Arabidopsis SNP Sequence Viewer

Chromosome : chr5 Coordinates : 938068 - 939811


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
938068  TGCAACCGACAGAGACGTCGCAGCCGGCGCCGTCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  chr5.fa
938068  TGCAACCGACAGAGACGTCGCAGCCNNNNNNNNCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  bay-0.fa
938068  TGCAACCGACAGAGACGTCGCAGCNNNNNNNNNCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  bor-4.fa
938068  TGCAACCGACAGAGACGNCGCAGCNNNNNNNNNCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  br-0.fa
938068  TGCAACCGACAGAGANNNNNNNNNNNNNNNNNNCNNNNNNNGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  bur-0.fa
938068  TGCAACCGACAGAGACGTCGCAGCNNNNNNNNNCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  c24.fa
938068  TGCAACCGACAGAGACGTCGCAGCCNNNNNNNNCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  col-0.fa
938068  TGCAACCGACAGAGANNNNNNNNNNNNNNNNNNCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  cvi-0.fa
938068  TGCAACCGACAGAGACGTCGCAGCNNNNNNNNNCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  est-1.fa
938068  TGCAACCGACAGAGACGTCGCAGNNNNNNNNGTCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  fei-0.fa
938068  TGCAACCGACAGAGACGTCGCAGCCNNNNNCGTCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  got-7.fa
938068  TGCAACCGACAGAGACGTCGCAGNNNNNNNNNNCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  ler-1.fa
938068  TGCAACCGACAGAGACGNCGCAGCNNNNNNNGTCGGATCAANGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  lov-5.fa
938068  TGCAACCGACAGAGACGTCGCAGCNNNNNNNNNCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  nfa-8.fa
938068  TGCAACCGACAGAGACGTCGCAGCCNNNNNCGTCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  rrs-10.fa
938068  TGCAACCGACAGAGACGTCGCAGCCNNNNNCGTCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  rrs-7.fa
938068  TGCAACCGACAGAGACGNNNNNNNNNNNNNNNNCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  sha.fa
938068  TGCAACCGACAGAGACGNCGCAGCNNNNNNNGTCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  tamm-2.fa
938068  NGCAACCGACAGAGACGTCGCAGCNNNNNNNGTCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  ts-1.fa
938068  TGCAACCGACAGAGACGTCGCAGCNNNNNNNNNCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  tsu-1.fa
938068  TGCAACCGACAGAGACGTCGCAGCCNNNNNNNNCGGATCAAGGCCGCCGGCTTAAGGATCAGTTATCGGAGAGTATGAGC  van-0.fa
 
938148  TTCAGTAGCCAAATGAAGAAGGAAGACGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGAGGAGAT  chr5.fa
938148  TTCAGTAGCCAAATGAAGAAGGAAGACGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGAGNNNRR  bay-0.fa
938148  TTCAGTAGCCAAATGAAGAAGGAAGACGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGAGNNNRR  bor-4.fa
938148  TTCAGTAGCCAAANGAAGAAGGNNNNNGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAANNNNNNRR  br-0.fa
938148  TTCAGTAGCCAAANGAAGAAGGNNNNCGATGAGTTGNCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGANNNNRR  bur-0.fa
938148  TTCAGTAGCCAAATGANGAAGGAAGNCGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGAGNNNRR  c24.fa
938148  TTCAGTAGCNAAATGAAGAAGGAAGACGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGNGNNNRR  col-0.fa
938148  TTCAGTAGCCAAANGAAGAAGGNNNNNGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAANNNNNNRR  cvi-0.fa
938148  TTCAGTAGCCAAATGAAGAAGGAAGACGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGAGNNNRR  est-1.fa
938148  TTCAGTAGCCAAATGAAGAAGGAAGACGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGAGNNNRR  fei-0.fa
938148  TTCAGTAGCCAAATGAAGAAGGAAGACGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGAGGNNRR  got-7.fa
938148  TTCAGTAGCCAAATGANGAAGGAAGACGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGANNNNRR  ler-1.fa
938148  TTCAGTAGCCAAATGAAGAAGGAAGACGATGAGTTGTCGATGNAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGNNNNNRR  lov-5.fa
938148  TTCAGTAGCCAAATGAAGAAGGAAGNCGATGAGTTGNCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGANNNNRR  nfa-8.fa
938148  TTCAGTAGCCAAATGAAGAAGGAAGACGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGAGGNGRR  rrs-10.fa
938148  TTCAGTAGCCAAATGAAGAAGGAAGACGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGAGGNNRR  rrs-7.fa
938148  TTCAGTAGCCAAATGANGAAGGAAGNCGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGAGNNNRR  sha.fa
938148  TTCAGTAGCCAAATGAAGAAGGAAGNCGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGAGNNNRR  tamm-2.fa
938148  TTCAGTAGCCAAATGAAGAAGGAAGACGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGAGGNNRR  ts-1.fa
938148  TTCAGTAGCCAAATGAAGAAGGAAGACGATGAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCNAAAGAAGAGGNNRR  tsu-1.fa
938148  NTCAGTAGCCAAATGAAGAAGGAAGNNNNNNAGTTGTCGATGAAAGCTTTGTCGGCGTTCAAGGCCAAAGAAGANNNNRR  van-0.fa
 
938228  CGAGAAGAAGAAGATGGAGATCAGAGAAAGAGTTCAAGCTCAGCTTGGTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  chr5.fa
938228  RRRRRRRRRRRRNNNNRNNNNCAGAGAAAGAGTTCANRRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  bay-0.fa
938228  RRRRRRRRRRRRNNNNRNGATCAGAGAAAGAGTTCAARRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  bor-4.fa
938228  RRRRRRRRRRRRNNNNRNNNNNNNANNNNNAGTTCNNRRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  br-0.fa
938228  RRRRRRRRRRRRNNNNRNNNNNAGAGAAAGAGTTNNNRRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  bur-0.fa
938228  RRRRRRRRRRRRNNNNRNNNNNNNAGAAAGAGTTCAARRRRRRRRRRRTCGTGTNGAAGATGAGTCCAAGCGTCTCGCTA  c24.fa
938228  RRRRRRRRRRRRNNNNRNGNTCAGAGAAAGAGTTCAARRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  col-0.fa
938228  RRRRRRRRRRRRNNNNRNNNNNNNNNNNAGAGTTNNNRRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  cvi-0.fa
938228  RRRRRRRRRRRRNNNNRNGNTCAGAGAAAGAGTTCAARRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  est-1.fa
938228  RRRRRRRRRRRRNNNNRNNNNNAGAGAAAGAGTTNANRRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  fei-0.fa
938228  RRRRRRRRRRRRNNNNRNNNTCAGAGAAAGAGTTCAARRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  got-7.fa
938228  RRRRRRRRRRRRNNNNRNNNNNNGAGAAAGAGTTCANRRRRRRRRRRRTCGTGTNGAAGATGAGTCCAAGCGTCTCGCTA  ler-1.fa
938228  RRRRRRRRRRRRNNNNRNNNNNNGAGAAAGAGTTCANRRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  lov-5.fa
938228  RRRRRRRRRRRRNNNNRNNNTCAGAGAAAGAGTTCANRRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  nfa-8.fa
938228  RRRRRRRRRRRRNNNNRNNNTCAGAGAAAGAGTTCANRRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  rrs-10.fa
938228  RRRRRRRRRRRRGNNNRNGNTCAGAGAAAGAGTTCAARRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  rrs-7.fa
938228  RRRRRRRRRRRRNNNNRNNNNNNNNNAAAGAGTTNANRRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  sha.fa
938228  RRRRRRRRRRRRNNNNRNNNTCAGAGAAAGAGTTCANRRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  tamm-2.fa
938228  RRRRRRRRRRRRNNNNRNGNTCAGAGAAAGAGTTCAARRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  ts-1.fa
938228  RRRRRRRRRRRRNNNNRNNNTCAGAGAAAGAGTTCAARRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  tsu-1.fa
938228  RRRRRRRRRRRRNNNNRNNNNNNNAGAAAGAGTTCAARRRRRRRRRRRTCGTGTTGAAGATGAGTCCAAGCGTCTCGCTA  van-0.fa
 
