Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 3376059 - 3378143


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
3376059  TTATGGGGTATGCATGATACTACTTTTAAACTTGACATAAGTTATGTTTGACATTTAAGGTTTTTATTGTTTATAATATT  chr1.fa
3376059  TTNTGGGGTNTGCATGATACTACTTTTAAACTTGACATAAGTTNTRRTTGACATTTAAGGTTNNNNNNNNRNNNNNNNNN  bay-0.fa
3376059  TTATGGGGTATGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  bor-4.fa
3376059  TTATGGGGTATGCATGATACTACTTTTNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  br-0.fa
3376059  TTATGGGGTATGCATGATACTACTTTTAAACTTGACATAAGTTNTRRTTGACATTTNAGNNNNNNNNNNNRNNNNNNNNN  bur-0.fa
3376059  TTATGGGGTATGCATGATACTACTTTTAAACTTGANNNNNNNTNNRRTNGACATTTNAGGTNNNNNNNNNRNNNNNNNNN  c24.fa
3376059  TTATGGGGTATGCATGATACTACTNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  col-0.fa
3376059  TTATGGGGTATGCATGATACTACTTTTAAACNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  cvi-0.fa
3376059  TTATGGGGTATGCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  est-1.fa
3376059  TTATGGGNTATGCATGATACTACTTTTNANNTNNNNNNNNNTNNNRRNNNNCANNNNNNNNNNNNNNNNNRNNNNNNNNN  fei-0.fa
3376059  TTATGGGGTNTGCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  got-7.fa
3376059  TTATGGNNNNNNNATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  ler-1.fa
3376059  TTATGNGGTATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  lov-5.fa
3376059  TTATGGGGTATGCATGATACTACTTTTAAACNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  nfa-8.fa
3376059  TTATGGGGTATGCATGATACNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  rrs-10.fa
3376059  TTATGGGGTATGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  rrs-7.fa
3376059  TTATGGGGTATGCATGATACNACNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  sha.fa
3376059  TTATGGGGTATGCATGATACTANNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  tamm-2.fa
3376059  TTATGGGGTATGCATGATACTACNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  ts-1.fa
3376059  TTATGGGGTNTGCATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  tsu-1.fa
3376059  TTATGGGGTATGCATGATACTANNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNN  van-0.fa
 
3376139  TTCTGAGACTTACGTTTTTTTCCTTGTCTGTATTTCAGGATAAGATGGTTAGGAAACCCATCGATCCAGAAGAGGAGCTC  chr1.fa
3376139  NNNNNNNANTTNCGTTTTNNNNNNNNNNNNNNNNTCAGGATAAGRRGNNNNNNANACNCATCGATCCAGAAGAGNANNTN  bay-0.fa
3376139  NNNNNNNNNNNNNNTTTTTNNNNNNNNNNNNNNTTCAGGANNNNRRNNNNNNNNNACCCATCGATCCAGAAGAGGAGCTC  bor-4.fa
3376139  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGGATNANRRNGTNAGGAAACCCATCGATCCAGAAGAGGAGCTC  br-0.fa
3376139  NNNNNNNNNNNNCGTNTNNNNNNNNNNNNNTATTTCAGGATAAGRRGGNNAGGAAACCCATCGATCCAGAAGAGGAGCTC  bur-0.fa
3376139  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCAGGATAAGRRGGNNAGGAAACCCATCGATCCAGAAGAGGAGCTC  c24.fa
3376139  NNNNNNNNNNNNNNNTTTNNNNNNNNNNNGTATTTCAGGATNNNRRGGNNAGGAAACCCATCGATCCAGAAGAGGAGCTC  col-0.fa
3376139  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGGATANNRRGGNNAGGAAACCCATCGATCCAGAAGAGGAGCTC  cvi-0.fa
3376139  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGNATNNNRRNGNNAGGAAACCCATCGATCCAGAAGAGGAGCTC  est-1.fa
