGCAGAAAAAGAAGCAGCCGTGGCTTCCAGATTATATCGTTGAGAACTGTTTAGCRCRCATATC  van-0.fa
 
18439218  GAGATCTTACTACCCGAAACTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  chr4.fa
18439218  GAGATCGTACTARCCGAAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  bay-0.fa
18439218  GANNNNGNNCNNRCCNAAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  bor-4.fa
18439218  GAGATCRTACTARCCGAAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  br-0.fa
18439218  NNNNNNGNNNNNRNNNNANRTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  bur-0.fa
18439218  GNNNNNGNNNNNRCCNAAARNCNCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  c24.fa
18439218  GAGATCRTACTARCCGAAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  col-0.fa
18439218  GNNNNNGNNNNNRNNGANARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  cvi-0.fa
18439218  GAGNNNGNNCNNRCCGAAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  est-1.fa
18439218  NNNNNNGNNNNNRNNNNAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  fei-0.fa
18439218  GANNTNGNNCTARCCGAAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  got-7.fa
18439218  GNNNNNGNNNNNRCCNAAARNCNCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  ler-1.fa
18439218  GANNNNGNNNNNRCCGAAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  lov-5.fa
18439218  GAGATCRTACTARCCGAAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  nfa-8.fa
18439218  GANNNNGNNCNARNNGAAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  rrs-10.fa
18439218  GAGANNGNNCNARCCGAAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  rrs-7.fa
18439218  GANNNNGNNNNNRNNNAAARNNNCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  sha.fa
18439218  GAGNNNGNNNNNRCCGAAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCNNT  tamm-2.fa
18439218  NNNNNNGNNNNNRNNNNAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  ts-1.fa
18439218  GAGATCRTACTARCCGAAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  tsu-1.fa
18439218  GAGNNNGNNCNARCCGAAARTCTCCCTAGTCTCAAGTCCTTTCGCTCTCTCGTCGTATCCAAAGAGCTCAACAAAGCGCG  van-0.fa
 
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  chr4.fa
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  bay-0.fa
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  bor-4.fa
18439298  ATATCGCCTCAACAACCGAANNNNACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  br-0.fa
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  bur-0.fa
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  c24.fa
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  col-0.fa
18439298  ATATCGCCTCAACAACCGAAGAANACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  cvi-0.fa
18439298  ANATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  est-1.fa
18439298  ATATCGCCTCAACAACCGAANNNNNCTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  fei-0.fa
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  got-7.fa
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  ler-1.fa
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  lov-5.fa
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  nfa-8.fa
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  rrs-10.fa
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  rrs-7.fa
18439298  ATATCGCCTCAACAACCGAAGAANNNNTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  sha.fa
18439298  NNNNCGCCTCAACAACCGAAGAANACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  tamm-2.fa
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  ts-1.fa
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  tsu-1.fa
18439298  ATATCGCCTCAACAACCGAAGAATACTTCTTCCACGTCTGCTTACAGCTTCCTAAGAGTCCTCTTCCAACCTGGTACACG  van-0.fa
 