938308  TGATTCGCGAGGTTTGATTTCGAATACATTATTTCAATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGTTG  chr5.fa
938308  TGATTCGCGAGGTTTGATTTCGANNNNNNNNNNTCAATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGTTG  bay-0.fa
938308  TGATTCGCGAGGTTTGATTTCGAATNNNNNNNNTCAATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGTTG  bor-4.fa
938308  TGATTCGCGAGGTTTGATTNNNNNNNNNNNNNNNNNNNTCGAGTTTTGGTGTGATTCACTTGCTGCTTTNAGTTTNNNNN  br-0.fa
938308  TGATTCGCGAGGTTTGATTTCNNNNNNNNNNNNTCAATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGTTN  bur-0.fa
938308  TGATTCGCGAGGTTTGATTTCNNNNNNNNNNNNNNAATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGNNN  c24.fa
938308  TGATTCGCGAGGTTTGATTTCGAATACNNNNNNTCAATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGTTG  col-0.fa
938308  TGATTCGCGAGGTTTGATTNNNNNNNNNNNNNNNNNNNNNGAGTTTTGGTGTGATTCACTTGCTGCTNNNNNNNTNNNNN  cvi-0.fa
938308  TGATTCGCGAGGTTTGATTTCGNANNNNNNNNNNNNATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGTTN  est-1.fa
938308  TGATTCGCGAGGTTTGATTTCGAANNNNNNNNNNCAATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGTTN  fei-0.fa
938308  TGATTCGCGAGGTTTGATTTCGNNNNNNNNNNNNCAATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGTTG  got-7.fa
938308  TGATTCGCGAGGTTTGATTTCGAATNCATTATTTCAATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGTNN  ler-1.fa
938308  TGATTCGCGAGGTTTGATTTCGAATACATNNNNTCAATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGTTG  lov-5.fa
938308  TGATTCGCGAGGTTTGATTTCGAANNNNNNNNNTNAANTCGAGTTNNNNNNNNNNNNNNNNGCTGCTTTNAGTTTTGTTN  nfa-8.fa
938308  TGATTCGCGAGGTTTGATTTCGAATNNNNNNNNTCAATTCGAGTTNNNNNNNNNNTCACTTGCTGCTTTAAGTTTTGTTG  rrs-10.fa
938308  TGATTCGCGAGGTTTGATTTCGAATACATTANTTCAATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGTTG  rrs-7.fa
938308  TGATTCGCGAGGTTTGATNNNNNNNNNNNNNNNNCAATTCGAGTTTTGGTGNGATTCACTTGCTGCTNNNNNNTTNNNNN  sha.fa
938308  TGATTCGCGAGGTTTGATTTCGNNNNNNNNNNNNNNATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGNNN  tamm-2.fa
938308  TGATTCGCGAGGTTTGATTTCGAATANNNNNNNTCAATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGTTN  ts-1.fa
938308  TGATTCGCGAGGTTTGATTTCGAATACNTTNNNNCAATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGTNN  tsu-1.fa
938308  TGATTCGCGAGGTTTGATTTCNNNNNNNNNNNNNNAATTCGAGTTTTGGTGTGATTCACTTGCTGCTTTAAGTTTTGTNN  van-0.fa
 
938388  TAGTGTATATTAGGTCAAATTCCTATGGCTTATAGTGACTAAAAGGGAAAAAAATTCAACCTCTTTTAAGATTTAGTAGT  chr5.fa
938388  TNNNNNATATTAGGTCAAATTCCTATGGCTTATAGTGACNNNNNGGGAAAAAAATNNNNNNNNNNNNNNNNNNNNNNNGN  bay-0.fa
938388  NNGTGTATATTAGGTCAAATTCCTATGGCTTATAGTGNNNNNNNNNGAAAAAAATTCANNNNNNNNNNNNNNNNNGTAGT  bor-4.fa
938388  NNNNNNNNNNNNNNNNAAATTCCTATGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
938388  TNGTGTATATTAGGTCAAATTCCTATGGCTTANAGTGANNNNNNGGGAAAAAAANTCAANNNNNNNNNNNNNNNNNNNGT  bur-0.fa
938388  NNNNNTATATTAGGTCAAATTCCTATGGCTTATAGTGNNNNNNNGGGAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNGN  c24.fa
938388  TNGTGTATATTAGGTCAAATTCCTATGGCTTATAGTGACTANAAGGGAAAAAAATTCAACCTNNNNNNNGATTTAGTAGT  col-0.fa
938388  NNNNNNNNNNNNNNNNNNATTCCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
938388  NNNNNNATATTAGGTCAAATTCCTATGGCTTATAGTGACNAAAAGGGAAAAAAATTCANNNNNNNNNNNNNNNNNGTAGT  est-1.fa
938388  NNNNNNNNNTTAGGTCAAATTCCTATGGCTTNTNNTNNNNNNNNNNNNAAAAAATTNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
938388  TNGNNTNTATTAGGTCAAATTCCTATGGCTTATAGTGACNAAAAGGGAAAAAAATTCANNNNNNNNNNNNNNNNNNNAGT  got-7.fa
938388  NNNNGTATATTAGGTCAAATTCCTATGGCTTATAGTGACTNAAAGGGAAAAAAATNNNNNNNNNNNNNNNNNNNNGTAGT  ler-1.fa
938388  TNGTGTATATTAGGTCAAATTCCTATGGCTTATAGTGACTAAAAGGGAAAAAAATNCAACCTCTNNNAAGATTTAGTAGT  lov-5.fa
938388  NNNNNNNTATTAGGTCAAATTCCTATGGCTTATAGTGACNANANGGGAAAAAAATTCAANNNNNNNNNNNNNNNNNNNGT  nfa-8.fa
938388  NAGTGTATATTAGGTCAAATTCCTATGGCTTATAGTGNNNNNNAGGGAAAAAAATTCAANNNNNNNNNNNNNTTAGTAGT  rrs-10.fa
938388  TNGTGTATATTAGGTCAAATTCCTATGGCTTATAGTGACTAAAAGGGAAAAAAATTCNNNNNNNNNNNNNNNNTAGTAGT  rrs-7.fa
938388  NNNNNNNNNTTAGGTCAAATTCCTATGGCTNNNNNNNNNNNNNNNNNNNAAAAATTNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
938388  NNNNNNATATTAGGNCAAATTCCTATGGCTTATAGTGANNNNNNNNNAAAAAAATNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
938388  NNNNNNATATTAGGTCAAATTCCTATGGCTTATAGTGACNNNNNNNNAAAAAAATNCNNNNNNNNNNNNNNNNNNGTAGT  ts-1.fa
938388  NNNNGTATATTAGGTCAAATTCCTATGGCTTATAGTGNNNNNNAGGGAAAAAAATNNNNNNNNNNNNNNNNNNNNGTAGT  tsu-1.fa
938388  NNNNNNNTATTAGGTCAAATTCCTATGGCTTATAGTGNNNNNNNGGGAAAAAAANNNNNNNNNNNNNNNNNNNNNNNNGT  van-0.fa
 