3376139  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGGATANNRRGGNNAGGAAACCCATCGATCCAGAAGAGGAGCTC  fei-0.fa
3376139  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNAAACCCATCGATCCAGAAGAGGAGCTC  got-7.fa
3376139  NNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNCCCATCGATCCAGAAGAGGAGCTC  ler-1.fa
3376139  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNACCCATCGATCCAGAAGAGGNGCTC  lov-5.fa
3376139  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGGATNNNRRGGNNNNNAAACCCATCGATCCAGAAGAGGAGCTC  nfa-8.fa
3376139  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRGNNTAGGAAACCCATCGATCCAGAAGAGGAGCTC  rrs-10.fa
3376139  NNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNAAACCCATCGATCCAGAAGAGGAGCTC  rrs-7.fa
3376139  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGGNNNNNRRNNNNNNNNNACCCATCGATCCAGAAGAGGAGCTC  sha.fa
3376139  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNNNNACCCATCGATCCAGAAGAGGAGCTC  tamm-2.fa
3376139  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGGNNNNNRRGNNNNNNAAACCCATCGATCCAGAAGAGGAGCTC  ts-1.fa
3376139  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRGNNNNNNAAACCCATCGATCCAGAAGAGGAGCTC  tsu-1.fa
3376139  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGATNNNRRGNTNAGGAAACCCATCGATCCAGAAGAGGAGCTC  van-0.fa
 
3376219  CGGTGGATGTCCCAAGAAGTACGGGGTTACGTTGAAGCTGTTCTTAACAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  chr1.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRTGNAGCTGNNNNNNNCAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  bay-0.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRTGNAGCTGNNNNNNNNAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  bor-4.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRARRRRRRRRTGAAGCTGTTCTTAACAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  br-0.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRTGAAGCTGTTCTTNACAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  bur-0.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRARRRRRRRRTGAAGCTGTTNNNNNCAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  c24.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRTGAAGCNNNNNNNNNCAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  col-0.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRTGAAGCTGTTCTNAACAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  cvi-0.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRTGAAGCNGNNCNTAACAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  est-1.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRTGAAGCTGNNNNNNNNAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  fei-0.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRTGNAGCNNNNNNNNNNAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  got-7.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRTGNANNNNNNNNNNNNAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  ler-1.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNCCTTGCAGCCAATGTTCCAANNNNNNNNNN  lov-5.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRARRRRRRRRTGAAGCTNNNNNNNNNAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  nfa-8.