Arabidopsis SNP Sequence Viewer

Chromosome : chr5 Coordinates : 3633971 - 3636418


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
3633971  GATGGAAACAGAAACGGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  chr5.fa
3633971  NNNNNAANNNNNNACGGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  bay-0.fa
3633971  GATGGAANNNNANNCNGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  bor-4.fa
3633971  NNNNNAAACNGAAACGGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  br-0.fa
3633971  GATGGANNNNNANACNGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  bur-0.fa
3633971  GATGGANNNNNAAACGGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  c24.fa
3633971  NNNNNAANNNNNNACGGAACATGATAGAACTGTCTCTGTCGATGNCAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  col-0.fa
3633971  NNNNNNNNNNNANNNNNNNCATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  cvi-0.fa
3633971  GATGGAAACNGANACNGAACATGATAGAACTGTCTCTGTCGANGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  est-1.fa
3633971  GATGGANNNNNAAACGGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  fei-0.fa
3633971  GANGNNNNNNNNNACGGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  got-7.fa
3633971  NNNNNNNNNNNAAACGGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  ler-1.fa
3633971  GATGGAAACAGAAACGGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  lov-5.fa
3633971  NNNNNNNNNNNNNNCNGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGNGCCAAGCTCAACGA  nfa-8.fa
3633971  GATGGANNNNNAAACGGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  rrs-10.fa
3633971  NNNNNAAACAGAAACGGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  rrs-7.fa
3633971  NANGNNNNNNNAAACGGAACATGATAGAACTGTCTCTGTCGNNNNCAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  sha.fa
3633971  GANGGAAACNGAAACGGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  tamm-2.fa
3633971  GANGNNNNNNNAAACGGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  ts-1.fa
3633971  GATGGAANCAGAAACGGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  tsu-1.fa
3633971  NNNGNNNNNNNAAACGGAACATGATAGAACTGTCTCTGTCGATGACAACGACAGCCTTGTACCTGAGCCAAGCTCAACGA  van-0.fa
 
3634051  AAGAAAGCTTTTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGACA  chr5.fa
3634051  AAGAANNNNNNTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGANN  bay-0.fa
3634051  AAGANNNNNNNNTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGACA  bor-4.fa
3634051  AAGAAANNNNNTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGANN  br-0.fa
3634051  AAGAAAGCTTTTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGACA  bur-0.fa
3634051  AAGAAAGCTTTTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGACA  c24.fa
3634051  AAGAAANNNNNNNNGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGACA  col-0.fa
3634051  AAGNNNNNNNNNTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGANN  cvi-0.fa
3634051  AAGAAAGNTTTTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCNTCAACTTTCAAGTGCAGGCGAAGTTTTGANN  est-1.fa
3634051  AAGAAAGNTTTTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGACA  fei-0.fa
3634051  AANNNNNNTTTTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGANN  got-7.fa
3634051  AAGAAAGCTNTTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTNGNNN  ler-1.fa
3634051  AAGAAAGCTTTTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGACA  lov-5.fa
3634051  ANGNNNNNNNNNNNGANGATCTCTCGCTTACTGGGCAAGTTATNAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGANN  nfa-8.fa
3634051  AAGAAAGCTTTTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGACA  rrs-10.fa
3634051  AAGAAANNNNNNNTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGACA  rrs-7.fa
3634051  AAGANNNNNNNNNNNAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGACN  sha.fa
3634051  AAGAAAGCNTTTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGACA  tamm-2.fa
3634051  AAGAAAGCTNTTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGACA  ts-1.fa
3634051  AAGAAAGCTTTTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGACA  tsu-1.fa
3634051  AAGAANNNNNNTTTGAAGATCTCTCGCTTACTGGGCAAGTTATGAATCCTCAACTTTCAAGTGCAGGCGAAGTTTTGACN  van-0.fa
 