938468  TGAGTGTTCTAAAATTAGAAAGCTGGATTTGGTCTTATTTAGGGTTTTTTAATATTTAGGTTCTAGATTTGTGGAACTTT  chr5.fa
938468  NGNGTGTTCNANNNNNNNAAAGCTGGATTTGGTNNNNRTTNNNNNNNNNNNNNNNNNNNNNNNTAGATTTGTGGAACTTT  bay-0.fa
938468  TGAGTGTTCTAAAATTAGAAAGCTGGATTTGGTNNNNRNNNNNNNNNNNNNNNNNNNNNNNTCTAGATTTGTGGAACTTT  bor-4.fa
938468  NNNNNNNNNNNNNNNNNNNNNGCTGGANTNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGNNNNNNNNN  br-0.fa
938468  TGAGTGTTCTAAAANNNNNAAGCTGGATTTGGTCNNNRNNNNNNNNNTTTNNNNNNNNNNNNNNNNATTTGTGGAACTTT  bur-0.fa
938468  NGNGTGTTCTAAAATTAGNAAGCTGGATTTGGNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNTAGATTTGTGGAACTTT  c24.fa
938468  TGAGTGTTCNAAAATTAGAAAGCTGGATTTGGTNNNNRNNNGGGTNNNNNNNNNNNNNGGTTCTAGATTTGTGGAACTTT  col-0.fa
938468  NNNNNNNNNNNNNNNNNNNNNNNTGGATNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNN  cvi-0.fa
938468  TGNGTNNNNNNNNNNTAGAAAGCTGGATTTGNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNAGATTTGTGGAACTTT  est-1.fa
938468  NNNNNNNNNNNNNNNNNNNAAGCTGGATTTGGNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGTGGAACTTT  fei-0.fa
938468  TGNGTGTTCNAAAATTAGAAAGCTGGATTTGGNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNAGATTTGTGGAACTTT  got-7.fa
938468  TGAGTGTTCTAAAATTAGAAAGCTGGATTTGNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNAGATTTGTGGAACTTT  ler-1.fa
938468  TGAGTGTTCTAAAATTAGAAAGCTGGATTTGGNNNNNRNNNGNNNNNNNNNNNNNNNNNNNNCNAGATTTGTGGAACTTT  lov-5.fa
938468  TGNGTGTNNNNNNNTTNGAAAGCTGGATTTGNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNAGATTTGTGGAACTTT  nfa-8.fa
938468  TGAGTGTTCTAAAATTAGAAAGCTGGATTTGGNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNAGATTTGTGGAACTTT  rrs-10.fa
938468  TGAGTGTTCTAAAATTAGAAAGCTGGATTTGGTNNNNRTNNGGGTNNNNNNNNNNNNNNNNTCTAGATTTGTGGAACTTT  rrs-7.fa
938468  NNNNNNNNNNNNNNNNNNNAAGCTGGATTTGNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGTGGANCTTT  sha.fa
938468  NGNGTNNNNNNNNANNNNNAAGCTGGATTTGGNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGTGGAACTTT  tamm-2.fa
938468  TGNGTGTTCTAAAATTAGAAAGCTGGATTTGGTNNNNRNNNGNNNNNNNNNNNNNNNNNNNNNNNNATTTGTGGAACTTT  ts-1.fa
938468  TGNGTGTTCTAAAATTAGAAAGCTGGATTTGNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNAGATTTGTGGAACTTT  tsu-1.fa
938468  TGAGTGNNNNNNAATTANAAAGCTGGATTTGNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNTAGATTTGTGGAACTTT  van-0.fa
 
938548  TTAGAAATTTAGAGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCTA  chr5.fa
938548  TTAGAAATTNAGAGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCTA  bay-0.fa
938548  TTAGAAATTNAGAGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCNA  bor-4.fa
938548  NNNNNNNNNNNNNNNNNNNTTTGTGTNCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGANNNNNNNA  br-0.fa
938548  TTAGANATTTAGAGNATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGANNNNNNNA  bur-0.fa
938548  TTAGAAATTNAGAGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCNA  c24.fa
938548  TTAGAAATTTAGAGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCTA  col-0.fa
938548  NNNNNNNNNNNNNNNNNNNTTTGNNNNNNNNGATGAGCNCTGTGTCATGATCTAAACCCGATTGGNAAAAGAAGNNGCNA  cvi-0.fa
938548  TTAGNNNNNNNNAGCATGATTTGTGTNCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCTA  est-1.fa
938548  TTAGANNNNNNGAGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGNNN  fei-0.fa
938548  TTAGAAATTTAGAGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCTA  got-7.fa
938548  TTAGAAATTTAGAGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCNA  ler-1.fa
938548  TTAGAAATTTAGAGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCNA  lov-5.fa
938548  NTAGAAANTNAGAGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCNA  nfa-8.fa
938548  TTAGAANNNNNGAGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCTA  rrs-10.fa
938548  TTAGAAATTTAGAGCATGATTTGTGTTCTATGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCTA  rrs-7.fa
938548  TTNNNNNNNNNNNNNANGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGANNNNNNNN  sha.fa
938548  TTAGNNNNNNNGAGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAANANNCNA  tamm-2.fa
938548  TTAGAANNNNNNNGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCNA  ts-1.fa
938548  TTAGNNNNNNAGAGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCNA  tsu-1.fa
938548  TNAGNNNNNNNNAGCATGATTTGTGTTCTAAGATGAGCTCTGTGTCATGATCTAAACCCGATTGGGAAAAGAAGAAGCNA  van-0.fa
 