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRARRRRRRRRTGNAGCTGNNNNNAACAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  rrs-10.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRTGNAGCNNNNNNNNNNAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  rrs-7.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRTGNAGCNNNNNNNNNNNGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  sha.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRTGAAGCTGNNNNNNNCAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  tamm-2.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRNGAAGNNNNNNNNNNNAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  ts-1.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRTGAAGNNNNNNNNNACAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  tsu-1.fa
3376219  CGGTGGATGTRRRRRRRRRRRRRRRRRRRRRRTGAAGCTGTTCTTAACAGCCTTGCAGCCAATGTTCCAAAGGTGAACTA  van-0.fa
 
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCTTGTCCATCTCTTTTCTCTTACAGAGATTCCTCGGTCATGCTACTA  chr1.fa
3376299  TCCTTATGCAAAANCTCGAAAGCTCTAAATTTTCTTGTCNNNNNNNNNTNTCTTACAGAGATTCCTCGGTCATGCTACTA  bay-0.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCTTGNNNNNNNNNNNNNNNNNNNNGAGATTCCTCGGTCATGCTACTA  bor-4.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCTTGTNNNNNNNNNNTNTCTTACAGAGATTCCTCGGTCATGCTACTA  br-0.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCTTGTNNNNNNNNNTTCTCTTACAGAGATTCCTCGGTCATGCTACTA  bur-0.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCTTGTCCANCTCTTTTCTNTTACAGAGATTCCTCGGTCATGCTACTA  c24.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCTTGNNNNNNNNNNNNNNNNNNCAGAGATTCCTCGGTCATGCTACTA  col-0.fa
3376299  TCCTTATGCAAAAGCNNNNNNNTNNNNNNNNTTCTTGTNNNNNNNNNTTNTCTTACAGAGATTCCTCGGTCATGCTACTA  cvi-0.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCTTGTNNNNNNNNNNNNNNNNNNAGAGATTCCTCGGTCATGCTACTA  est-1.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCTNGNNNNNNNNNNNTNTCTTACAGAGATTCCTCGGTCATGCTACTA  fei-0.fa
3376299  TCCTTATGCAAAAGCTCGAAANCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCCTCGGTCATGCTACTA  got-7.fa
3376299  TNCTTATGCAAAAGCTCGAAAGCTCTAAATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCCTCGGTCATGCTACTA  ler-1.fa
3376299  NNNTTATGCAAAAGCTCGAAAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCCTCGGTCATGCTACTA  lov-5.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCTTGTNNNNNNNNNNNNTCTTACAGAGATTCCTCGGTCATGCTACTA  nfa-8.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCNNNNNNNNNNNNNNNNNNNNNNNNNGATTCCTCGGTCATGCTACTA  rrs-10.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCNNNNNNNNNNNNNNNNNNNNNNNNNGATTCCTCGGTCATGCTACTA  rrs-7.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCTTGTNNNNNNNNNNNNNNNNNNNNAGATTCCTCGGTCATGCTNNNN  sha.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCTTGTNNNNNNNNNNNNNNNNNNAGAGATTCCTCGGTCATGCTACTA  tamm-2.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCNNNNNNNNNNNNNNNNNNNNNNAGAGATTCCTCGGTCATGCTACTA  ts-1.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCTCGGTCATGCTACTA  tsu-1.fa