3634131  AAAGTTGAATTGGATTTTGCTTTTGTCTCTGAGAAATTGGTCAATCTTAGTCTTCTTACTATGCAACTCGGCACGAGGGA  chr5.fa
3634131  NNNNNNNNATTGGNTTNTGNNNNNGTCTCTGAGAAATTGGTCAATCTNNNNNTTCTTACTATGCAACTCGGCACGAGGGA  bay-0.fa
3634131  ANNNNNNNNTNGGNTTNTNNNNNNNNNNNTGAGAAATTGGTCAATCNTNNTNTTNTTNCTATGCAACTCGGCACGAGGGA  bor-4.fa
3634131  NNNNNNNNNNNNNNTTNTGNTTTTGNCTCTGAGAAATTGGTCAATNNNNGTCTTCTTACTATGCAACTCGGCACGAGGGA  br-0.fa
3634131  AAAGTTGAATTGGATTTTGNTTTTGTCTCTGAGAAATTGGTCAATCTTAGTCTTCTTACTATGCAACTCGGCACGAGGGA  bur-0.fa
3634131  AANGTTGAATTGGATTTTGNTTTTGTCTCTGAGAAATTGGTCAATCTTAGTCTTCTTACTATGCAACTCGGCACGAGGGA  c24.fa
3634131  AANNNNNNNNNNNNTTNTGNTTNTGNCTCTGAGAAATTGGTCAANNNNNNNNTTCTTACTATGCAACTCGGCACGAGGGA  col-0.fa
3634131  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGAAATTGGTCAATNNNNNNNNNCNTACTATGCAACTCGGCACGAGGGA  cvi-0.fa
3634131  NNNNNNNNNNNNGNTTNTGNTTTTGTCTCTGAGAAATTGGTCAATNNNNNNNNTCTTACTATGCAACTCGGCACGAGGGA  est-1.fa
3634131  NAAGTTGAATTGGATTTTGNNNNNGTCTCTGAGAAATTGGTCAATCTTNGTCTTCTTACTATGCAACTCGGCACGAGGGA  fei-0.fa
3634131  NNNNNNNNATTGGNTNNTGNTTTNGTCTCTGAGAAATTGGTCAATCTTAGTCTTCTTACTATGCAACTCGGCACGAGGGA  got-7.fa
3634131  NNNNNNNNNTNNNNTTNTGNNNNNGTCTCTGAGAAATTGGTCAATNNNNGTCTTCNTACTATGCAACTCGGCACGAGGGA  ler-1.fa
3634131  AAAGTTGAATTGGNTTNTGNNNNNGTCTCTGAGAAATTGGTCAATCTTAGTCTTCTTACTATGCAACTCGGCACGAGGGA  lov-5.fa
3634131  NNNNNNNNNNNNNNNNNNNNNNNNGTCTCTGAGAAATTGGTCAATCNNNNNNTTCTTACTATGCAACTCGGCACGAGGGA  nfa-8.fa
3634131  AANGTTGAATTGGNTNNTGNTTTTGTCTCTGAGAAATTGGTCAATCTTAGTCTTCTTACTATGCAACTCGGCACGAGGGA  rrs-10.fa
3634131  NNNNNNNNNNNNNNNTNTGNTTTTGTCTCTGAGAAATTGGTCAATCTNNNNNTTCTTACTATGCAACTCGGCACGAGGGA  rrs-7.fa
3634131  NNNNNNNNNNNNNNTTNNGNNNNNGTCTCTGAGAAATTGGTCAATNNNNNNNTTCTTACTATGCAACTCGGCACGAGGGA  sha.fa
3634131  ANNNNNNNNNNNGNTTNTGNTTTTGTNTCTGAGAAATTGGTCAATCTTNGTCTTCTTACTATGCAACTCGGCACGAGGGA  tamm-2.fa
3634131  NAAGTNGNATTGGNTTNTGNNNNNGTCTCTGAGAAATTGGTCAATCTTNGTCTTCTTACTATGCAACTCGGCACGAGGGA  ts-1.fa
3634131  AAAGTNGAATTGGNTTTTGCTTTTGTCTCTGAGAAATTGGTCAATCTTAGTCTTCTTACTATGCAACTCGGCACGAGGGA  tsu-1.fa
3634131  NNNNNNNNNNNNNNNNNNNNTTTTGTCTCTGAGAAATTGGTCAATCTNNNNNTTCTTACTATGCAACTCGGCACGAGGGA  van-0.fa
 
3634211  AAATGATTTTGAGTCTTTTGTTTCTAAGAAAGAAGAAGATGAAGAAGAGCCTTCGAGTAATGTTGATGATGATGATGATT  chr5.fa
3634211  AAATGATNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNNNAGAGCCTTCGAGTAATGNNNNNRRRNNRRRRGNNR  bay-0.fa
3634211  AAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCNTCGAGTAANNNNNNNRRRNNRRRRNNTR  bor-4.fa
3634211  AAATGNTTNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAATGNNNNNRRRNNRRRRNNNR  br-0.fa
3634211  AAATGANTNNGNNNNNNNNGTTTCTAAGAANNNNRRRNNRNNNGAAGAGCCTTCGAGTAATGTNNNNRRRNNRRRRNNNR  bur-0.fa
3634211  AAATGATTTTGNNNNNNNNGNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAATGNNNNNRRRNNRRRRGNTR  c24.fa
3634211  AAATGATNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAATGNNNNNRRRNNRRRRGNTR  col-0.fa
3634211  AAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAANNNNNNNRRRNNRRRRNNNR  cvi-0.fa
3634211  AAANNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAATGNNNNNRRRNNRRRRGNNR  est-1.fa
3634211  AAATGATTTNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAATGNNNNNRRRNNRRRRGNTR  fei-0.fa
3634211  AAATGNTTNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAATGNNNNNRRRNNRRRRNNNR  got-7.fa
3634211  AAATGATNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAATGNNNNNRRRNNRRRRNNNR  ler-1.fa
3634211  AAATGATTTTGNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAATGNNNNNRRRNNRRRRNNNR  lov-5.fa
3634211  AAATGNTTNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAANNNNNNNRRRNNRRRRGNTR  nfa-8.fa
3634211  AAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAATGTNNNNRRRNNRRRRNNTR  rrs-10.fa
3634211  AAATGATTTNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAATGNNNNNRRRNNRRRRNNNR  rrs-7.fa
3634211  AAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCNTCGAGTNNNNNNNNNRRRNNRRRRGNNR  sha.fa
3634211  AAATGATTNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAATGNNNNNRRRNNRRRRGNTR  tamm-2.fa
3634211  AAATGNTTNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAATGTTGNNRRRGNRRRRGATR  ts-1.fa
3634211  AAATGATTTTGNNNNTTTTNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAATGNNNNNRRRNNRRRRGNTR  tsu-1.fa
3634211  AAATGNTTNNNNNNNNNNNNNNNNNNNNNNNNNNRRRNNRNNNGAAGAGCCTTCGAGTAANNNNNNNRRRNNRRRRNNNR  van-0.fa
 
3634291  CTGCTGAGAAGGCATTGGAGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  chr5.fa
3634291  NTGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  bay-0.fa
3634291  CNGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  bor-4.fa
3634291  CNGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  br-0.fa
3634291  NNGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  bur-0.fa
3634291  CNGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  c24.fa
3634291  CNGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  col-0.fa
3634291  NNGCTGAGAAGGCATTGGNGTNTGNTCNCTNGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  cvi-0.fa
3634291  NNGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  est-1.fa
3634291  CTGCTGAGAAGGCATTGGNGTTTGATCTCTNGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  fei-0.fa
3634291  CTGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  got-7.fa
3634291  CTGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  ler-1.fa
3634291  CTGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  lov-5.fa
3634291  CNGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGNATCGCTTCTTGGT  nfa-8.fa
3634291  CTGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  rrs-10.fa
3634291  NNGCTGAGAAGGCATTGGNGTTTGATCTCTNGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  rrs-7.fa
3634291  NNGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  sha.fa
3634291  CTGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  tamm-2.fa
3634291  CTGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  ts-1.fa
3634291  CTGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  tsu-1.fa
3634291  NTGCTGAGAAGGCATTGGNGTTTGATCTCTTGTCTTCAATTCTCAATTCAGAGGTGAAAGAACTTGAATCGCTTCTTGGT  van-0.fa
 