938628  TGAATCAAGCTCTGAACTGAATTTGTGGTGATGTATGTTTGGTGTATTCAGGAACTTGAAGGTTTTGCTGATCCCATGAG  chr5.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGTGATGTATGTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  bay-0.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGTGANNNNNNTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  bor-4.fa
938628  TGAATCAAGNNNNNAACTGAATTTGTGGTGNNNNNNNNNNNNNNNGNNNNNNNNCTTGANGGRNTRGCTGATCCCATGRR  br-0.fa
938628  TGANTCAAGCTCTGAACTGAATTTGTGGTGANNNNNNTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  bur-0.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGNGATGTATGTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  c24.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGNGANGTNTGTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  col-0.fa
938628  TNAANNNNNNNNNNAACTGAATTTGTGNNNNNNNNNNNTTGGTGTATTCAGGAACTTGANGNRTTRGCTGATCCCATGRR  cvi-0.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGNGATGTATGTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  est-1.fa
938628  NNAATCAAGCTCTGAACTGAATTTGTGGNGNNGNATGTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  fei-0.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGNGATGTNTGTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  got-7.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGTGANNNNNNTTTGGTGTATTCAGGAACTTGAAGGRTTRGNTGATCCCATGRR  ler-1.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGNGANGTNTGTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  lov-5.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGTGATGTATGTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  nfa-8.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGTGATGTATGTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  rrs-10.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGTGATGTATGTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  rrs-7.fa
938628  NNAATCAAGCTCTGAACTGAATTTGTGNNNNNNNNNNTTTGGTGTATTCAGGAACTTGAAGGRTTRGNTGATCCCATGRR  sha.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGTGATGNATGTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  tamm-2.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGTGATGTATGTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  ts-1.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGNGATGTATGTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  tsu-1.fa
938628  TGAATCAAGCTCTGAACTGAATTTGTGGNGNNGNATGTTTGGTGTATTCAGGAACTTGAAGGRTTRGCTGATCCCATGRR  van-0.fa
 
938708  GAAGGAAGTTACTATGGTGAGGAAGAAGATTGATTCTCTCGACAAAGAATTAAAGCCATTGGGGAATACAGTTCAGAAAA  chr5.fa
938708  RAARGAAGTTACTATGGNRNGGARRAAGATTGATTNTRTCRACAAAGAATRRRAGNCATTNNNRRATACAGTTCAGAAAA  bay-0.fa
938708  RAARGAAGTTACTATGGTRAGGARRAAGATTGATTCTRTCRACAAAGAATRRRNGCCATTGGGRRATACAGTTCAGAAAA  bor-4.fa
938708  RAARNAAGTTANTANNNNRNNNNRRNNNNTTGATTNNRNNRNCNAAGANNRRRNNNNNNNNNNRRNNNNNNNNNNNNNNN  br-0.fa
938708  RAARNAAGTTACTATNGNRNGGNRRANGATTGATNCNRTCRACAAAGAATRRRNNNNNNTGNGRRANNCAGTTCAGAAAA  bur-0.fa
938708  RAARGAAGTTACTATGGNRNGGARRAAGATTGATTNTRTCRACAAAGAATRRRNNNCATTGNNRRATNCAGTTCAGAAAA  c24.fa
938708  RAARGAAGTTACTATGGTRANGARRAAGATTGATTCTRTCRACAAAGAATRRRAGCCATTGNGRRATACAGTTCAGAAAA  col-0.fa
938708  RANRNNNGTTACTATNNNRNNNNRRNNNNNNNATNNNRNNRNNNAAGNNNRRRNNNNNNNNNNRRNNNCNNNNNNNNNNN  cvi-0.fa
938708  RAARGAAGTTACTATGGNRAGGARRAAGATTGATTCTRTCRACAAAGAATRRRAGNCATTGGGRRATNCAGTTCAGAAAA  est-1.fa
938708  RAARGAAGTTACTATGNNRANGNRRANGATTGATTCTRTCRACAAAGAATRRRNNNNNTTNNNRRANNCANTTCAGAAAA  fei-0.fa
938708  RAARGAAGTTACTATGGTRAGGARRAAGATTGATTCTRTCRACAAAGAATRRRAGNCATTGGGRRATACAGTTCAGAAAA  got-7.fa
938708  RAARGAAGTTACTATGGNRNNGARRNNGATTGATTCTRTCRACAAAGAATRRRAGNCATTGNNRRATNCAGTTCAGAAAA  ler-1.fa
938708  RAARGAAGTTACTATGGNRNGGARRANGATTGATTCNRTCRACAAAGAATRRRAGCCATTGNGRRATNCAGTTCAGAAAA  lov-5.fa
938708  RAARGAAGTTACTATGGNRNGGARRANGATTGATTCTRTCRACAAAGAATRRRANNCATTGGGRRNTNCAGTTCAGAAAA  nfa-8.fa
938708  RAARGAAGTTACTATGGTRAGGARRAAGATTGATTCTRTCRACAAAGAATRRRAGNCATTGGGRRATACAGTTCAGAAAA  rrs-10.fa
938708  RAARGAAGTTACTATGGTRAGGARRAAGATTGATTCTRTCRACAAAGAATRRRAGNCATTGGGRRATACAGTTCAGAAAA  rrs-7.fa
938708  RAARGAAGTTACTATGNNRNNNNRRNNNATTGATTNNRTNRANAAAGAATRRRNNNNNNTNNNRRNNNCANNNNAGAAAA  sha.fa
938708  RAARGAAGTTACTATGNNRAGGARRANGATTGATTCTRTCRACAAAGAATRRRANNCATTGNNRRANNCAGTTCAGAAAA  tamm-2.fa
938708  RAARGAAGTTACTATGGNRAGGARRAAGATTGATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAA  ts-1.fa
938708  RAARGAAGTTACTATGGTRAGGARRAAGATTGATTCTRTCRACAAAGAATRRRAGCCATTGGGRRATACAGTTCAGAAAA  tsu-1.fa
938708  RANRGAAGTTACTATGGNRNNGARRAAGATTGATTCTRTCRACAAAGAATRRRAGNCATTGGGRRNTNCNGTTCAGAAAA  van-0.fa
 
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAATGCTTCATATATGTAATTAGGCACCGCGTTTTGAGATAAATTGCTTTACT  chr5.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAATNNNNNNNNNNNNTAATTAGGCACCGCGTTTTGAGATAANTTGCTTNACT  bay-0.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAATGNNNNNNATATGTAATTAGGCACCGCGTTTTGAGATAANTTGCTTTACT  bor-4.fa
938788  NNNNNTGTGGTNTGCTATTGAGAATTGTNNNNNNNNNNNNNNGTAATTAGGCACCGCGTTTTGAGATNNNNNNNNNNNNN  br-0.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAATNNNNNNNNNNNNTAATTAGGCACCGCGTTTTGAGATAANTTGCTTTACT  bur-0.fa
938788  AGGTTTGTGGNTTGCTATTGAGAATTGTAATNNNNNNNNNNNGTAATTAGGCACCGCGTTTTGAGATAAATTGCTTNACT  c24.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAATGCTTCATNTATGTAATTAGGCACCGCGTTTTGAGATAAATTGCTTTACT  col-0.fa
938788  NNNNNNNNNGTTTGCTNTTGAGAATTNNNNNNNNNNNNNNNNNNNATTAGGCACCGCGTTTTGAGANNNNNNNNNNNNNN  cvi-0.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAATNNNNNNNNNNNNNAATTAGGCACCGCGTTTTGAGATAAATTGNTTTACT  est-1.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTANNNNNNNNNNNNNNTAATTAGGCACCGCGTTTTGAGATANNNNNNNNNNNN  fei-0.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAATNNNNNNNNNNTGTAATTAGGCACCGCGTTTTGAGATAANTTGCTTTACT  got-7.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAATGNNNNNNNNATGTAATTAGGCACCGCGTTTTGAGATAAATTGCTTTACT  ler-1.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAATGCNNNNNATATGTAATTAGGCACCGCGTTTTGAGATAAATTGCTTTACT  lov-5.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAATGNNNNNNNNNTGTAATTAGGCACCGCGTTTTGAGATAAATTGCTTTNCT  nfa-8.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAATGCNNNNNATATGTAATTAGGCACCGCGTTTTGAGATAAATTGCTTTACT  rrs-10.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAATGCNNNNNNNATGTAATTAGGCACCGCGTTTTGAGATAAATTGCTTTACT  rrs-7.fa
938788  ANNNNNGTGGTTTGCTATTGAGAATTGTAANNNNNNNNNNNTGTAATTAGGCACCGCGTTTTGAGATANNNNNNNNNNCT  sha.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAANNNNNNNNNNNNGTAATTAGGCACCGCGTTTTGAGATAAANNNNNTTACT  tamm-2.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAATGNNNNNNNNNTGTAATTAGGCACCGCGTTTTGAGATAANTTGCTTTACT  ts-1.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAATGCTTCANATATGTAATTAGGCACCGCGTTTTGAGATAAATTGCTTTACT  tsu-1.fa
938788  AGGTTTGTGGTTTGCTATTGAGAATTGTAANNNNNNNNNNNTGTAATTAGGCACCGCGTTTTGAGATAAANTGCTTTACT  van-0.fa
 