3376299  TCCTTATGCAAAAGCTCGAAAGCTCTAAATTTTCTTGTNNNNNNNTTTTCTCTTACAGAGATTCCTCGGTCATGCTACTA  van-0.fa
 
3376379  AGCGATGTGAATTGACCATGAACAGGCTGTTGTTCTTTGTCAAGTAGAGAAAGCAAAGGAAGACATGCTGAATCAACTCT  chr1.fa
3376379  AGCGATGTGAATTTNNNNNNNNNNNNNTNNNNRTNNRNGTCNAGTAGAGAAAGCAAANGAAGACATGCNGAATCAACTCT  bay-0.fa
3376379  AGCGATGTGAATTGACCATGAACAGGCTGNTGRTCNRNNNCAAGTAGAGAAAGCAAAGGAAGACATGCNGAATCAACTCN  bor-4.fa
3376379  AGCGATGTGAATTTACCATGAACAGGCTGTTGRTCTRTGNCAAGTAGAGAAAGCAAAGGAAGACATGCNGAATCAACTCT  br-0.fa
3376379  AGCGATGTGAATTTNNNATGAACAGGCTGTTGRTCNRNGTCAAGNAGAGAAAGCAAAGGAAGACATGCNGAATCAACTCT  bur-0.fa
3376379  AGCGATGTGAATTTACCATGNNNNNNCTGTTGRTCNRTGTCAAGTAGAGAAAGCAAAGGAAGACATGCNGAATCAACTCT  c24.fa
3376379  AGCGATGTGAATTGACCATGAACAGGCTGTTGRTCTRTNNCAAGTAGAGAAAGCAAAGGAAGACATGCNGAATCAACTCT  col-0.fa
3376379  AGCGATGTGAATTTNNNNNNAACAGGCTGTTGRTCNRNGTCAAGTAGAGAAAGCAAAGGAAGACATGCNGAATCAACTCT  cvi-0.fa
3376379  AGCGATGTNNNNNTNCCATGAACAGGCTGTTGRTCTRTGNCAAGTAGAGAAAGCAAAGGAAGACATGCTGAATCAACTCT  est-1.fa
3376379  AGCGATGTGAATTTACCATGAACAGGCTGTTGRTNNRNGTCAAGTAGAGAAAGCAAAGGAAGACATGCTGAATCAACTCT  fei-0.fa
3376379  AGCNNNNNNNNNNTNNNNNNNNNAGGCTGTNGRNNNRNNNNNNNNNNNGAAAGCAAAGGAAGACATGNNNNNTCAACNNN  got-7.fa
3376379  AGCGATGTGAATTGACCATGAACNNNNNNNNGRTCNRNGNNNNNNNNNNNNNNCAAAGGAAGACATGCNNNNNCAACNNN  ler-1.fa
3376379  AGNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNRNNNRNNNNNNNNNNNNNNNNNNNNNNNNNACATGCNNNNTCANCNNN  lov-5.fa
3376379  AGCGATGTGNNNNTNNNANNNNNNNGCTGNNGRTNNRNGNCAAGTAGAGAAAGCAAAGGAAGACATGCTGAATCAACTCT  nfa-8.fa
3376379  AGCGATGTGAATTTACCATGAACAGGCTGTTGRTCTRTNNCAAGTAGAGAAAGCAAAGGAAGACATGCTGAATCAACTCT  rrs-10.fa
3376379  AGCGATGTGAATTGACCATGAACAGGCTGTTGRTCNRTNNCAAGTAGAGAAAGCAAAGGAAGACATGCNGAATCAACTCN  rrs-7.fa
3376379  NNNNNNNNNNNNNTNNNNNNNNNNNNNTGNNGRNNNRNNNCAAGNAGAGAAAGCAANGGAAGACATGCNGAATCAACTCT  sha.fa
3376379  AGCGATNNNNNNNTNNNNNNNACAGGCNGNNGRTNNRNNNCAAGTAGAGAANGNNANGGAAGACATGCTGAATCAACTCN  tamm-2.fa
3376379  AGCGATGTGAATNTNNNNNNNNNNNGCTGNNGRTNNRNGNCAAGTAGAGAAAGCNAANGAAGACATGCTGAATCAACTCT  ts-1.fa
3376379  AGCGATNNNNNNNTNNNNNNNNNNNNNNNNNNRNNNRNNNCNAGTAGAGAAAGCAAAGGAAGACATGCTGAATCAACTCN  tsu-1.fa
3376379  AGCGATGTGANNNTACCATGAACAGGCTGTTGRTCNRNGNCAAGTAGAGAAAGCAAAGGAAGACATGCTGAATCAACTCT  van-0.fa
 
3376459  ACAGTTCTATAAGGTTCAATATCTTTTCGTTCCCTGTGCCTTGTTTCGTTTCAGTTGTGGTGTGCTTACTTGTGCTCTCC  chr1.fa
3376459  ACAGTTCTATAAGGTTCAATATNTTTTCGTTCCCTGNNNNNNGTTTCGTTTCNNNNNTNNTNTGCTTACTTGTGCTCTCC  bay-0.fa
3376459  NNNNNNNNNNNNNNNNNNNNNTCTTTTCGTTCCCTGTGCCTTGTTTCGTTTCNGTTGTGGTGTGCTTACTTGTGCTCTCC  bor-4.fa
3376459  ACAGTTCTANNNNNNNNNNNNTCTTTTCGTTCCCTGNNNNNNGTTTCGTTTCAGTTGTGGTGTGCTTACTTGTGCTCTCC  br-0.fa
3376459  ACAGTTCTATAAGGTTCAATATCTTTTCGTTCCCTGTGNCTTGTTTCGTTTCNGTTGTGGTNTGNTTNCTTGTGCTCTCC  bur-0.fa
3376459  ACAGTTCTATAAGGTTCAATATCTTTTCGTTCCCTGTGCCTTGTTTCGTTTCNGTTGTGGTGTGCTTACTTGTGCTCTCC  c24.fa
3376459  ACNGTTCTATAANNNNNNNTATCTTTTCGTTCCCTGTGNCTTGTTTCGTTTCNGTTGTGGTGTGCTTACTTGTGCTCTCC  col-0.fa
3376459  ACAGTTCTATANNNNNNAATATCTTTTCGTTCCCTGNNNNNNGTTTCGTTTCAGTTGTGGTGTGCTTACTTGTGCTCTCC  cvi-0.fa