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGAAGCTTTCTTGGATTTGGA  chr5.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGNGAAGCTTTCTTGGATTTGGA  bay-0.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGNGAAGCTTTNTTGGATTTGGA  bor-4.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGNAGCTTTNTTGGATTTGGA  br-0.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGAAGCTTTCTTGGATTTGGA  bur-0.fa
3634371  TTTCTCCAGAACGAGANNNNNNNNGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGAAGCTTTCTTGGATTTGGA  c24.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGNAGCTTTNTTGGATTTGGA  col-0.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGNNNNNNNNTTNTTGGATTTGGA  cvi-0.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGNNNNNGCTTTNTNNGNTTTGGA  est-1.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGAAGCTTTCTTGGATTTGGA  fei-0.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGAAGCTTTCTTGGATTTGGA  got-7.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGAAGCTTTCTTGGATTTGNA  ler-1.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGAAGCTTTCTTGGATTTGGA  lov-5.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGNNNNNNNNNNNNNNGNTTTGGA  nfa-8.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGAAGCTTTCTTGGATTTGGA  rrs-10.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGAAGNTTTCTTGGATTTGGA  rrs-7.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGANGNTTTCTTGGATTTGGA  sha.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGAAGCTTTNTTGGATTTGGA  tamm-2.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGAAGCTTTCTTGGATTTGGA  ts-1.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGAAGCTTTCTTGGATTTGGA  tsu-1.fa
3634371  TTTCTCCAGAACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGNGAAGCTTTNTTGGATTTGGA  van-0.fa
 
3634451  AGGGAAGTTGAATGATACTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAAGAAGCAATCTTCTAACT  chr5.fa
3634451  AGGGAAGTTGAATGATNCTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAAGNNNNNNNNNNCTAACT  bay-0.fa
3634451  AGGGAAGTTGAATGATACTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAAGNAGNAANNNNCTAACT  bor-4.fa
3634451  AGGGAAGTTGAATGATNCTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAAGNNNNNNNNNNNNAACT  br-0.fa
3634451  ANGGAAGTTGAATGATACTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAAGNAGCAATCTTCTAACT  bur-0.fa
3634451  AGGGAAGTTGAATGATACTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAAGNNNNNATCTTCTAACT  c24.fa
3634451  AGGGAAGTTGAATGATNCTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAAGNNNNNNNNNNNTAACT  col-0.fa
3634451  AGGGAAGTTGAATGATACTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGNGGAAATGAANNNNNNNNNNNCTAACT  cvi-0.fa
3634451  AGGGAAGTTGAATGATNCTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAAGNNNNNNNNNTCTAACT  est-1.fa
3634451  AGGGAAGTTGAATGATACTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAAGNNNNNATCTTCTAACT  fei-0.fa
3634451  AGGGAAGTTGAATGATACTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAAGNAGCAATCTTCTAACT  got-7.fa
3634451  AGGGAAGTTGAATGATACTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAAGNNNNNNNNTTCTAACT  ler-1.fa
3634451  AGGGAAGTTGAATGATACTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGANNNNNNNNNNNNCTAACT  lov-5.fa
3634451  ANGGAAGTTGAATGATNCTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAANNNNNNNNNNNNNAACT  nfa-8.fa
3634451  AGGGAAGTTGAATGATACTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAAGNANNANTCTTCTAACT  rrs-10.fa
3634451  AGGGAAGTTGAATGATNCTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAANNNNNNNNNNNCTAACT  rrs-7.fa
3634451  AGGGAAGTTGAATGNNNNNGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGANNNNNNNNNNNNCTAACT  sha.fa
3634451  AGGGAAGTTGAATGATACTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGNGGAAATGAAGNANNNNNNNTCTAACT  tamm-2.fa
3634451  AGGGAAGTTGAATGATACTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGNGGNAANGNNGNNNNNNNNNTCTAACT  ts-1.fa
3634451  AGGGAAGTTGAATGATACTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAAGNAGCNATCTTCTAACT  tsu-1.fa
3634451  NGGGAAGTTGAATGATNCTGAACAATCTTTGGGTCAGTTAATGGAACAAGTAGTGGAAATGAANNNNNNNNNNNNNAACT  van-0.fa
 