938868  GTTTATGGATGATGAAGATATATGTATAGATTGGACCCATTTTATACCGACTTGATACTGAATAATTTTCAGAATGTGTT  chr5.fa
938868  GTTTATGGATGATGNNNNNNNNNNNNTAGATTGGARCCATTTTATACCGACTTGATACTGNNNNNNNNTCAGAATGTGTT  bay-0.fa
938868  GTTTATGGATGATGAAGNNNNNNNNATAGATTGGARCCATTTTATACCGACTTGATACTGNNNNNTTTTCAGAATGTGTT  bor-4.fa
938868  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNGARNCATTTTATACCGACTTGNNNNNNNNNNNNNNNNAGAATGTGTT  br-0.fa
938868  GTTTATGGATGATGAAGNNNNNNNNNNNNATTNGARNCATTTTATACCGACTTGATACTGNNNNNNNTTCAGAATGTGTT  bur-0.fa
938868  GTTTATGGATGATGNNNNNNNNNNNNNNNATTGGARCCATTTTATACCGACTTGATACTNNNNNNNNNNCAGAATGTGTT  c24.fa
938868  GTTTATGGATGATGAAGNNNNNNNTATAGATTGGARCCATTTTATACCGACTTGATACTGAATNATTTTCAGAATGTGTT  col-0.fa
938868  NNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNATTTTATACCGACTTGANNNNNNNNNNNNNNNNNAATGTGTT  cvi-0.fa
938868  GTTTATGGATGATGANNNNNNNNNNNNNNATTGGARCCATTTTATACCGACTTGATACNNNNNNNTNTTCAGAATGTGTT  est-1.fa
938868  GTTTATGGATGNTGNNNNNNNNNNNATAGATTGGARCCATTTTATACCGACTTGATACTNNNNNNNNNTCAGAATGTGTT  fei-0.fa
938868  GTTTATGGATGNTGAANNNNNNNGTATAGATTGGARCCATTTTATACCGACTTGATACTGANNNNNNNNCAGAATGTGTT  got-7.fa
938868  GTTTATGGATGATGAANNNNNNNNTATAGATTGGARCCATTTTATACCGACTTGATACTGAATAATTTTCAGAATGTGTT  ler-1.fa
938868  GTTTATGGATGATGAANNNNNNNNTATAGATTGGARCCATTTTATACCGACTTGATACTGAATAATTTTCAGAATGTGTT  lov-5.fa
938868  GTTTATGGATGATGAANNNNNNNNNNNNNATTGGARCCATTTTATACCGACTTGATACTNNNNNNNNNNCAGAATGTGTT  nfa-8.fa
938868  GTTTATGGATGATGNNNNNNNNTGTATAGATTGGARCCATTTTATACCGACTTGATACTNNNNNNNTTTCAGAATGTGTT  rrs-10.fa
938868  GTTTATGGATGATGANNNNNNNNGTATAGATTGGARCCATTTTATACCGACTTGATACTGAATAATTTTCAGAATGTGTT  rrs-7.fa
938868  GTTTATGGATGATNNNNNNNNNNNNNNAGATTNNARCCATTTTATACCGACTTGATACTNNNNNNNNNNNNGAATGTGTT  sha.fa
938868  GTTTATGGATGATGNNNNNNNNNNTATAGATTGGARCCATTTTATACCGACTTGATACTNNNNNNNNNTCAGAATGTGTT  tamm-2.fa
938868  GTTTATGGATGATGAANNNNNNNNNNTAGATTGGARCCATTTTATACCGACTTGATACTGNNNNNNNTTCAGAATGTGTT  ts-1.fa
938868  GTTTATGGATGATGAAGNNNNNNNTATAGATTGGARCCATTTTATACCGACTTGATACTGANNNNTTTTCAGAATGTGTT  tsu-1.fa
938868  GTTTATGGATGATGNNNNNNNNNNNNNAGATTNNNRCCATTTTATACCGACTTGATACTNNNNNNNTTTCAGAATGTGTT  van-0.fa
 
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGATGCTCTTGAAGCATTCAATG  chr5.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGCTNTTGAANNARRRRARG  bay-0.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGCTCTTGAAGCARRRRARG  bor-4.fa
938948  CNNNNNNNNNNNNNNNNNNNGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAANNARNNNNNNNNNNNNRRRRNRN  br-0.fa
938948  CAGGAGNCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAANGNRNNNNNTGAANNNRRRRARG  bur-0.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGNNCTTGANNNARRRRARG  c24.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGCTCTTGAAGCARRRRARG  col-0.fa
938948  CAGGAGNNNNNNNNNNNNNNGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGNARNNNNNNNNNNNNRRRRNRN  cvi-0.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGCNCTTGAANCARRRRARG  est-1.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGNNCTTGAANNNRRRRARG  fei-0.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGCNCTTGAAGCARRRRARG  got-7.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGNNNTTGAANNARRRRARG  ler-1.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGNNNNNNNNNNNRRRRARG  lov-5.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGCTCTTGANNNARRRRARG  nfa-8.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGCTCTTGAANNARRRRARG  rrs-10.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGCTCTTGNNNNARRRRARG  rrs-7.fa
938948  CAGGAGTCTTATTNTTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGNARGNNNNNNNNNNARRRRARN  sha.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGNNNNNNAANNARRRRARG  tamm-2.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGCTCTTGAAGCARRRRARG  ts-1.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGARGCTCTTGAAGCARRRRARG  tsu-1.fa
938948  CAGGAGTCTTATTATTCAAAGCCGTTTTTTTCAAAATGTGCAGGAAACAGAGTACAAGGNRGNTNTNGAANCARRRRNRG  van-0.fa
 
939028  AAAAGAACAAGGAGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCTCTCTCTACAAT  chr5.fa
939028  AAAAGANNARGNAGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCTCTCTCTACAAT  bay-0.fa
939028  AAAAGANCARGGAGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCTCTCTCTACAAT  bor-4.fa
939028  NNNNNNNNNRNNNGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATNNNNNNNNNNNNNNNNNNNTACAAN  br-0.fa
939028  ANAAGANNNRNNNNNNGGTGNAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATANNNNCTCACTTCTNTCTCTACAAT  bur-0.fa
939028  AAAAGANNNRGNNGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCTCTCTCTACAAT  c24.fa
939028  AAAAGANNNRNNAGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCTCTCNCTACAAT  col-0.fa
939028  NNAANANNNRNNNGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCANNNNNNNNNNNNNNNNNNNNNTACANN  cvi-0.fa
939028  NNAAGAACNRGGAGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCTCTCTCTACAAT  est-1.fa
939028  ANAANANNNRNNNGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACNNNNCTCTCTACAAT  fei-0.fa
939028  NNAANAACARGGAGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCTCTCTCTACAAT  got-7.fa
939028  AAAAGANNARNNNGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCTCTCTCTACAAT  ler-1.fa
939028  AAAAGANNNRNNAGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCTCTCTCTACAAT  lov-5.fa
939028  AAAAGANNNRGNAGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCTCNCTCTACAAT  nfa-8.fa
939028  NAAANNNNARGGAGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCTCTCTCTACAAT  rrs-10.fa
939028  AAAAGAACARGGAGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCTCTCTCTACAAT  rrs-7.fa
939028  ANAANANNNRNNAGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTNACTTNNCTCTCTACAAT  sha.fa
939028  NAAAGANNARGNNGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACNNNNCTCTCTACAAT  tamm-2.fa
939028  AAAAGAANARGNAGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCTCTCTCTACAAT  ts-1.fa
939028  AAAAGAANARGGAGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCTCTCTCTACAAT  tsu-1.fa
939028  ANAAGANNNRNNAGAAGGTGGAGCTGATCACCAAGCTACAGGAGGTTTGTTCAATATGATCTCACTTCNCTCTCTACAAT  van-0.fa
 
939108  TTCCAAGTAGTATTTCGTATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  chr5.fa
939108  TTCCAAGTAGTATTTCGTATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  bay-0.fa
939108  TTCCAAGTAGTATTTCGTATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  bor-4.fa
939108  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTATGGATGGTCTNCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  br-0.fa
939108  TTCCAAGTAGTATNNNNTATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  bur-0.fa
939108  TTCCAAGTAGTATTNNNNNTTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  c24.fa
939108  TTCCAAGTAGTATTTCGTATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  col-0.fa
939108  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  cvi-0.fa
939108  TTCCAAGTANNNNNTCGTATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  est-1.fa
939108  TTCCAAGTAGNANNNNNNNTTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTNTNNCGN  fei-0.fa
939108  TTCCAAGTAGTATTTCGTATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGTTGTGTTNTCTATCAA  got-7.fa
939108  TTCCAAGTAGTATTTCGTATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  ler-1.fa
939108  TTCCAAGTAGTATTTCGTATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGTTGTGTTGTCTATCAA  lov-5.fa
939108  TTCCAAGTAGTATTTCGNATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  nfa-8.fa
939108  NTCCAAGTAGTATTTCNTATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  rrs-10.fa
939108  TTCCAAGTAGTANTTCGTATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  rrs-7.fa
939108  TTCCAAGNNNNNNNNNNNNNNNNNNNNNNNGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  sha.fa
939108  TTCCAAGTNNNNNNNNNNNNNNNNNNNNACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  tamm-2.fa
939108  TTNCAAGTAGTATTTCGTATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  ts-1.fa
939108  TTCCAAGTAGTNTTTCGTATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGTNNNGTTGTCTATCAA  tsu-1.fa
939108  TTCCAAGTAGNNNNNNNTATTTGAATGAACGTTATGGATGGTCTGCGTTTGGTCCTACAAATTGGTGTGTTGTCTATCAA  van-0.fa
 
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTTACCATTACCTTTGTTTAGAACCTTACAAAATTAGGTAAAGACAT  chr5.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTNNCCATNACNTTTGTTTAGAACCTTACAAAATTAGGTAAAGACAT  bay-0.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTTNCCATTANCTTTGTTTAGAACCTTACAANNNNNNNNNNNCNNNN  bor-4.fa
939188  ACNAATCGTGTTTAAGCTGTAGGGCATATAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGACAT  br-0.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTTACCATNNNNNNNGTTTAGAACCTTACAAAATTNGGTAAAGACAT  bur-0.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTTANCANNNNNNNTGTTTAGAACCTTACAAAANTAGGTAAAGACAT  c24.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTTACCATTACCTTTGTTTAGAACCTTACAAAATTAGGTAAAGACAT  col-0.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACAT  cvi-0.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTTNCCATNNNNNNTGTTTAGAACCTTACAAAATNAGGTAAAGACAT  est-1.fa
939188  NNNNNTCGTGTTTAAGCTGTAGGGCATATAAATTTNNNNNNNNNNNNTGTTTAGAACCTTACAAAANTAGGTAAAGACAT  fei-0.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTNACCATTANCTTTGTTTAGAACCTTACAAAATNAGGTAAAGACAT  got-7.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTTACCATTACCTTTGTTTAGAACCTTACAANNNNNNNNNNNCNNNN  ler-1.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTTACCATTNCCTTTGTTTAGAACCTTACAAAATTAGGTAAAGACAT  lov-5.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTTACCATTNCCTTTGTTTNGAACCTTACAAAATNAGGTAAAGACAT  nfa-8.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAANTNNANCANTANCTTTGTTTAGAACCTTACAAAATTAGNTAAAGACAT  rrs-10.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTTACCATTANCTTTGTTTAGAACCTTACAAAATTAGGTAAAGACAT  rrs-7.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTNNNNNNNNNNNNNNNTTTAGAACCTTANANNANTNNGNAAAGACAT  sha.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATNNNNNNNNNNNNNNTGTTTAGAACNTTACAAAATTAGGTAAAGACAT  tamm-2.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTTACCANNNNNNTTGTTTAGAACCTTACAAAATTAGGTAAAGACAT  ts-1.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTTACCATTNCCTTTGTTTAGAACCTTACAAAATTAGGTAAAGACAT  tsu-1.fa
939188  ACTAATCGTGTTTAAGCTGTAGGGCATATAAATTTTNNNNNNNNCTTTGTTTAGAACCTTACAAAANTAGGTAAAGACAT  van-0.fa
 
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  chr5.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  bay-0.fa
939268  NGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  bor-4.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGANTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  br-0.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACNTGGGAAAGACTCCCATNGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  bur-0.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  c24.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  col-0.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGANTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  cvi-0.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  est-1.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  fei-0.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  got-7.fa
939268  NNNTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  ler-1.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  lov-5.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCNCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  nfa-8.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  rrs-10.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  rrs-7.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  sha.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  tamm-2.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  ts-1.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  tsu-1.fa
939268  TGGTCCCGTAGTTTTGTTCCAAGACTTGGGAAAGACTCCCATTGCAATAGGTGAAGTCATCTTACCGAGTTTTGGAATCC  van-0.fa
 