3376459  NNNNNTCTATANNNNNNNNNNTCTTTTCGTTCCCTGTGCCTTGTTTCGTTTCAGTTGTGGTGTGCTTACTTGTGCTCTCC  est-1.fa
3376459  ACAGTTCTATAAGNTTCAATATCTTTTCGTTCCCTGNNNNNNGTTTCGTTTCAGTTGTGGTGTGCTTNCTTGTGCTCTCC  fei-0.fa
3376459  NNNNNNNNNNNNNNNNNNNNNNNNNNTCGTTCCCTGTGCCTTGTTTCGTTTCAGTTGTGGTGTGCTTACTTGTGCTCTCC  got-7.fa
3376459  NNNNNNNNNNNNNNNNNNNNNNNTTTTCGTTCCCTNNNNNNNGTTTCGTTTCNGNNGNGNNGNGNNTNCTTGTGCTCNNN  ler-1.fa
3376459  NNNNNNNNNNNNNNNNNNNNNNNNNNTCGTTCNNNNNNNNNNGTTTCGTTTCNNNNGTNNTNNNNNNNNNNGTGCTNTCC  lov-5.fa
3376459  ACNGTTCTATNNNNNNNNNTATCTTTTCGTTCCCTGTGNCTTGTTTCGTTTCNGTTGTGGTGTGCTTACTTGTGCTCTCC  nfa-8.fa
3376459  ACNGTTCTNNNNNNNNNNNNATCTTTTCGTTCCCTGTGCCTTGTTTCGTTTCAGTTGTGGTGTGCTTACTTGTGCTCTCC  rrs-10.fa
3376459  NNNNNNNNNNNNNNNNNNNNNNNNTTTCGTTCCCTGNNNNNNGTTTCGTTTCNGTTGTGGTGTGCTTACTTGTGCTCTCC  rrs-7.fa
3376459  ANNNNNNNNNNNNNNNNNNNNNCTTTTCGTTCCCTGNNNNNNGTTTCGTTTCNGTTGTGGTGTGCTTNCTTGTGCTCTCC  sha.fa
3376459  NNNNNNNNNNNNNNNNNNNNNTCTTTTCGTTCCCTGTGNCTTGTTTCGTTTCNGTTGTGGTGTGCTTACTTGTGCTCTCC  tamm-2.fa
3376459  NNNNNNNTNNNNNNNNNNATATCTTTTCGTTCCCTGTGCCTTGTTTCGTTTCAGTTGTGGTGTGCTTACTTGTGCTCTCC  ts-1.fa
3376459  NNNNNNNNNNNNNNNNNNNNNNNTTTTCGTTCCCTGTGCCTTGTTTCGTTTCNGTTGTGGTGTGCTTACTTGTGCTCTCC  tsu-1.fa
3376459  NCAGTTCTANNNNNNNNNNNNNCTTTTCGTTCCCTGTGCCTTGTTTCGTTTCAGTTGTGGTGTGCTTACTTGTGCTCTCC  van-0.fa
 
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGAAAGGATTGAGTCATTGATACAAGAGGATCAGAATGTCAAAAGACGAAGA  chr1.fa
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGAAAGGATTGAGTCATTGATRCAAGAGGATCANRRRRRRRRAANANGARRR  bay-0.fa
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGAAAGGATNGNNTNANNNNNRNNNGAGGATCAGRRRRRRRRAAGACGARRR  bor-4.fa
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGANAGGATNGAGTCATTGATRCAAGAGGATCAGRRRRRRRRAAGACGARRR  br-0.fa
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGANAGGATTGAGTCATTGATRCAAGAGGATCAGRRRRRRRRANGACGARRR  bur-0.fa
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGAAAGGATTGAGTCATTGATRCAAGAGGATCAGRRRRRRRRAANACGARRR  c24.fa
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGAAAGGATNGAGTCATTGATRCAAGAGGATCAGRRRRRRRRAANANGARRR  col-0.fa
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGANAGGATNGAGTCATTGATRCAAGAGGATCAGRRRRRRRRAAGACGARRR  cvi-0.fa
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGAAAGGATTGAGTCATTGNTRCNAGAGGATCAGRRRRRRRRAAGACGARRR  est-1.fa
3376539  TGTATTTGATCTTTNGTGCAATAGGCAATGAAAGGATTGAGTCATTGATRCAAGAGGATCAGRRRRRRRRANNANGARRR  fei-0.fa
3376539  TGTATNNNNNNNNTAGTGCANTAGGCAATGANAGGATTGNNNNNNNNNNRNNNGAGGATNNNRRRRRRRRAANANGARRR  got-7.fa
3376539  NNNATTTGATCTNTAGTGCAATAGGCAATGANAGNATNGANTNNNNNNNRNNNNAGGATCNGRRRRRRRRNNNACGARRR  ler-1.fa
3376539  TGTATTTNNNNNNNNNTNCANTAGGCAATGANANNNNNNNNNNNNNNNNRNNNNNNNNTNNNRRRRRRRRNNNANNARRR  lov-5.fa
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGANAGGATTGAGTCATTGNTRCAAGAGGATCAGRRRRRRRRAANANGNRRR  nfa-8.fa
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGAAAGGATNGAGTCATTGATRCAAGAGGATCAGRRRRRRRRAAGACGARRR  rrs-10.fa
3376539  TGTATTTGATCTNTAGTGCAATAGGCAATGANAGNATNGAGTCATTNNNRCNNGAGGATCANRRRRRRRRAANANGARRR  rrs-7.fa
