Arabidopsis SNP Sequence Viewer

Chromosome : chr4 Coordinates : 18440125 - 18441297


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTGCGGCTACGACTTCCAAAGGCGAACCACCGTCGAAAAAGAGGAAAACGAATCC  chr4.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTGCGGCTACGACTTCCAAAGGCGAACCACCGTCGAAAAAGAGGAAAACGAATCC  bay-0.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTGCGGCTACGACTTCCAANGGCGAACCACCGTCGAAAAAGAGGAAAACGAATCC  bor-4.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTNCGGCTACGACTTCCAAAGGCGAACCACCGTCGAAAAAGAGGAAAACGAATCC  br-0.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTNCGGCTACGACTTCCAAAGGCGAACCACCGTCGAAAAAGAGGAAAACGAATCC  bur-0.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTNTGCGGCTACGACTTCCAANGGCGAACCACCGTCGAAAAAGAGGAAAACGAATCC  c24.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTGCGGCTACGACTTCCAANGGCGAACCACCGTCGAAAAAGAGGAAAACGAATCC  col-0.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTGCGGCTACGACTTCCAAAGGCGAACCACCGTCGAAAAAGAGGAAAACGAANNN  cvi-0.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTGCGGCTACGACTTCCAANGGCGAACCACCGTCGAAAANGAGGAAAACGAATCC  est-1.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTGCGGCTACGACTTCCAANGGCGAACCACCGTCGAAAANGAGGAAAACGAATCC  fei-0.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTGCGGCTACGACTTCCAAAGGCGAACCACCGTCGAAAAAGAGGAAAACGAATCC  got-7.fa
18440125  ACTTTTTGGGCAGAAACNNNTNNNNNTGCGGCTACGACTTCCAAAGGCGAACCACCGTCGAAAAAGAGGAAAACGAATCC  ler-1.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCNGCGGCTACGACTTCCAAAGGCGAACCACCGTCGAAAANGAGGAAAACGAATCC  lov-5.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTGCGGCTACGACTTCCAAAGGCGAACCACCGTCGAAAANGAGGAAAACGAATCC  nfa-8.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTGCGGCTACGACTTCCAAAGGCGAACCACCGTCGAAAAAGAGGAAAACGAATCC  rrs-10.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTGCGGCTACGACTTCCAANGGCGAACCACCGTCGAAAAAGAGGAAAACGAATCC  rrs-7.fa
18440125  ACTTTTTGGGCAGAAACCGCCGNNNNNNNNNNTACGACTTCCAAAGGCGAACCACCGTCGAAAAAGAGGAAAACGAANNN  sha.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTNCGGCTACGACTTCCAANGGCGAACCACCGTCGAAAAAGAGGAAAACGAATNC  tamm-2.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTGCGGCTACGACTTCCAANGGCGAACCACCGTCGAAAAAGAGGAAAACGAANCC  ts-1.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTGCGGCTACGACTTCCAANGGCGAACCACCGTCGAAAAAGAGGAAAACGAATCC  tsu-1.fa
18440125  ACTTTTTGGGCAGAAACCGCCGCCTCTGCGGCTACGACTTCCAANGGCGAACCACCGTCGAAAANGAGGAAAACGAATCC  van-0.fa
 