939348  AGTCTGCAAGTTTGTCATTTTAATAGTTAATTTCTTGACTCTAAAACGGGTTTCACAATTTGTGAAAAGTGAAGTCAGTG  chr5.fa
939348  AGTCTGCAAGTTTGTCATTNNNNNNNNNNNNNNNNNGACTCTAAAACGGGTTTNNNNNNNNNNNAAAAGTGAAGTCAGTG  bay-0.fa
939348  AGTCTGCAAGTTTGTCATTNNNNNNNNNNNNNNNTTGACTCTAAAACGGGTTTCACNATTTGNGAAAAGTGAAGTCAGTG  bor-4.fa
939348  AGTCTGCAAGTTTGTCANNNNNNNNNNNNNNNNNNNNACTCTAAAACGGGTTNNNNNNNNNNNNNAAAGTGAAGNCAGTG  br-0.fa
939348  AGTCTGCAAGTTTGTNNNNNNNNNNNNNNNNNNCTTGACTCTAAAACGGGTTTCANNNNNNNNNAAAAGTGAAGTCAGTG  bur-0.fa
939348  AGTCTGCAAGTTTGTCANNNNNNNNNNNNNNNNNNNGACTCTAAAACGGGTTTCANNNNNNNNGAAAAGTGAAGTCAGTG  c24.fa
939348  AGTCTGCAAGTTTGTCATTTTAATAGTTANTTTCTTGACTCTAAAACGGGTTTCACNATNTGNGAAAAGTGAAGTCAGTG  col-0.fa
939348  AGTCTGCAAGTTTGTNNNNNNNNNNNNNNNNNNNNNNANTCNAAAACGGGTTNNNNNNNNNNNNNAAAGTGAAGNCAGTG  cvi-0.fa
939348  AGTCTGCAAGTTTGTCATNNNNNNNNNNNNNNNNNNGACTCTAAAACGGGTTTCACAATNTGTGAAAAGTGAAGTCAGTG  est-1.fa
939348  AGTCTGCAAGTTTGTCATNNNNNNNNNNNNNNNNNNGACTCTAAAACGGGTTTCNNNNNNNNNGAAAAGTGAAGTCAGTG  fei-0.fa
939348  AGTCTGCAAGTTTGTCATTTNNNNNNNNNNNNNNTTGACTCTAAAACGGGTTTCACNNNNNGTGAAAAGTGAAGTCAGTG  got-7.fa
939348  AGTCTGCAAGTTTGTCATTNNNNNNNNNNNNNNCTTGACTCTAAAACGGGTTTCACANNNNNTGAAAAGTGAAGTCAGTG  ler-1.fa
939348  AGTCTGCAAGTTTGTCATTTNANNNNNNNNNNTCTTGACTCTAAAACGGGTTTCNNNNNNNNNGAAAAGTGAAGTCAGTG  lov-5.fa
939348  AGTCTGCAAGTTTGTCATNNNNNNNNNNNNNNNNNTGACTCTAAAACGGGTTTCACNNNNNNNGAAAAGTGAAGTCAGTG  nfa-8.fa
939348  AGTCTGCAAGTTTGTCATNNNNNNNNNNNNNNNNNNGACTCTAAAACGGGTTTCACAATNTGNGAAAAGTGAAGTCAGTG  rrs-10.fa
939348  AGTCTGCAAGTTTGTCATTTNNNNNNTTNNNTTCTTGACTCTAAAACGGGTTTCACAATTTGNGAAAAGTGAAGTCAGTG  rrs-7.fa
939348  AGTCTGCAAGTTTGTNNNNNNNNNNNNNNNNNNNNNGACTCTAAAACGGGTTNNNNNNNNNNNNAAAAGTGAAGTCAGTG  sha.fa
939348  AGTCTGCAAGTTTGTCANNNNNNNNNNNNNNNNNNNGACTCTAAAACGGGTTTCACNNNNNNNNAAAAGTGAAGTCAGTG  tamm-2.fa
939348  AGTCTGCAAGTTTGTCATTNNNNNNNNNNNNNNNNTGACTCTAAAACGGGTTTCACANTTTGTGAAAAGTGAAGTCAGTG  ts-1.fa
939348  AGTCTGCAAGTTTGTCATNNNNNNNNNNNNNNNNTTGACTCTAAAACGGGTTTCACAATTTGTGAAAAGTGAAGTCAGTG  tsu-1.fa
939348  AGTCTGCAAGTTTGTCATNNNNNNNNNNNNNNNNNNGACTCTAAAACGGGTTTCNCNNNNNNNNAAAAGTGAAGTCAGTG  van-0.fa
 
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  chr5.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  bay-0.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  bor-4.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTNTTTTCTCCAAACTAGATCCAACGCATTATCTTAG  br-0.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTNTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  bur-0.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGNTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  c24.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  col-0.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAANNNNNNNNNNNNNNCTAGATCCAACGCATTATCTTAG  cvi-0.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  est-1.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  fei-0.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATGNNNG  got-7.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  ler-1.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTANGNNNN  lov-5.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  nfa-8.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  rrs-10.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTNGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  rrs-7.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCNCCAAACTAGATCCAACGCATTATCTTAN  sha.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  tamm-2.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  ts-1.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATGNNNG  tsu-1.fa
939428  TGAGACTCTAGATCAGGACTTTCCATGTTTGGGTGCTTGGAAATTATTTTCTCCAAACTAGATCCAACGCATTATCTTAG  van-0.fa
 
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  chr5.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  bay-0.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  bor-4.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATNNN  br-0.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  bur-0.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  c24.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  col-0.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTANNNNNN  cvi-0.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  est-1.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  fei-0.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  got-7.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  ler-1.fa
939508  NACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  lov-5.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  nfa-8.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  rrs-10.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  rrs-7.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  sha.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  tamm-2.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  ts-1.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  tsu-1.fa
939508  CACCTCTATTTCGCAAGTGAGATATCCGAAAGAACAATCATGCGTTTTTGCATGTCGTGTCTGTAATTGCACTATATCCT  van-0.fa
 