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGANAGGATTGAGTCATTNNNRNNNGAGGATCANRRRRRRRRNNNANGNRRR  sha.fa
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGAAAGGATTGAGTCATTNNNRCAAGAGGATCAGRRRRRRRRAANANGNRRR  tamm-2.fa
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGAAAGGATNGAGTCATTGNNRCNNGAGGATCNGRRRRRRRRNNNANGARRR  ts-1.fa
3376539  TGTATTTGNNNNNTAGTGCAATAGGCAATGAAAGGATTGAGNNNNNNNNRNNNGNGGATNAGRRRRRRRRNNNNCGARRR  tsu-1.fa
3376539  TGTATTTGATCTTTAGTGCAATAGGCAATGAAAGGATNGAGTCATTGATRCAAGAGGATCAGRRRRRRRRAAGACGARRR  van-0.fa
 
3376619  GAGCGTTACCAGAAACAATCCTCTCTTCTTTCTAAACTCACGAGGCAGCTTAGCATTCACGACAACCGAGCAGCAGCTGC  chr1.fa
3376619  RRRRRNNACCAGAAARRRNCNTCNCTTCTTTCTAAACTCACGAGGCANRRTNNCRRRRRRRRRNNNCGCNNNNNRNNNNN  bay-0.fa
3376619  RRRRRTTACCAGNAARRRNNNNNNNNNNNNNNNNAACTCACGAGGCAGRRTAGCRRRRRRRRRAACCGAGCNNNRNNNGC  bor-4.fa
3376619  RRRRRTTACCAGAAARRRNNNNNNNNNNNTTCTAAACTCACGAGGCAGRRTAGCRRRRRRRRRAACCGCGCNNNRNNNNN  br-0.fa
3376619  RRRRRTNACCAGAAARRRNCNTCNNNNCTTTCTAAACTCACGAGGCAGRRTAGCRRRRRRRRRANNCGCNNNNNRNNNNN  bur-0.fa
3376619  RRRRRTTACCAGAAARRRNCNTCNCTTCTTTCTAAACTCACGAGGCAGRRTAGCRRRRRRRRRANNCGCNNNNNRNNNNN  c24.fa
3376619  RRRRRTTACCAGAAARRRNNNNNNNNNNNNNCTAAACTCACGAGGCAGRRTAGCRRRRRRRRRAACCGAGCNNCRNNNNN  col-0.fa
3376619  RRRRRTTACCAGAAARRRNNNNNNNNNNNTTCTAAACTCACGAGGCAGRRTAGCRRRRRRRRRNNNCGCNNNNNRNNNNN  cvi-0.fa
3376619  RRRRRTTACCAGAAARRRNNNNNNNNNNNNNNNAAACTCACGAGGCAGRRTAGCRRRRRRRRRNANCGCNNNNNRNNNNN  est-1.fa
3376619  RRRRRTTACCAGAAARRRNNNNNNNNNNNNTCTAAACTCACGAGGCNGRRTAGCRRRRRRRRRNNNCGCNNNNNRNNNNN  fei-0.fa
3376619  RRRRRTTACCAGAAARRRNNNNNNNNNNNNNNNNAACTCACGAGGCAGRRTAGCRRRRRRRRRAACCGCGCNNNRNNNNN  got-7.fa
3376619  RRRRRTNACCAGAAARRRNNNNNNNNNNNNNNNAAACTCACGAGGCAGRRTAGCRRRRRRRRRAANCGAGCNNNRNNNNN  ler-1.fa
3376619  RRRRRTTACCAGNNNRRRNNNNNNNNNNNNNNNNNACTCACGAGGCAGRRTAGCRRRRRRRRRNNNNNCNNNNNRNNNNN  lov-5.fa
3376619  RRRRRTNACCAGNANRRRNNNNNNNNNNNNNCTAAACTCACGAGGCAGRRTAGCRRRRRRRRRNNNNNCNNNNNRNNNNN  nfa-8.fa
3376619  RRRRRTTACCAGNAARRRNNNNNNNNNNNNNNTAAACTCACGAGGCAGRRTAGCRRRRRRRRRAANCGCGCNNNRNNNNN  rrs-10.fa
3376619  RRRRRTTACCAGAAARRRNNNNNNNNNNNNNNNNNACTCACGAGGCAGRRTAGCRRRRRRRRRAACCGAGCNNNRNNNNN  rrs-7.fa
3376619  RRRRRNNNCCAGNNNRRRNNNNNNNNNNNNNNTAAACTCACGAGGCAGRRTNGCRRRRRRRRRNNNNNCNNNNNRNNNNN  sha.fa
3376619  RRRRRTTACCAGAAARRRNNNNNNNNNNNNNNTAAACTCACGAGGCAGRRTAGCRRRRRRRRRNNNCGCNNNNNRNNNNN  tamm-2.fa
3376619  RRRRRNNACCAGNANRRRNNNNNNNNNNNNNCTAAACTCACGAGGCAGRRTAGCRRRRRRRRRNANCGCNNNNNRNNNNN  ts-1.fa
3376619  RRRRRTTACCAGAAARRRNNNNNNNNNNNNNNNAAACTCACGAGGCAGRRTAGCRRRRRRRRRNNNCGCNNNNNRNNNNN  tsu-1.fa
3376619  RRRRRTTACCAGAAARRRNNNNNNNNNNNNTCTAAACTCACGAGGCAGRRTAGCRRRRRRRRRAACCGCGCNNNRNNNNN  van-0.fa
 
3376699  TTCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCTTATTATATTCGAAACATGATAACAGTTCTTCTGCT  chr1.fa
3376699  NNCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCTTATTATATTCGAAACATGATAACAGTTCTTCTNCN  bay-0.fa
3376699  TTCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGNNNNNTTATNNNNNNNNNNNNNNANNANTTCTTCTGCT  bor-4.fa
3376699  TTCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCTTATTATATTCGAAACATGATAACNGTTCTTCTGCT  br-0.fa