18440205  ATCTCCTCCTCCGTCGCTTTTGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGTATACCGAAATCGTATTACC  chr4.fa
18440205  ATCTCCNNNNCCGTCGCTTTTGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  bay-0.fa
18440205  ATCTNNNNNNNNNNNNTTTTTGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  bor-4.fa
18440205  ATCTCCNNNNCCGTCGCTTTTGTCACTCCCAGATNTTCTCNNNNNNNNCTGTTTATCCCGRANACCGAAATCGTARTANC  br-0.fa
18440205  ATCTNNNNNNNNNNNNTNNNTGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  bur-0.fa
18440205  ATCTNNNNNNNNNNNNTNNNNNTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  c24.fa
18440205  ATCTCCNCCNCCGTCGCTTTTGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  col-0.fa
18440205  NNCNNNNNNNNNNNNNTNNNNNNNANTCNCANATGTTCTCATNNNNNNNNNTTTATCCCGRATACCGAAATCGTARTNCC  cvi-0.fa
18440205  ATCTNNNNNNNNNNNNTNNNNGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  est-1.fa
18440205  ATCTNNNNNNNNNNNNTNNTTGTCACTCCCAGATGTTCTCATNNNNNNCTGTTTATCCCGRATACCGAAATCGTARTACC  fei-0.fa
18440205  ATCTCCNNNNNNNNNNTTTTTGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  got-7.fa
18440205  ATCTCCTCCNCCGTCGCTTTTGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  ler-1.fa
18440205  ATCTNNNNNNNCGNCNTTTTTGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  lov-5.fa
18440205  NNNNNNNNNNCCGTCGCTTTTGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  nfa-8.fa
18440205  ATCTNNNNNNNNNNNNTTTTTGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  rrs-10.fa
18440205  ATCTNNNNNNNNNNNNTTTTTGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  rrs-7.fa
18440205  NNCNNNNNNNNNNNNNTTNTTGTCACTCCCAGATGTTCTCANNNNNNNCTGTTTATCCCNRNNACCGAAATCGTARNNNC  sha.fa
18440205  ATCTNNNNNNNNNNNGTTTTTGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  tamm-2.fa
18440205  ATCTNNNNNNNNNNNNTTTTTGTCACTCCCAGATGTTCTCATTCTANACTGTTTATCCCGRATACCGAAATCGTARTACC  ts-1.fa
18440205  ATCTCCNNNNCCGTCGCTTTTGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  tsu-1.fa
18440205  ATCTNNNNNNNNNNNNTTTTTGTCACTCCCAGATGTTCTCATTCTAAACTGTTTATCCCGRATACCGAAATCGTARTACC  van-0.fa
 
18440285  CTAAACTCTCCATAGTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  chr4.fa
18440285  CTAAACTCTCCRTAGTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  bay-0.fa
18440285  CNAAACTCTCCRTNGTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  bor-4.fa
18440285  CNAAACTCNNCRNNNTCTCCAAAACATTTCGTGATCTCATCATNTNNANTGATCTTAACCACGCTCGATTTCACCACAAA  br-0.fa
18440285  CTAAACTCTCCRTNNTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  bur-0.fa
18440285  CTAAACTCNCCRNNNTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  c24.fa
18440285  CTAAACTCTCCRNNGTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAN  col-0.fa
18440285  CNAAACTCNCCRTNNTNTCCAAAACATTTCGTGATCTCATCANNNNNATTGATCTTAACCACGCTCGATTTCACCACANN  cvi-0.fa
18440285  CNAAACTCTCCRTNGTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  est-1.fa
18440285  CTAAACTCNNNRNNNNCTCCAAAACATTTCGTGATCTCATCATNTCCATTGATCTTAACCACGCTCGATTTCACCACAAA  fei-0.fa
18440285  CTAAACTCTCCRTNGTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  got-7.fa
18440285  CTAAACTCNCCRNNNTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  ler-1.fa
18440285  CTAAACTCTCCRTNGTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  lov-5.fa
18440285  CNAAACTCTCCRTNGTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  nfa-8.fa
18440285  CTAAACTCTCCRTNGTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  rrs-10.fa
18440285  CTAAACTCTCCRTNGTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  rrs-7.fa
18440285  CTAAACTCNNNRNNNNCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAN  sha.fa
18440285  CTAAACTCNNCRNNNTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAN  tamm-2.fa
18440285  CTAAACTCNCCRNNGTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  ts-1.fa
18440285  CTAAACTCTCCRTNGTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  tsu-1.fa
18440285  CTAAACTCTCCRTNGTCTCCAAAACATTTCGTGATCTCATCATATCCATTGATCTTAACCACGCTCGATTTCACCACAAA  van-0.fa
 