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGTTGTTTATATTCACTATGATCGTGTT  chr5.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGTTGNNNNNNNTCACTATGATCGTGTT  bay-0.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGTTGNNNNNNNNCACTATGATCGTGTT  bor-4.fa
939588  NNNNATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAANNNNNNNNNNNNNNNNNNNATGATCGTGTT  br-0.fa
939588  NNNNATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGTTGNTNNTNTTCACTATGATCGTGTT  bur-0.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGTTNNNNNNNNNNACTATGATCGTGTT  c24.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGTTGTTTATATTCACTATGATCGTGTT  col-0.fa
939588  NNNNNNNCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAANNNNNNNNNNNNNNNNNNNTATGATCGTGTT  cvi-0.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGTTGTTNNNNNNCACTATGATCGTGTT  est-1.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTNTTNTTNATATTCACTATGATCGTGTT  fei-0.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGTTGTTTNTATTCACTATGATCGTGTT  got-7.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGTTGTTTNTATTCACTATGATCGTGTT  ler-1.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGNTGTTTATATTCACTATGATCGTGTT  lov-5.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGNTGNTTNTATTCACTATGATCGTGTT  nfa-8.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTNTTGTTTNNATTCACTATGATCGTGTT  rrs-10.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGTTGTTTATATTCACTATGATCGTGTT  rrs-7.fa
939588  GNATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTNNNNNNNNNNNNCACTATGATCGTGTT  sha.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAANNNNNNNNNNNATTCACTATGATCGTGTT  tamm-2.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGTTGTTNNNNNTCACTATGATCGTGTT  ts-1.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGTTGTTTNTATTCACTATGATCGTGTT  tsu-1.fa
939588  GTATATTCCATTGCAACGCTTGTACTATGTGGTGAGCCTGCTAGATCAAAAGTGTTGTNNNNNNNNACTATGATCGTGTT  van-0.fa
 
939668  CTTATGACAGTATTGAGACAGAGAGACTTAATGTACTTCTCTTCTTTTTTGATGAATGCGCGCAGTTGGAGGGAGAAAGC  chr5.fa
939668  CTTATGACAGTATTGAGARAGAGAGACTNAANGNNNNNNNNNNNTTTTTTGATGAATGCGCGCAGTTGGAGGGAGAAAGC  bay-0.fa
939668  CTTATGACAGTATTGAGARAGAGAGACTTAATGTNNNNNNNNTNTTTTTTGATGAATGCGCGCAGTTGGNGGGAGAAAGC  bor-4.fa
939668  CTTATGACAGTATTGNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGATGAATGCGCGCAGTTGGAGGGAGAAAGC  br-0.fa
939668  CTTATGACAGTATTGNGNRAGNNNNNNNNNNNNNNNNNNNNNTCTTTTTTGATGAATGCGCGCAGTTGGAGGGAGAAAGC  bur-0.fa
939668  CTTATGACAGTATTGAGARAGAGAGACTTANNNNNNNNNNNNNNNNTTTTGATGAATGCGCGCAGTTGGAGGGAGAAAGC  c24.fa
939668  CTTATGACAGTATTGAGARAGAGAGACTTAATGTANNNNTNNNNTTTTTTGATGAATGCGCGCAGTTGGAGGGAGAAAGC  col-0.fa
939668  CTTATGACAGTATTGNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGATGAATGCGCGCAGTTGGNGGGNNNNNNC  cvi-0.fa
939668  CTTATGACAGTATTGAGARAGAGAGACTTAATNNNNNNNNNNTCTTTTTTGATGAATGCGCGCAGTTGGNGGGAGAAAGC  est-1.fa
939668  CTTATGACAGTATTGAGARNGNGANANNTNNNNNNNNNNNNNNNTTTTTTGATGAATGCGCGCAGTTGGAGGGAGAAAGC  fei-0.fa
939668  CTTATGACAGTATTGAGARAGAGAGACTTAATGNNNNNNNNNNNTTTTTTGATGAATGCGCGCAGTTGGAGGGAGAAAGC  got-7.fa
939668  CTTATGACAGTATTGAGARAGNGAGACTTAANNNNNNNNNNTTCTTTTTTGATGAATGCGCGCAGTTGGAGGGAGAAAGC  ler-1.fa
939668  CTTATGACAGTATTGAGNRNGNGAGACTTAATGTANNNNNNNNNNNTTTTGATGAATGCGCGCAGTTGGAGGGAGAAAGC  lov-5.fa
939668  CTTATGACAGTATTGAGARAGAGAGACTTAATNNNNNNNNNNNNTTTTTTGATGAATGCGCGCAGTTGGAGGGAGAAAGC  nfa-8.fa
939668  CTTATGACAGTATTGAGARAGAGAGACTTANNNNNNNNNNNNNNTTTTTTGATGAATGCGCGCAGTTGGAGGGAGAAAGC  rrs-10.fa
939668  CTTATGACAGTATTGAGARAGAGAGACTTAATGTANNNNTCTTCTTTTTTGATGAATGCGCGCAGTTGGNGGGAGAAAGC  rrs-7.fa
939668  CTTATGACAGTATTGNNNRNNNGAGACNNNNNNNNNNNNNNNNNNNTTTTGATGAATGCGCGCAGTTGGNNNNNGAAAGC  sha.fa
939668  CTTATGACAGTATTGAGNRNNNGAGACTTAANNNNNNNNNNNNNNNNTTTGATGAATGCGCGCAGTTGGNGGGAGAAAGC  tamm-2.fa
939668  CTTATGACAGTATTGAGARAGAGAGACTTAANNNNNNNNNNTTCTTTTTTGATGAATGCGCGCAGTTGGNGGGAGAAAGC  ts-1.fa
939668  CTTATGACAGTATTGAGARAGAGAGACTTAATNNNNNNNNNNTCTTTTTTGATGAATGCGCGCAGTTGGNGGGAGAAAGC  tsu-1.fa
939668  CTTATGACAGTATTGAGNRAGAGAGACTTANNNNNNNNNNNNNNTTTTTTGATGAATGCGCGCAGTTGGAGGGAGAAAGC  van-0.fa
 
939748  GAGAAATTCAGGTTCAAGAAGCTGGAGGAGCTAAGCAAGAACATTGATCTAACCAAACCTTAGT   chr5.fa
939748  GAGAAATTCAGGTTCAAGAAGCTGGARRRRRRNAGCAAGAACATTGATCNAACCAAACCTTAGT   bay-0.fa
939748  GAGAAATTCAGGTTCAAGAAGCTGGARRRRRRNAGCAAGAACATTGATCTAACCAAACCTTAGT   bor-4.fa
939748  GAGAAATTCAGGTTCAAGAAGCTGNARRRRRRAAGCAAGAACATTGNNNNNACCAAACCTTAGT   br-0.fa
939748  GAGAAATTCAGGTTCAAGAAGCTNNARRRRRRAAGCAAGAACATTGATCNAACCAAACCTTAGT   bur-0.fa
939748  GAGAAATTCAGGTTCAAGAAGCTGGARRRRRRNAGCAAGAACATTGATCTAACCAAACCTTAGT   c24.fa
939748  GAGAAATTCAGGTTCAAGAAGCTGGARRRRRRNAGCAAGAACATTGATCTAACCAAACCTTAGT   col-0.fa
939748  GAGAAATTCAGGTTCAAGAAGCTGGARRRRRRAANCAAGAACATNGNNCNAACCAAACCTTAGT   cvi-0.fa
939748  GAGAAATTCAGGTTCAAGAAGCTGGARRRRRRNAGCAAGAACATTGATCNAACCAAACCTTAGT   est-1.fa
939748  GAGAAATTCAGGTTCAAGAAGCTNGARRRRRRAAGCAAGAACATTGATCTAACCAAACCTTAGT   fei-0.fa
939748  GAGAAATTCAGGTTCAAGAAGCTGGARRRRR</