18439378  CTCTGGATAAAACCTGATCAGATCGAGAAGAAGAAGAAGATTAATACGTTTACTGGAAATACTCGGTTGGTACAAATACC  chr4.fa
18439378  CTCTGGATAAAACCTGATCAGATCGANNNRANNANNNNNNNNNNNACGTTTACTGGAAATACTCGGTRRRRRRRAATACC  bay-0.fa
18439378  CTCTGGATAAAACCTGATCAGATCGAGNNRANNNNNNNNNNNNNNACGTTTACTGGAAATACTCGGTRRRRRRRAATACC  bor-4.fa
18439378  CTCTGGATAAAACCTGATCAGATCGANNNRNNNAANNNNNNNNNNNNNNNNNCTGGAAATACTCGGTRRRRRRRAATACC  br-0.fa
18439378  CTCTGGATAAAACCTGATCAGATCGANNNRNNNNNNNNNNNNAATACGTTTACTGGAAATACTCGGTRRRRRRRAATACC  bur-0.fa
18439378  CTCTGGATAAAACCTNATCAGATCGAGNNRNNNNNNNNNNNNNNNNNGNTTACTGGAAATACTCGGTRRRRRRRAATACC  c24.fa
18439378  CTCTGGATAAAACCTGATCAGATCGANNNRNNNAAGNNNNNNNNNACGTTTACTGGAAATACTCGGTRRRRRRRAATACC  col-0.fa
18439378  CTCTGGATAAAACCTGATCAGATCNNNANRNNNAANNNNNNNNNNNNNNNNNNTGGAAATACTCGGTRRRRRRRAATACC  cvi-0.fa
18439378  CTCTGGATAAAACCTGATCAGATCGANNNRNNNNNNNNNNNNNNNACGTTTACTGGAAATACTCGGTRRRRRRRAATACC  est-1.fa
18439378  CTCTGGATAAAACCTGATCAGATCGANNNRNNNANNNNNNNNNNNNNNTTTACTGGAAATACTCGGTRRRRRRRAATACC  fei-0.fa
18439378  CTCTGGATAAAACCTGATCAGATCGAGNNRNNNAAGAANNNNNNNNCGNTTACTGGAAATACTCGGTRRRRRRRAATACC  got-7.fa
18439378  CTCTGGATAAAACCTGATCAGATCGANNNRNNNNNNNNNNNNNNNACGTTTACTGGAAATACTCGGTRRRRRRRAATACC  ler-1.fa
18439378  CTCTGGATAAAACCTGATCAGATCGANNNRNNNNNNNNNNNNNNNACGTTTACTGGAAATACTCGGTRRRRRRRAANACC  lov-5.fa
18439378  CTCTGGATAAAACCTGATCAGATCGANNNRNNNNNNNNNNNNNNNACNNNNNNTGGAAATACTCGGTRRRRRRRAATACC  nfa-8.fa
18439378  CTCTGGATAAAACCTGATCAGATCGANANRNNNNNGNNNNNNNNNACGTTTACTGGAAATACTCGGTRRRRRRRAATACC  rrs-10.fa
18439378  CTCTGGATAAAACCTGATCAGATCGAGNNRNNNANNNNNNNNNNTACGTTTACTGGAAATACTCGGTRRRRRRRAATACC  rrs-7.fa
18439378  CTCTGGATAAAACCTGATCAGATCNNNNNRNNNNNNNNNNNNNNNNNNNNNNCTGGAAATACTCGGTRRRRRRRANNACC  sha.fa
18439378  CTCTGGATAAAACCTGATCAGATCGANNNRNNNNNNNNNNNNNNTACGTTTACTGGAAATACTCGGTRRRRRRRAATACC  tamm-2.fa
18439378  CTCTGGATAAAACCTGATCAGATCGANNNRNNNAAGNNNNNNNNNACGTTNACTGGAAATACTCGGTRRRRRRRAATACC  ts-1.fa
18439378  CTCTGGATAAAACCTGATCAGATCGAGANRNNNNNNNNNNNNNNNACGTTTACTGGAAATACTCGGTRRRRRRRAATACC  tsu-1.fa
18439378  CTCTGGATAAAACCTGATCAGATCGANANRNNNNNNANNNNNNNNACGTTTACTGGAAATACTCGGTRRRRRRRAATACC  van-0.fa
 