18440365  ACACAAGAACACTTTTTTCATGTCTGCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  chr4.fa
18440365  ACANNNNNNCACTTTTTTCATGRCRRCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  bay-0.fa
18440365  NCNNNNNNNCACTTTTTTCATGRNRRCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  bor-4.fa
18440365  ANNNNNNNNNNNNTTTTTCNNNRNRRNTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  br-0.fa
18440365  ACACAAGAACACTTTTTTCATGRNRRCNTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  bur-0.fa
18440365  NCNNNNNNNNNNNTTTTTCNNNRNRRNTNAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  c24.fa
18440365  NNNNNNNAACACTTTTTTCATGRCRRCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  col-0.fa
18440365  NNNNNNNNNNNNTTTTTTCNNNRNRRNTNAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  cvi-0.fa
18440365  ACACANNNNNACTTTTTTCATGRNRRCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  est-1.fa
18440365  ANNNNNNNNNACTTTTTTCNNNRNRRCTNAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  fei-0.fa
18440365  ACANNNNNNCACTTTTTTCATGRCRRCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  got-7.fa
18440365  ACNNNNNNNCACTTTTTTCATGRNRRCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  ler-1.fa
18440365  ACACANGAACACTTTTTTCATGRCRRCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  lov-5.fa
18440365  NCNNNNNNNNACTTTTTTCNTGRCRRCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  nfa-8.fa
18440365  ACACAANAACACTTTTTTCATGRCRRCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  rrs-10.fa
18440365  ACACAANAANACNTTTTTCATGRCRRCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  rrs-7.fa
18440365  NNNNNNNNNNNNNTTTTTNNNNRNRRNTNAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  sha.fa
18440365  NNNNNNNNNNACTTTTTTCANNRNRRCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  tamm-2.fa
18440365  ACNNNNNNNCACTTTTTTCATGRCRRCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  ts-1.fa
18440365  NNNNNNNNNNACTTTTTTCATGRCRRCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  tsu-1.fa
18440365  NCNNANGAACACNTTTTTCATGRCRRCTTAAAGCTTCCCGATCGTCCTCTTCCCTCGTGGTACACACTCTGGATCAAACC  van-0.fa
 
18440445  CCAAGGATTCGATGACAAGGAGGAGGAGAAGAAGAAGAAGAAGAAGTCTACCTTGGTACAAGTACCTTCTTCCTATGCTT  chr4.fa
18440445  CCAAGGATTCGATGACAAGNNNNNNNRRRRRRRRRRRRRRNNNAAGTCTACCTTGGTACAAGTACCTTCTTCCTATGCTT  bay-0.fa
18440445  CCAAGGATTCGATGACAAGGANNNNNRRRRRRRRRRRRRRNNNNNGTCTACCTTGGTACAAGTACCTTCTTCCTATGCTT  bor-4.fa
18440445  CCAAGGATTCGATGACAAGNNNNNNNRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNGTNCCTTCTTCCTNTGCTT  br-0.fa
18440445  CCAAGGATTCGATGACNNNNNNNNNNRRRRRRRRRRRRRRNNNNAGTCTACCTTGNTACAAGTACCTTCTTCCTATGCTT  bur-0.fa
18440445  CCAAGGATTCGATGACAAGNNNNNNNRRRRRRRRRRRRRRNNNNNNTCTACCTTGNTACAAGNACCTTCTTCCTATGCTT  c24.fa
18440445  CCAAGGATTCGATGACAAGNNNNNNNRRRRRRRRRRRRRRNNNAAGTCTACCTTGGTACAAGTACCTTCTTCCTATGCTT  col-0.fa
18440445  CCAAGGATTCGATGACAANNNNNNNNRRRRRRRRRRRRRRNNNNNNNNTACCTTGGNACNAGNACCTTCTTCCTATGCTT  cvi-0.fa
18440445  CCAAGGATTCGATGACAANNNNNNNNRRRRRRRRRRRRRRNNNAAGTCTACCTTGGTACAAGTACCTTCTTCCTATGCTT  est-1.fa
18440445  CCAAGGATTCGATGACAANNNNNNNNRRRRRRRRRRRRRRNNNNNNTCTACCTTGGTNCANNNNNNNTCTTCCTNTGCTT  fei-0.fa
18440445  CCAAGGATTCGATGACAAGNNNNNNNRRRRRRRRRRRRRRNNNAAGTCTACCTTGGTACAAGNACCTTCTTCCTATGCTT  got-7.fa
18440445  CCAAGGATTCGATGACAANNNNNNNNRRRRRRRRRRRRRRNNNNAGTCTACCTTGGTACAAGTACCTTCTTCCTATGCTT  ler-1.fa
18440445  CCAAGGATTCGATGACAAGNNNNNNNRRRRRRRRRRRRRRNNNNAGTCTACCTTGGNACNAGNACCTTCTTCCTATGCTT  lov-5.fa
18440445  CCAAGGATTCGATGACAANNNNNNNNRRRRRRRRRRRRRRNNNNNGTCTACCTTGGNACNAGNACCTTCTTCCTATGCTT  nfa-8.fa
18440445  CCAAGGATTCGATGACAAGGANNNNNRRRRRRRRRRRRRRNNNNAGTCTACCTTGGTACAAGTACCTTCTTCCTATGCTT  rrs-10.fa
18440445  CCAAGGATTCGATGACAAGGANNNNNRRRRRRRRRRRRRRNNNAAGTCTACCTTGGTACAAGTACCTTCTTCCTATGCTT  rrs-7.fa
18440445  CCAAGGATTCGATGACANNNNNNNNNRRRRRRRRRRRRRRNNNNNNNNTANNNNNNNNNNNNNNNNTTCTTCCTATGCTT  sha.fa
18440445  CCAAGGATTCGATGACAANNNNNNNNRRRRRRRRRRRRRRNNNNAGTCTACCTTGGTACAAGTACCTTCTTCCTATGCTT  tamm-2.fa
18440445  CCAAGGATTCGATGACAAGGNNNNNNRRRRRRRRRRRRRRNNNAAGTCTACCTTGGTACAAGNACCTTCTTCCTATGCTT  ts-1.fa
18440445  CCAAGGATTCGATGACAAGNNNNNNNRRRRRRRRRRRRRRNNNAAGTCTACCTTGGTACAAGTACCTTCTTCCTATGCTT  tsu-1.fa
18440445  CCAAGGATTCGATGACAAGGNNNNNNRRRRRRRRRRRRRRNNNAAGTCTACCTTGGTACAAGTACCTTCTTCCTATGCTT  van-0.fa
 