3376699  NNCAAGTTATTCGGACNNTNNNGGCACTGGTAAATTCATCCGCCTTATTATATTCGAAACATGATAACAGTTCTTCTGCT  bur-0.fa
3376699  TTCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCTTATTATATTCGAAACATGATAACAGTTCTTCTGCT  c24.fa
3376699  NTCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCTTATTATATNNNNNNCATGATAACNGTTCTTCTGCT  col-0.fa
3376699  NTCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCTTATTATATTCGAAACATGATAACAGTTCTTCTGCT  cvi-0.fa
3376699  NNCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCTTATTATNNNNNNNNCATGATAACAGTTCTTCTGCT  est-1.fa
3376699  NTCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCTTATTATATTCGAAACATGATAACAGTTCTTCTGCT  fei-0.fa
3376699  NTCAAGTTATTCNNNNNNTNNNNNNACTGGTAAATTCATCCGCNNNNNNNNNNNNNNNNNNNNATAACAGTNCTTCTGCT  got-7.fa
3376699  NNCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
3376699  NNCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3376699  NTCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCTTATTATATTCGNAACATGATAACNGTTCTTCTGCT  nfa-8.fa
3376699  NNCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCTTATTATANNNNNNNCATGATNNNNNNTCTTCTGCT  rrs-10.fa
3376699  TTCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCTTNTTATANNNNNNNNNNNNTNNNANNNNNTCTGCT  rrs-7.fa
3376699  NNCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCTTNTTATANNNNNNNCATNANNNNNNNNNNTCTGCT  sha.fa
3376699  NTCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCNTNTTATATNNNNNNNATGATANNNNNNCTTCTGCT  tamm-2.fa
3376699  NTCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCTTATTATATTNNNNACATGATAACNGTTCTTCTGCT  ts-1.fa
3376699  NTCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTTCTGCT  tsu-1.fa
3376699  TTCAAGTTATTCGGACAACAGTGGCACTGGTAAATTCATCCGCCTTATTATANNNNNNNCATGATAACNGTTCTTCTGCT  van-0.fa
 
3376779  TGCTTGGTTTGGATTGATACGGTTTCTTAAATACCATCTGAAAGATCTTCAATGAAACTTAGGTTTATAAATCTTTTAAT  chr1.fa
3376779  NGNNNNGNNNNNNNTNATNCGGTTTCTTAAATACCATCTGAAANATCTTCAATGAAACTTAGGTTNNNNNATCTTTTAAT  bay-0.fa
3376779  TGCTTGGTTTGGATTGATACGGTTNCTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
3376779  TGCTTGGTTTGGNTTNATNCGGTTTCTTAAATNNNNNNNGAAANNNNNNNNNTGNNNNNNNNNNNNNNNNNNNNNNNNNT  br-0.fa
3376779  TGCTTGGTTTGGNTTNATNCGGTTTCTTAAATACCATCTGAAANATCTTCAATGAAACTTAGGTNNNNNNNNNTTTTAAT  bur-0.fa
3376779  TGCTTGGTTTGGNTTGATNCGGTTTCTTAAATACCATCTGAAAGATCTTCAATGAAACTTAGGTTNNNNNNNNNTNTAAT  c24.fa
3376779  TGCTTGGTTTGGATTGATNCGGTTTCTTAANNNNNNNNNGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
3376779  TGCTTGGTTTGGATTGATACGGTTTCTTAAATNNNNNCTGANNNNNNNNNAATGAAANNNNNNNNNNNNNNNNNNNNNNT  cvi-0.fa
3376779  TGCTTGGTTTGGATTGATACGGTTTCTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
3376779  TGCTTGGTTTGGNTTNATNCGGTTTCTTAAATACCATCTGNNNNNNNTTCAATGANNNNNNNNNNNNNNNNNNNNNTAAT  fei-0.fa
3376779  TGNTTGGTTTGGNTTNNNNNNNNNTCNTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
3376779  NNNNNGGTTTGGATTNNNNNNNTNTCTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
3376779  NNNTTGGTTTGGNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3376779  TGCTTGGTTTGGATTGATACGGTTTCTTAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT  nfa-8.fa