3634531  TTCAGAGGTTATCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCTAGCTTTCTTTTTAACCTTGTTGTGAT  chr5.fa
3634531  TTCAGAGGTTATCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCNANNNNNNNNTTTANCCTTGTTGTGAT  bay-0.fa
3634531  TNNNNNGGTTATCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCTAGNNNNNNNNNNNNNNNTGTTGTGAT  bor-4.fa
3634531  TTCAGAGGTTATCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCNAGNNNNNNNNNNNNNNTTGTTGTGAT  br-0.fa
3634531  TTCAGAGGTTATCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCNAGCTTTCTTTTTAACCTTGTTGTGAT  bur-0.fa
3634531  TTCAGAGGTTATCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCTAGCTTTNTTTTTAACCTTGTTGTGAT  c24.fa
3634531  TTCAGAGGTTATCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCTAGCNNNNNNNNNNNNNNTGTTGTGAT  col-0.fa
3634531  NTNNGNGNNTNTCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCTNNNNNNNNTNNNNNNNNNGTTGTGAT  cvi-0.fa
3634531  TTCAGAGGTTNTCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCNAGNNNNNNNNNNNNNNNTGTTGTGAT  est-1.fa
3634531  TTCAGAGGTTATCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCTAGCTTTCTTTTTAACCTTGTTGTGAT  fei-0.fa
3634531  TTCAGAGGTTATCTTCTGGTTTGGNNNTNNNAGGAAGCTGTAAGTGACCAATCNAGCTTTNTTTTTAACCTTGTTGTGAT  got-7.fa
3634531  TTCAGAGGTTATCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCNAGNNNNNNNTTTAACCTTGTTGTGAT  ler-1.fa
3634531  TTCAGAGGTTATCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCNAGCTNNNNNNNTAACCTTGTTGTGAT  lov-5.fa
3634531  TTCAGAGGTTNTCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCTNGCNNNNNNNNNNNNNNTGTTGTGAT  nfa-8.fa
3634531  TTCAGAGGTTATCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCNAGCTTTCTTTTTAACCTTGTTGTGAT  rrs-10.fa
3634531  TTCAGAGGTTNTCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCNAGCTTTNNNNNNNNNNNTGTTGTGAT  rrs-7.fa
3634531  TTNAGAGGTTATCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCNNNNNNNNNNNNNNNNNNTGTTGTGAT  sha.fa
3634531  TTCAGAGGTTATCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCNNGCNTTNTTNNNNNNNTTGTTGTGAT  tamm-2.fa
3634531  TTCAGAGGTTATCTTCTNGTTTNGNNNTNNNANGAAGCTGTAAGTGACCAATCTAGCTTTNTTNTTNACCTTGTTGTGAT  ts-1.fa
3634531  TTCAGAGGTTATCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCNAGCTTTNTTTTTAACNTTGTTGTGAT  tsu-1.fa
3634531  TTCAGAGGTTNTCTTCTGGTTTGGATGAACAAGGAAGCTGTAAGTGACCAATCNAGCNNNNNNNNTNNNNTTGTTGTGAT  van-0.fa
 
3634611  GATCACTTGGTGAGAAAAATTTCAGGCTTTAATGAATACTATATAACTTTGTTTTTGCAGGGTCTGGAGGGCAAACTTCA  chr5.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGCNNNNNNNNNNNNNNNNNNNNNNNNTTTTTGCAGGGTCTGGAGGGCAAACTTCA  bay-0.fa
3634611  GATCNCTTGGTGAGAAAAATTTCAGGCNNNNNNNNNNNNNNNNNNNNNNTGTTTTTGCAGGGTCTGGAGGGCAAACTTCA  bor-4.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGCTNNNNNNNNNNNNNNNNNNNNNNNNTTTTGCAGGGTCTGGAGGGCAAACTTCA  br-0.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGCTTTAANNNNNNNNNNNNNNNNNTGTTTTTGCAGGGTCTGGAGGGCAAACTTCA  bur-0.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGCTTTNNNNNNNNNNNNNNNNNNTTGTTTTTGCAGGGTCTGGAGGGCAAACTTCA  c24.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTGCAGGGTCTGGAGGGCAAACTTCA  col-0.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGNNNNNNNNNNNNNNNNNNNNNNNTNTTTTTGCAGGGTCTGGAGGGCAAACTTCA  cvi-0.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGCTNNNNNNNNNNNNNNNNNNNNNNNTTTTTGCNGGGTCTGGAGGGCAAACTTCA  est-1.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGCTTTNNNNNNNNNNNNNNNNNNNTGTTTTTGCAGGGTCTGGAGGGCAAACTTCA  fei-0.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGCTTTANNNNNNNNNNNNNNNNNNTGTTTTTGCAGGGTCTGGAGGGCAAACTTCA  got-7.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGCTNNNNNNNNNNNNNNNNNNNNNNNNNTTTGCAGGGTCTGGAGGGCAAACTTCA  ler-1.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGCTNNNNNNNNNNNNNNNNNNNNNNGTTTTTGCAGGGTCTGGAGGGCAAACTTCA  lov-5.fa
3634611  GATCACTTGGNGAGAAAAATTTCAGNNNNNNNNNNNNNNNNNNNNNNNNTGTTTTTGCAGGGTCTGGAGGGCAAACTTCA  nfa-8.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGCTTTAATGNNNNNNNNNNNNNNNTGTTTTTGCAGGGTCTGGAGGGCAAACTTCA  rrs-10.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGCNNNNNNNNNNNNNNNNNNNNNNNNTTTTTGCNGGGTCTGGAGGGCAAACTTCA  rrs-7.fa
3634611  GATCACTTGGTGAGAAAAATTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTGCAGGGTCTGGAGGGCAAACTTCA  sha.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGCTTNNNNNNNNNNNNNNNNNNNNNNTTTTTGCAGGGTCTGGAGGGCAAACTTCA  tamm-2.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGCTNNNNNNNNNNNNNNNNNNNNNNNTTTTTGCAGGGTCTGGAGGGCAAACTTCA  ts-1.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGGCTTTANNNNNNNNNNNNNNNNTTTGTTTTTGCAGGGTCTGGAGGGCAAACTTCA  tsu-1.fa
3634611  GATCACTTGGTGAGAAAAATTTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTGCAGGGTCTGGAGGGCAAACTTCA  van-0.fa
 