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  chr4.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  bay-0.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  bor-4.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  br-0.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATNCTCCCTCTCGGGTCATG  bur-0.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTANGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  c24.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  col-0.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  cvi-0.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  est-1.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  fei-0.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  got-7.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  ler-1.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  lov-5.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  nfa-8.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  rrs-10.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  rrs-7.fa
18440525  CTCAAACACCATTGGTNNTNGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  sha.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGNTATCCTCCCTCTCGGGTCATG  tamm-2.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  ts-1.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  tsu-1.fa
18440525  CTCAAACACCATTGCTCGTAGTAGGTATTGATTCAGATGTCTATGCATTCAAACAATGTTATCCTCCCTCTCGGGTCATG  van-0.fa
 
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  chr4.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  bay-0.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  bor-4.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  br-0.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  bur-0.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  c24.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  col-0.fa
18440605  NNNNNCNNNAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  cvi-0.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  est-1.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  fei-0.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  got-7.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  ler-1.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  lov-5.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  nfa-8.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  rrs-10.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  rrs-7.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  sha.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  tamm-2.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  ts-1.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  tsu-1.fa
18440605  TTTGTTCGTAACAAGGAGTGTGTCATATGGCGTAATGCCCCCGACATGACTGTGGCTAGAGCTAATCCTGTTGCCTACGT  van-0.fa
 