18439458  ATCTTCCTATCATTATCCTTTTGACCAAGTGTTCATCTTTAATCTTTATGGTGCTATGCGTTCATCCAAGGCAATGGTCC  chr4.fa
18439458  ATCTTCCTATCATTATCCTTTTGACCAAGTGTTCATCTTTNATCTTTATGGTGCTATGCGTTCATCCAAGGCAATGGTCC  bay-0.fa
18439458  ATCTTCCTATCATTATCCTTTTGACCAAGTGTTCATCTTTAATCTTTATGGTGCTATGCGTTCATCCAAGGCAATGATCC  bor-4.fa
18439458  ATCTNNNNNNNNNNNNCCTTTTGACCAAGTGTTCANNNNNNNNCTTTATGGTGCTATGCGTTCATCCAAGGCAATGGTCC  br-0.fa
18439458  ATCTTCCTATNATTATCCTTTTGACCAAGTGTTCATCTTTAATCTTTATGGTGCTATGCGTTCATCCAAGGNNNNNANNN  bur-0.fa
18439458  ATCTTCCTATCNNNNNCCTTTTGACCAAGTGTTCATCNNNNNNNTTTATGGTGCTATGCGTTCATCCAAGGCAATGGTCC  c24.fa
18439458  ATCTTCCTATCATTATCCTTTTGACCAAGTGTTCATCTTTAATCTTTATGGTGCTATGCGTTCATCCAAGGCAATGGTCC  col-0.fa
18439458  ATCTTCNNNNNNNNNNNCTTTTGACCAAGTGTNCNNNNNNNNNNTTTATGGTGCTATGCGTTCATCCAAGGCAANNCNNN  cvi-0.fa
18439458  ATCTTCCTATCNTTATCCTTTTGACCAAGTGTTCATCTTNAATCTTTATGGTGCTATGCGTTCATCCAAGGCAANNANNN  est-1.fa
18439458  ATCTTCCNNNNNNNNTCCTTTTGACCAAGTGTTCATCNNNNNNCTTTATGGTGCTATGCGTTCATCCAAGGCAATGGTCC  fei-0.fa
18439458  ATCTTCCNATCATTATCCTTTTGACCAAGTGTTCATCNTTAATCTTTATGGTGCTATGCGTTCATCCAAGGCAATGATCC  got-7.fa
18439458  ATCTTCCTATCATTATCCTTTNNNNNTNNNNNNNNNNTTTAATCTTTATGGTGCTATGCGTTCATCCAAGGCAATGGTCC  ler-1.fa
18439458  ATCTTCCTATCATTATCCTTTTGACCAAGTGTTCATCTTTAATCTTTATGGTGCTATGCGTTCATCCAAGGCAATGATCC  lov-5.fa
18439458  ATCTTNNNNNNATTATCCTTTTGACCAAGTGTTCANNNNNNNTCTTTATGGTGCTATGCGGTCATCCAAGGCAATGGTCC  nfa-8.fa
18439458  ATCTTCCTATCATTATCCTTTTGACCAAGTGTTCATCTTTAATCTTTATGGTGCTATGCGTTCATCCAAGGCAANNANNN  rrs-10.fa
18439458  ATCTTCCTATCATTATCCTTTTGACCAAGTGTTCATCTTTAATCTTTATGGTGCTATGCGTTCATCCAAGGCAATGGTCC  rrs-7.fa
18439458  ATCTNNNNNNNNNNNNNCTTTTGACCAAGTGTTCATNNNNNNNNNNTATGGTGCTATGCGTTCATCCAAGGCAATGGTCC  sha.fa
18439458  ATCTTCNTATCATTANCCTTTTGACCAAGTGTTCATNNNNAATCTTTATGGTGCTATGCGTTCATCCAAGGCAATGATCC  tamm-2.fa
18439458  ATCTTCCTATNNNNNNCCTTTTGACCAAGTGTTCATNNNNNNNCTTTATGGTGCTATGCGTTCATCCAAGGCAATGGTCC  ts-1.fa
18439458  ATCTTCCTNNNNNNNTCCTTTTGACCAAGTGTTCATCTTTNATCTTTATGGTGCTATGCGGTCATCCAAGGCAATGGTCC  tsu-1.fa
18439458  ATCTTCCTATCATTNTCCTTTTGACCAAGTGTTCATCTTNAATCTTTATGGTGCTATGCGTTCATCCAAGGCAANNANNN  van-0.fa
 
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   chr4.fa
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   bay-0.fa
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   bor-4.fa
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   br-0.fa
18439538  NTCCCCNNNNNNNTGGGTTGGTAAGCATGTTTTGAATAGAA   bur-0.fa
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATNGAA   c24.fa
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   col-0.fa
18439538  NTCCCNNTTCANNNNNNTTGGTAAGCATGTTTTGAATAGAA   cvi-0.fa
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   est-1.fa
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   fei-0.fa
18439538  GTCCCCNTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   got-7.fa
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   ler-1.fa
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   lov-5.fa
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   nfa-8.fa
18439538  NTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   rrs-10.fa
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   rrs-7.fa
18439538  GTCCCCCTTCATNTGGGTTGGTAAGCATGTTTTGAATNGAA   sha.fa
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   tamm-2.fa
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   ts-1.fa
18439538  GTCCCCCTTCATATGGGTTGGTAAGCATGTTTTGAATAGAA   tsu-1.fa
18439538  GTCCCCCTTCATATGGGTTGGTNAGCATGTTTTGAATAGAA   van-0.fa
 
visited.