3634691  GTGTCTCAAAACGATGGTGAGTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACTGCTGATCAGCAAAGGAATGTTTT  chr5.fa
3634691  GTGTCTCAAAACGATGGTGAGTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACTGCTGATCAGCAAAGGAATGTTTT  bay-0.fa
3634691  GTGTCTCAAAACGATGGNNNNNNNTNNNNNNNGAGCGCTAAGATCAATATGCAGACTGCNNNNNNNCAAAGGAATGTTTT  bor-4.fa
3634691  GTGTCTCAAAACGATGGTGANTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACTGCTGATCNGCAAAGGAATGTTTT  br-0.fa
3634691  GTGTCTCAAAACGATGGTGANTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACTGCTGNNNNNCAAAGGAATGTTTT  bur-0.fa
3634691  GTGTCTCAAAACGATGGTGAGTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACTGCNGATCAGCAAAGGAATGTTTT  c24.fa
3634691  GTGTCTCAAAACGATGGTGANTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACTGCTGATCAGNAAAGGAATGTTTT  col-0.fa
3634691  GTGTCTCAAAACGATGGTGANTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACTGCNNNNCAGCAAAGGANTGTNNN  cvi-0.fa
3634691  GTGTCTCAAAACGATGGTGAGTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACTGCTGATCNGCAAAGGANTGTTTT  est-1.fa
3634691  GTGTCTCAAAACGATGGTGANTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACNNNNNNNCNGCAAAGGAATGTTTT  fei-0.fa
3634691  GTGTCTCAAAACGATGGTGNNNCNGGTGANCTGAGCGCTAAGATCAATATGCAGACTGCTGATCAGCAAAGGAATGTTTT  got-7.fa
3634691  GTGTCTCAAAACGANNNNNNNNNNNNNNNNNNNNNNNNNNNGATCAATATGCAGACTGCNGATCAGCAAAGGAATGTTTT  ler-1.fa
3634691  GTGTCTCAAAACGATGGTGANTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACTGCNGNNCNGCAAAGGAATGTTTT  lov-5.fa
3634691  GTGTCTCAAAACGATGGTGANTTTGGTGATCTGAGCGCTAAGATCAATATGCNGACTGNNNNNNNGCAAAGGAATGTTNN  nfa-8.fa
3634691  GTGTCTCAAAACGATGGTGANTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACTGCNGATCAGCAAAGGAATGTTTT  rrs-10.fa
3634691  GTGTCTCAAAACGATGGTGANTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACTGCTGATCNGNNANGGAATGTTTT  rrs-7.fa
3634691  GTGNCTCAAAACGANNNNNNNNNNTNNNNNNNGAGCGCTAAGATCAATATGCNGACTGCTGATCAGCAAAGGAATGTNNN  sha.fa
3634691  GTGTCTCAAAACGATGGTGANTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACTGCTGATCNGCAAAGGAATGTTTT  tamm-2.fa
3634691  GTGTCTCAAAACGANNNNNNNNCNGGTGANCTGAGCGCTAAGATCAATANGCAGACTGCNGNNCNGCAAAGGAATGTTTT  ts-1.fa
3634691  GTGTCTCAAAACGATGGTGAGTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACTGCTGANCAGCAAAGGAATGTTTT  tsu-1.fa
3634691  GTGTCTCAAAACGATGGTGANTTTGGTGATCTGAGCGCTAAGATCAATATGCAGACTGCTGATCAGCAAAGGAATGTTTT  van-0.fa
 
3634771  AAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGAAACTAAGTGAATCAAGAAATACTGAACGAGAAC  chr5.fa
3634771  NAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGANNNNNNNNNNNNNNNGAAATACTGAACGAGAAC  bay-0.fa
3634771  AAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGAAANNNNNNNNNNCAAGAAATACTGAACGAGAAC  bor-4.fa
3634771  AAGGNTGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGANNNNNNNNNNNNCAAGAAATACTGAACGAGNNC  br-0.fa
3634771  NAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGAAACTAAGTGAATCAAGAAATACTGAACGAGAAC  bur-0.fa
3634771  AAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGAAACTAAGTGAATCAAGAAATACTGAACGAGAAC  c24.fa
3634771  AAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAANTTGAGAAGAAACNNNNNNNNNNNNNAAATACTGAACGAGANN  col-0.fa
3634771  AAGGNTGCTTGAGAAATCTTTGGCTAAGGAGATGGANCTTGAGAAGNNNNNNNNNNNNNNNNGAAANACTGAACGAGAAN  cvi-0.fa
3634771  AAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGANNNNNNNNNNNNNNNGAAATACTGAACGAGANC  est-1.fa
3634771  AAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGAAACNNNNNNNNTCAAGAAATACTGAACGAGAAC  fei-0.fa
3634771  AAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGAAACNNNNNNNNNNAAGAAATACTGAACGAGAAC  got-7.fa
3634771  AAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGAAACNNNNNNNNNNNNGAAATACTGAACGAGAAC  ler-1.fa
3634771  AAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGANNNNNNNNNNNNCAAGAAATACTGAACGAGAAC  lov-5.fa
3634771  NNNNNNNNTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAANNNNNNNNNNNNNNNNNNNNNNNNNGAACGAGAAC  nfa-8.fa
3634771  AAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGAAACTAAGTGAATCAAGAAATACTGAACGAGAAC  rrs-10.fa
3634771  NAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGAAACNNNNNNNNNNAAGAAATACTGAACGAGAAC  rrs-7.fa
3634771  NNNNNNNNTTGAGAAATCTTTGGCTAAGGAGATGGANCTTGAGAAGNNNNNNNNNNNNNCAAGAAATACTGAACGAGANN  sha.fa
3634771  NAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGAAACNNNNNNNNNCAAGAAATACTGAACGAGAAC  tamm-2.fa
3634771  AAGGATGCTTGAGAAATCTTTGGCNAAGGAGATGGAACTNGAGAAGANNNNNNNNNNNNCAAGAAATACTGAACGAGAAC  ts-1.fa
3634771  AAGGATGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGAAACTAAGNGAATCAAGAAATACTGAACGAGAAC  tsu-1.fa
3634771  NNNNNTGCTTGAGAAATCTTTGGCTAAGGAGATGGAACTTGAGAAGAAACNNNNNNNNNNNAGAAANACTGAACGAGAAC  van-0.fa
 