18440685  CTTCGATAGGAAAATATATGTTATGGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGGTGAGGTTTTTGATCCAAAGA  chr4.fa
18440685  CTTCGATAGGAAANNNNNNGRRNTGGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGNTGNNRRRRRRRRRRRRRRRR  bay-0.fa
18440685  CTTCGATAGGAAAATANNNNRRNTGGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGGTGNGRRRRRRRRRRRRRRRR  bor-4.fa
18440685  CTTCGATAGGANNNNNNNNNRRNTGGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGGTGNNRRRRRRRRRRRRRRRR  br-0.fa
18440685  CTTCGATAGGAAAANNNNNGRRNTGGGAGGTTGTGCGGAAACCGAATCCGCANATTGGGGTNNNRRRRRRRRRRRRRRRR  bur-0.fa
18440685  CTTCGATAGGNNNNNNNNNNRRNTGGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGNNGNGRRRRRRRRRRRRRRRR  c24.fa
18440685  CTTCGATAGGAAANNNNNTNRRNNGGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGNTGNNRRRRRRRRRRRRRRRR  col-0.fa
18440685  CTTCGATANNNNNNNNNNNNRRNNNGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGNTGNNRRRRRRRRRRRRRRRR  cvi-0.fa
18440685  CTTCGATAGGANNNNNNNNNRRNTGGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGNTGNGRRRRRRRRRRRRRRRR  est-1.fa
18440685  CTTCGATAGGNNNNNNNNNNRRNTNGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGNTNNNRRRRRRRRRRRRRRRR  fei-0.fa
18440685  CTTCGATAGGAANNNNNNNGRRNTGGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGNTGNGRRRRRRRRRRRRRRRR  got-7.fa
18440685  CTTCGATAGGAANNNNNNNNRRNNGGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGGTGNNRRRRRRRRRRRRRRRR  ler-1.fa
18440685  CTTCGATAGGAANNNNNNNNRRNTNGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGGTGNNRRRRRRRRRRRRRRRR  lov-5.fa
18440685  CTTCGATAGGNNNNNNNNNNRRNTGGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGGTGNGRRRRRRRRRRRRRRRR  nfa-8.fa
18440685  CTTCGATAGGAAANNNNNNNRRNTNGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGNTGNGRRRRRRRRRRRRRRRR  rrs-10.fa
18440685  CTTCGATAGGAANNNNNNNNRRNNNGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGNTGNGRRRRRRRRRRRRRRRR  rrs-7.fa
18440685  CTTCGATAGGANNNNNNNNNRRNNNGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGNNNNNNRRRRRRRRRRRRRRRR  sha.fa
18440685  CTTCGATAGGNNNNNNNNNNRRNTNGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGNNNNNRRRRRRRRRRRRRRRR  tamm-2.fa
18440685  CTTCGATAGGNNNNNNNNNNRRNTGGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGGTGNGRRRRRRRRRRRRRRRR  ts-1.fa
18440685  CTTCGATAGGANNNNNNNNNRRNNNGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGNNGNGRRRRRRRRRRRRRRRR  tsu-1.fa
18440685  CTTCGATAGGAANNNNNNNGRRATGGGAGGTTGTGCGGAAACCGAATCCGCAAATTGGGGTGNGRRRRRRRRRRRRRRRR  van-0.fa
 
18440765  CTCAAACTTGGGAACCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCAATGATTAGAAAAATAGAGATGATCCAA  chr4.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCAATNNNNNNNANAANAGAGATGATCCAA  bay-0.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCAATGATNAGAAAAANAGAGATGANCCAA  bor-4.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCAANNNNNNNNNNNNNNNNNNNNNNCCAA  br-0.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCNTTCCCCTNNNNTCCGCTTCTCTTCAATGATTAGAAAAATAGAGATGATCCAA  bur-0.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCANNNNNNNNNNNNNNNNNGANGANCCAA  c24.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCAATGATTAGAAAAANAGAGATGANCCAA  col-0.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAA  cvi-0.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCANNNNNNNNNNNAANAGAGATGANCCAA  est-1.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCNNNNNNNNNNNNNNNNGNGNNNNNNNAA  fei-0.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCAATGATTAGAAAAANAGAGATGANCCAA  got-7.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCAATGATNNNNNNAANAGAGATGANCCAA  ler-1.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCAATGATTAGAAAAATAGAGATGANCCAA  lov-5.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCAATNNNNNNNNNNNNAGAGATGANCCAA  nfa-8.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCAATNANNANAAAAATAGAGATGANCCAA  rrs-10.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCAANNNNNNNAAAAANAGAGATGANCCAA  rrs-7.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTNCCCTGAGCTNCGCTTCTCTTCNNNNNNNNNNNNNNNNNNNNNNNNNCAA  sha.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCNGCTTCTCTTCANNNNNNNNNNNNNNAGAGATGATCCAA  tamm-2.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCAANNNNNNNNNNNNNNNNGATGANCCAA  ts-1.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCAATGNNNNNNNNNANAGAGATGANCCAA  tsu-1.fa
18440765  RRRRRRRRRRRRAARCTTTACCTGTCCCTTCCCCTGAGCTCCGCTTCTCTTCAATGANNNNNNNNNNNNAGATGANCCAA  van-0.fa
 
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  chr4.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  bay-0.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  bor-4.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAANNNNNAAATGGAACGTTGCAGCGAA  br-0.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  bur-0.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  c24.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  col-0.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGNGAAATGGAACGTTGCAGCGAA  cvi-0.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  est-1.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  fei-0.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  got-7.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  ler-1.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  lov-5.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  nfa-8.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  rrs-10.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  rrs-7.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGANAAATGGAACGTTGCAGCGAA  sha.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  tamm-2.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  ts-1.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  tsu-1.fa
18440845  GGAAAGTTTTACGTGAGGAGCAATGACAGCAAGGACTCTGTTTATGATCCGATAAGAGAGAAATGGAACGTTGCAGCGAA  van-0.fa
 
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  chr4.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  bay-0.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  bor-4.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  br-0.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  bur-0.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  c24.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  col-0.fa
18440925  ACCGCAGTTGAANNNNNNNNCNNNNNNNNNNNNTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  cvi-0.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  est-1.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  fei-0.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  got-7.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  ler-1.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  lov-5.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  nfa-8.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  rrs-10.fa
18440925  ACCGCAGTTGAATGATNGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  rrs-7.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  sha.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  tamm-2.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  ts-1.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  tsu-1.fa
18440925  ACCGCAGTTGAATGATAGTAGGTGTTCGGTAGGTAATGTTTGGTACTCTTGTCGTCCCAACAGTTTCTTGTGGTTTGACA  van-0.fa
 
18441005  ATGAAATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  chr4.fa
18441005  ATGAAATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  bay-0.fa
18441005  ATGAAATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  bor-4.fa
18441005  ATGANNNNNNAAATTGGAGACNGATCAAGGGTTTGTCNTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  br-0.fa
18441005  ATGAAATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  bur-0.fa
18441005  ATGAAATTAAAANTTGGAGACTGATCAAGGGTTTGTCNTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  c24.fa
18441005  ATGAAATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTNGTGGTTTGATTGAAACAGTT  col-0.fa
18441005  ANNNNNNNNNNAATTGGANACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGNAACAGTT  cvi-0.fa
18441005  ATGAAATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  est-1.fa
18441005  ATNAAATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  fei-0.fa
18441005  ATGAAATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  got-7.fa
18441005  ATGAAATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  ler-1.fa
18441005  ATGAAATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  lov-5.fa
18441005  ATGANATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  nfa-8.fa
18441005  ATGAAATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  rrs-10.fa
18441005  ATGAAANTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  rrs-7.fa
18441005  ATNANNTNAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  sha.fa
18441005  ATGAAATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGANACAGTT  tamm-2.fa
18441005  ATGAAANTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  ts-1.fa
18441005  ATGAAATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  tsu-1.fa
18441005  ATGAAATTAAAAATTGGAGACTGATCAAGGGTTTGTCTTCGTTGAATCATAGTTGTCGTAGTGGTTTGATTGAAACAGTT  van-0.fa
 
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCTACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  chr4.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCTACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  bay-0.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCTACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  bor-4.fa
18441085  TGCTACGATGGGAATCTCTTACTNTTGTGGGACAAGCCTACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGNATATTTG  br-0.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCTACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  bur-0.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCNACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  c24.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCTACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  col-0.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCNACCAAGCCTCGCCGTCGTGTTTGTGAAGNCANGTNTATTTG  cvi-0.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCNACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  est-1.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCTACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  fei-0.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCNACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  got-7.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCTACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  ler-1.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCNACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  lov-5.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCNACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  nfa-8.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCTACCAAGCCTCGCCGTCGTGTTTGTGAAGNCAAGTATATTTG  rrs-10.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCNACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  rrs-7.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCTACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  sha.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCNACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  tamm-2.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCNACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  ts-1.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCTACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  tsu-1.fa
18441085  TGCTACGATGGGAATCTCTTACTATTGTGGGACAAGCCTACCAAGCCTCGCCGTCGTGTTTGTGAAGACAAGTATATTTG  van-0.fa
 