3634851  TAGAGATGAAACTGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  chr5.fa
3634851  RNGAGANGNAACTNTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  bay-0.fa
3634851  RNGAGATGAAACTGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  bor-4.fa
3634851  RNGNGATGAANCTGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  br-0.fa
3634851  RAGNGATGAAACTGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  bur-0.fa
3634851  RAGAGATGAAACTGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  c24.fa
3634851  RNGAGATGAAACNGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGNAACCGAAGATGCGTTCTCCAGGTGGCTT  col-0.fa
3634851  RNGNGANNNNNNNNTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGCTCTCCAGGTGGCTT  cvi-0.fa
3634851  RNGAGNNNNNNNNGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  est-1.fa
3634851  RNGAGATGAAACTGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  fei-0.fa
3634851  RNGAGATGAAACTGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  got-7.fa
3634851  RNGNGATGAAACTGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  ler-1.fa
3634851  RAGAGATGAAACTGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  lov-5.fa
3634851  RNNNNNNGAAACTGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  nfa-8.fa
3634851  RAGAGATGAAACTGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  rrs-10.fa
3634851  RAGAGANNNNNNNNTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  rrs-7.fa
3634851  RNGNGATNNNNNNNTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  sha.fa
3634851  RNGAGANGAAACTGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  tamm-2.fa
3634851  RNGAGATGAAACTGTATTCTTCTGAGCAGGATGTTGTCTACNTGGAAGAAGNAACCGAAGATGCGTTCTCCAGGTGGCTT  ts-1.fa
3634851  RAGAGATGAAACTGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  tsu-1.fa
3634851  RNGAGANGANACTGTATTCTTCTGAGCAGGATGTTGTCTACATGGAAGAAGTAACCGAAGATGCGTTCTCCAGGTGGCTT  van-0.fa
 
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  chr5.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAANNNNNTNNNNNNNNNNACTCCAGATTCTTCAGTTCAATCT  bay-0.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  bor-4.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  br-0.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  bur-0.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  c24.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCNGTTCAATCT  col-0.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  cvi-0.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  est-1.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  fei-0.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  got-7.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  ler-1.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  lov-5.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  nfa-8.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  rrs-10.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  rrs-7.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  sha.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  tamm-2.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  ts-1.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  tsu-1.fa
3634931  GAGGCAGATAATGCTGCTGAAGTCTTTAAGGGAACGTCAAAGGAGATGTCTGGAAAACTCCAGATTCTTCAGTTCAATCT  van-0.fa
 
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  chr5.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  bay-0.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  bor-4.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  br-0.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  bur-0.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  c24.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  col-0.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  cvi-0.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  est-1.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  fei-0.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  got-7.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  ler-1.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  lov-5.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  nfa-8.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  rrs-10.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  rrs-7.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  sha.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  tamm-2.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  ts-1.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGNAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  tsu-1.fa
3635011  AAGTGGCTCTTTTAAGCGGGAAGACAACTTGAAGTCTAAGCTTGTTGATTCAAAGGAACGTTTAGAAGCTAAGGAATGCG  van-0.fa
 
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTTGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  chr5.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGNCTTGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  bay-0.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTTGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAANAGAGAGTTTG  bor-4.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCNAGACTTGCTGACTTTCTTGTGGCACAAACAGAAGGCTNAAAAGAGAGTTTG  br-0.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTTGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  bur-0.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTNGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  c24.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTNGCTGACTTTCTTGTGGCACAAACAGAAGGNTTAAAAGAGAGTTTG  col-0.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTTGCTGACTTTCTTGTGGCACAAACAGAAGNNNNNNAAGAGAGTTTG  cvi-0.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCNAGNCTNGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  est-1.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTNGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  fei-0.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTNGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  got-7.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTNGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  ler-1.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCANGACTTGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  lov-5.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCNAGNCTNGCTGACTTTCTTGTGGCACAAACAGAAGGCTNAAAAGAGAGTTTG  nfa-8.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTNGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  rrs-10.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTNGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  rrs-7.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTNGCTGACTTTCTTGTGGCACAAACAGAAGGCTNAAAAGAGAGTTTG  sha.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTNGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  tamm-2.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCANGACTTGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  ts-1.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTTGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  tsu-1.fa
3635091  CCTTGCACAAGCTTGATAGCAGCAATGCAAGACTNGCTGACTTTCTTGTGGCACAAACAGAAGGCTTAAAAGAGAGTTTG  van-0.fa
 