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGGGGTAAGGTTGAGTGGTCTAATGTTGTGCTTACGG  chr4.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNGRAAGGTTGAGTGGRNNRRRRRRRRRRRRRRRR  bay-0.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNNRANGGTTGAGTGGRNNRRRRRRRRRRRRRRRR  bor-4.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCANGTTTGNNNRAANGTNGAGTGNRNNRRRRRRRRRRRRRRRR  br-0.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNGRNNGGTTGAGTGGRNNRRRRRRRRRRRRRRRR  bur-0.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNNRNAGGTTGAGTGNRNNRRRRRRRRRRRRRRRR  c24.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNNRAANGTTGAGTGGRNNRRRRRRRRRRRRRRRR  col-0.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAANNNNNNNNRNNGGTNGAGNGGRNNRRRRRRRRRRRRRRRR  cvi-0.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNNRAAGGTNGAGTGGRNNRRRRRRRRRRRRRRRR  est-1.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTNNNNRAANGTTGAGNNNRNNRRRRRRRRRRRRRRRR  fei-0.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNNRAAGGTNGAGTGGRNNRRRRRRRRRRRRRRRR  got-7.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNNRNAGGTTGAGTGGRNNRRRRRRRRRRRRRRRR  ler-1.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNNRNAGGTTGAGTGGRNNRRRRRRRRRRRRRRRR  lov-5.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNGRANGGTNGAGTGGRNNRRRRRRRRRRRRRRRR  nfa-8.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNGRAAGGTTGAGTGGRNNRRRRRRRRRRRRRRRR  rrs-10.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNGRNAGGTNGAGTGGRNNRRRRRRRRRRRRRRRR  rrs-7.fa
18441165  CTGNGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNNRNNNGTTGAGNNNRNNRRRRRRRRRRRRRRRR  sha.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNNRNAGGTTGAGTNNRNNRRRRRRRRRRRRRRRR  tamm-2.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNGRANGGTTGAGTGGRNNRRRRRRRRRRRRRRRR  ts-1.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNNRANGGTTGAGTGGRNNRRRRRRRRRRRRRRRR  tsu-1.fa
18441165  CTGTGCGTTGATTTCGTTTAATAAGCGCAAAAATGGTCAAGTTTGNNGRAAGGTTGAGTGGRNNRRRRRRRRRRRRRRRR  van-0.fa
 
18441245  TTCCCAGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   chr4.fa
18441245  RRCCCAGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   bay-0.fa
18441245  RRCCCNGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   bor-4.fa
18441245  RRCCCNGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACN   br-0.fa
18441245  RRCCCAGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   bur-0.fa
18441245  RRCCCNGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   c24.fa
18441245  RRCCCAGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   col-0.fa
18441245  RRCCCAGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAANN   cvi-0.fa
18441245  RRCCCNGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   est-1.fa
18441245  RRCCCAGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   fei-0.fa
18441245  RRCCCAGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   got-7.fa
18441245  RRCCCAGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   ler-1.fa
18441245  RRCCCAGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   lov-5.fa
18441245  RRCCCNGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   nfa-8.fa
18441245  RRCCCAGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   rrs-10.fa
18441245  RRCCCAGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   rrs-7.fa
18441245  RRNCNAGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACN   sha.fa
18441245  RRNCCAGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   tamm-2.fa
18441245  RRCCCAGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   ts-1.fa
18441245  RRCCCNGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   tsu-1.fa
18441245  RRCCCNGTTCATACCGTTTCTTGCGTTCTACAGTGATACGGACTTGATCAACA   van-0.fa
 
visited.