3635171  CAAGAGGCTGAAGAAAAATTGATTTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  chr5.fa
3635171  CAAGAGGCTGAAGAAAAATTGNTTTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  bay-0.fa
3635171  CAAGAGGCTGAAGAAAAATTGATTTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  bor-4.fa
3635171  CAAGAGGCTGAAGAAANNNNNNNNNTGTTGNACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  br-0.fa
3635171  CAAGNGGCTGAAGAAAAATTGATTTNGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  bur-0.fa
3635171  CAAGAGGCTGAAGAAAAATTGATTTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  c24.fa
3635171  CAAGAGGCTGAAGAAAAANNNNTTTTGTTGNACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  col-0.fa
3635171  CAAGAGGCTGAAGAAAAANNNNNNNNNTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  cvi-0.fa
3635171  CAAGAGGCTGAAGAAAAATTGNTTTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  est-1.fa
3635171  CAAGAGGCTGAAGAAAAATTGATTTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  fei-0.fa
3635171  CAAGAGGCTGAAGAAAAATTGATTTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  got-7.fa
3635171  CAAGAGGCTGAAGAAAAATTGATTTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  ler-1.fa
3635171  CAAGAGGCTGAAGAAAAANTGATTTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  lov-5.fa
3635171  CAAGAGGCTGAAGAAAAATTGATNNTGTTGNACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  nfa-8.fa
3635171  CAAGAGGCTGAAGAAAAATTGATTTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  rrs-10.fa
3635171  CAAGAGGCTGAAGAAAANNNNNNNTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  rrs-7.fa
3635171  CAAGAGGCTGAAGAAAAANNNNNNNNGTTGAACACTGAGAATTCCANNNNNNGTGAGAAAGTTAGCTCCCTTGAAGAACA  sha.fa
3635171  CAAGAGGCTGAAGAAAAATTGATNTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  tamm-2.fa
3635171  CAAGAGGCTGAAGAAAAATTGATTTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  ts-1.fa
3635171  CAAGAGGCTGAAGAAAAATTGANTTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  tsu-1.fa
3635171  CAAGAGGCTGAAGAAANNNNNNNNTTGTTGAACACTGAGAATTCCACATTAAGTGAGAAAGTTAGCTCCCTTGAAGAACA  van-0.fa
 
3635251  ACTGAATGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  chr5.fa
3635251  ACTGAATGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  bay-0.fa
3635251  ACTGAATGAANATGGNNNNNNAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  bor-4.fa
3635251  ACTGAATGAATATGGGANTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  br-0.fa
3635251  ACTGAATGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  bur-0.fa
3635251  ACTGAATGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  c24.fa
3635251  ACTGAANGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  col-0.fa
3635251  ACTGAANGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  cvi-0.fa
3635251  ACTGAATGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  est-1.fa
3635251  ACTGAATGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  fei-0.fa
3635251  ACTGAATGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  got-7.fa
3635251  ACTGAANGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  ler-1.fa
3635251  ACTGANNNNNTATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  lov-5.fa
3635251  ACTGAATGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  nfa-8.fa
3635251  ACTGAATGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  rrs-10.fa
3635251  ACTGAATGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  rrs-7.fa
3635251  ACTGAATGAATATGGGANTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  sha.fa
3635251  ACNGAATGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  tamm-2.fa
3635251  ACTGAATGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  ts-1.fa
3635251  ACTGAATGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  tsu-1.fa
3635251  ACTGAATGAATATGGGATTCAAACAGAAGATGCGGATGCTACTTCTGGTGCTCTGATAACAGATCTTGAACGTATCAACG  van-0.fa
 
3635331  AGGAACTGAAAGATAAATTAGCCAAAACTGAAGCAAGGGCTGAGGAAACAGAATCCAAGTGCAAAATCCTAGAAGAAAGC  chr5.fa
3635331  AGGAACTGAAAGATAANTTAGCCAAAACNGAAGCAAGNGCTGAGGAAACAGAATCCAAGTGCAAAATNNNNNNAGAAAGC  bay-0.fa
3635331  AGGAACTGAAAGATAAATTAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAATCCAAGTGCAAAATNNNNNNAGAAAGC  bor-4.fa
3635331  AGGAACTGAAAGATNNNNNNGCCAAAACNGAAGCAAGNGCTGAGGAAACAGAANCCAAGTGCAAAATNNNNNNAGAAANC  br-0.fa
3635331  AGGAACTGAAAGATAAATTAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAATCCAAGTGCAAAATNNNNNNAGAANGC  bur-0.fa
3635331  AGGAACTGAAAGATAAATTAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAATCCAAGTGCAAAATNNNNNNAGAAAGC  c24.fa
3635331  AGGAACTGAAAGATAAATTAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAANCCAAGTGCAAAATNNNNNNNNAAAGC  col-0.fa
3635331  AGGAACTGAANNNNNNNTNAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAANCCAAGTGCAAAATNNNNNNNNNNNNN  cvi-0.fa
3635331  AGGAACTGAAAGATAAATTAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAATCCAAGTGCAAAATNNNNNNAGAAAGC  est-1.fa
3635331  AGGAACTGAAAGATAAATTAGCCNANNCNGAAGCAAGNGCTGAGGAAACAGAATCCAAGTGCAAAATNNNNNNAGAAAGC  fei-0.fa
3635331  AGGAACTGAAAGATAAATTAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAANCCAAGTGCAAAATNNNNNNAGAAAGC  got-7.fa
3635331  AGGAACTGAAAGATAAATTAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAATCCAAGTGCAAAATCCTNGAAGAAAGC  ler-1.fa
3635331  AGGAACTGAAAGATAAATTAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAATCCAAGTGCAAAATCCTNGAAGAAAGC  lov-5.fa
3635331  AGGAACTGAAAGATANNNNNNCCAAAACNGAAGCAAGNGCTGAGGAAACAGAANCNNANTGCAAAATNNNNNNNNNNNNN  nfa-8.fa
3635331  AGGAACTGAAAGATAAATTAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAATCCAAGTGCAAAATNNNNNNAGAAAGC  rrs-10.fa
3635331  AGGAACTGAAAGATAAATNAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAATCCAAGTGCAAAATNNNNNNNNNNNNC  rrs-7.fa
3635331  AGGAACTGAAAGATAAATTAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAANCCAAGTGCAAAATNNNNNNAGAANGC  sha.fa
3635331  AGGAACTGAAAGATAAATTAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAATCCAAGTGCAAAATNNNNNNAGAAANC  tamm-2.fa
3635331  AGGAACTGAAAGATAAATTAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAANCCAAGTGCAAAATNNNNNNAGAAAGC  ts-1.fa
3635331  AGGAACTGAAAGATAAATTAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAATCCAAGTGCAAAATNNNNNNAGAAAGC  tsu-1.fa
3635331  AGGAACTGAAAGATAAATTAGCCAAAACNGAAGCAAGGGCTGAGGAAACAGAANCCAAGTGCAAAATNNNNNNAGAAAGC  van-0.fa
 
3635411  AAAAAGGAGCTTCAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  chr5.fa
3635411  AAAAAGGAGCTTNAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  bay-0.fa
3635411  AAAAAGGAGCTTNAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  bor-4.fa
3635411  AAAAAGGAGCTTCAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACANAAGTTAGCATCGCTTGAGAAACA  br-0.fa
3635411  AAAAAGGAGCTTNAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  bur-0.fa
3635411  AAAAAGGAGCTTNAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  c24.fa
3635411  AAAAAGGAGCTTNAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  col-0.fa
3635411  NNNNNNNAGCTTCAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  cvi-0.fa
3635411  AAAAAGGAGCTTNAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  est-1.fa
3635411  AAANAGGAGCTTNAAGACGAGTTGGNGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  fei-0.fa
3635411  AAAAAGGAGCTTCAAGACGAGTTGGGGAATTTNAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  got-7.fa
3635411  AAAAAGGAGCTTCAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  ler-1.fa
3635411  AAAAAGGAGCTTCAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  lov-5.fa
3635411  NNNNNNNNGCTTNAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  nfa-8.fa
3635411  AAAAAGGAGCTTNAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  rrs-10.fa
3635411  ANAANGGAGCTTCAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  rrs-7.fa
3635411  AAAAAGGAGCTTNAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  sha.fa
3635411  NNANAGGAGCTTNAAGACGAGTTGGNGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  tamm-2.fa
3635411  AAAAAGGAGCTTCAAGACGAGTTGGGGAATTTNANNGNCAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  ts-1.fa
3635411  AAANAGGAGCTTCAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  tsu-1.fa
3635411  AAAAAGGAGCTTCAAGACGAGTTGGGGAATTTCAGAGACAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACA  van-0.fa
 
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCTGTTGAAGCAAGTAAAGAAAAGCAGAACTTGTTATATT  chr5.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCTGTTGAAGCAAGTAAAGAAAAGRNNNANNNNNNNNNNN  bay-0.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGNAAAGAAAAGRNGAACTTNNNNNNNN  bor-4.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAANNNRNNNANNNNNNNNNNN  br-0.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAAANGRNGAACTTGTTATATT  bur-0.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAAAAGRAGAACTTGTTATNNN  c24.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAAAANRANNACNNNNNNNNNN  col-0.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAAANNRNNNNNNNNNNNNNNN  cvi-0.fa
3635491  CTTGAGGGACTCAGATCTACAACNAGAACATGCAGTTGCAGCNGTTGAAGCAAGNAAAGAAANGRANNANNNNNNNNNNN  est-1.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAAAAGRANAACTTGTTANNNN  fei-0.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAANAGRAGAACTTGTTATATN  got-7.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAANNNRNNNACTTNNNNNNNN  ler-1.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAAANNRANNACTTGTTNNNNN  lov-5.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAANNNRNNNACTTNTNNNNNN  nfa-8.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAAAAGRAGAACTTGTTATATT  rrs-10.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAANANRANAANNNNNNNNNNN  rrs-7.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAAANNRNNNNNNNNNNNNNNN  sha.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAAANNRANNACTTGNNNNNNN  tamm-2.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAAANNRANNACNTGNNNNNNN  ts-1.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAANAGRANAACTTGTNNNNNN  tsu-1.fa
3635491  CTTGAGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCNGTTGAAGCAAGTAAAGAAANNRNNNANNNNNNNNNNN  van-0.fa
 
3635571  CTACTGTTTCTGATATGGAGGATGTGATCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  chr5.fa
3635571  NNNNNNNNTCTGATATGGAGGATGTGATCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  bay-0.fa
3635571  NNNNNNNTTCTGATATGGAGGATGTGATCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  bor-4.fa
3635571  NNNNNNNNTCTGATATGGAGGATGTGATCGAGGATCTAAAANCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  br-0.fa
3635571  CTNCTGTTTCTGATATGGAGGATGTGATCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  bur-0.fa
3635571  NNNNNGTTTCTGATATGGAGGATGTGATCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  c24.fa
3635571  NNNNNNNNTCTGATATGGAGGATGTGATCGAGGATCTAAAANCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  col-0.fa
3635571  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATCTAAAANCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  cvi-0.fa
3635571  NNNNNNNNNNNGATATGGAGGATGTGNTCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  est-1.fa
3635571  NNNNTGTTTCTGATATGGAGGATGTGATCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  fei-0.fa
3635571  NNNNNNTTTCTGATATGGAGGATGTGATCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  got-7.fa
3635571  NNNNNNNNNCTGATATGGAGGATGTGATCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  ler-1.fa
3635571  NNNNNNNNTCTGATATGGAGGATGTGATCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  lov-5.fa
3635571  NNNNNGTTTCTGATATGGAGGATGTGATCGAGGATCTAAAATCANAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  nfa-8.fa
3635571  CTNCTGTTTCTGATATGGAGGATGTGATCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  rrs-10.fa
3635571  NNNNNNNNNCTGATATGGAGGATGTGATCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  rrs-7.fa
3635571  NNNNNNNNNNNNATATGGAGGATGTGATCGAGGATCTAAAATNAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  sha.fa
3635571  NNNNNNNTTCTGATATGGAGGATGTGATCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  tamm-2.fa
3635571  NNNNNNTTTCTGATATGGAGGATGTGATCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  ts-1.fa
3635571  NNNNNGTTTCTGATATGGAGGATGTGATCGAGGATCTAAAATCAAAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACC  tsu-1.fa
3635571  NNNNNNNNNCTGATATGGAGGATGTGATCGAGGATCTAAA