3376779  TGCTTGGTTTGGATTGATNCGGTTTCTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAT  rrs-10.fa
3376779  TGCTTGGTTTGGATTGATNCGGTTTCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
3376779  TGCTTGGTTTGGNNNNNNNNGGTTTCTTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
3376779  TGCTTGGTTTGGNTTGATACGGTTTCTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
3376779  TGCTTGGTTTGGATTGATNCGGTTTCTTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
3376779  TGCTTGGTTTGGATTGATNCGNTTNCTNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
3376779  TGCTTGGTTTGGATTGATNCGGTTTCTTAAANNNNNNNTNANNNNNNNNNNNTGANNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
3376859  CTTGGTATCACTTGTCCTACAGAGAGTAGCCCAAGAGCAAGTGGAGGTTCTTCAGGGGACGACTGGATGAATGCCTTCAA  chr1.fa
3376859  CTTGGTATCACTTGTCCTACAGAGAGNNNNNNNNNNANNNNNNNNNNNTNNNNAGGGGACGACTGGATGAATGCCTTCAA  bay-0.fa
3376859  NTTNGTATCACTTGTCCTACAGAGAGTAGCCCAAGAGCAAGTGGAGGTTCTTCAGGGGACGACTGGATGAATGCCTTCAA  bor-4.fa
3376859  CTTGGTATCACTTGTCCTACAGAGAGTAGNCNNNNNANNNNNNNNNNTTCTTCAGGGGACGACTGGATGAATGCCTTCAA  br-0.fa
3376859  CTTGGTATCACTTGTCCTACAGAGAGTANNNNNNNAANNNNNNNNNNNTCTTCAGGGGACGACTGGATGAATGCCTTCAA  bur-0.fa
3376859  CTTGGTATCACTTGTCCTACAGAGAGTAGNCCAAGAANNNNNNNNNGTTCTTCAGGGGACGACTGGATGAATGCCTTCAA  c24.fa
3376859  CTTGGTATCACTTGTCCTACAGAGAGTAGCCCAAGAGCAAGTGGAGGTTCTTCAGGGGACGACTGGATGAATGCCTTCAA  col-0.fa
3376859  CTTGGTATCACTTGTCCTACAGAGAGNNNNNNNNNNANNNNNNGNGGTTCNTCAGGGGACGACTGGATGAATGCCTTCAA  cvi-0.fa
3376859  CTTGGTATCACTTGTCCTACAGAGNNNNNNNNNNNNANNNNNNNNNNTTCTTCAGGGGACGACTGGATGAATGCCTTCAA  est-1.fa
3376859  CTTGGTATCACTTGTCCTACAGAGANNNNNNNNNNNANNNNNNNNNNTTCTTCAGGGGACGACTGGATGAATGCCTTCAA  fei-0.fa
3376859  NNNNGTATCACTTGTCCTACAGAGANNNNNNNNNNNANNNNNNNNNNTTCTTCAGGGGACGACTGGATGAATGCCTTCAA  got-7.fa
3376859  NNNNNNATCACTTGTCCTACNGAGAGTAGCCCAAGAGCAAGTGGAGNNNNNNNNNNNNNNNNNNNNNNNAATGCCTTCAA  ler-1.fa
3376859  NNNNNNNNNACTTGTCCTANANNNNNNNNNNNNNNNANNNNNNNNNNNNNTTNAGGGGACGACTGGATGAATGCCNTCNA  lov-5.fa
3376859  CTTGGTATCACTTGTCCTACAGAGANNNNNNNNNNNANNNNNNNNNNTTCTTCAGGGGACGACTGGATGAATGCCTTCAA  nfa-8.fa
3376859  CTTGGTATCACTTGTCCTACAGAGAGTNNNNNNNNNANNNNNNNNNNNTCTTCAGGGGACGACTGGATGAATGCCTTCAA  rrs-10.fa
3376859  NNNNGTATCACTTGTCCTACAGAGAGTAGCCCAAGAGCAAGTGGAGGTTCTTCAGGGGACGACTGGATGAATGCCTTCAA  rrs-7.fa
3376859  CTTGGTATCACTTGTCCTACAGANNNNNNNNNNNNNANNNNNNNNNNNTCTTCAGGGGACGACTGGATGAATGCCTTCAA  sha.fa
3376859  NTNGGTATCACTTGTCCTACAGAGAGNNNNNNNNNNANNNNNNNNNNTTCTTCAGGGGACGACTGGATGAATGCCTTCAA  tamm-2.fa
3376859  NTTGGTATCACTTGTCCTACAGAGNNNNNNNNNNNNANNNNNNNNNNNTCTTCAGGGGACGACTGGATGAATGCCTTCAA  ts-1.fa
3376859  NNNGGTATCACTTGTCCTACAGAGNNNNNNNNNNNNANNNNNNNNNGTTCTTCAGGGGACGACTGGATGAATGCCTTCAA  tsu-1.fa
3376859  NTTGGTATCACTTGTCCTACAGAGAGTANCCCAANNANNNNNNNNGGTTCTTCAGGGGACGACTGGATGAATGCCTTCAA  van-0.fa
 
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCACAGCCGCCGTTACAGTGACCCTGCGC  chr1.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGNNNNNNCCGCCGTTACAGTGACCCTGCGC  bay-0.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  bor-4.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGNNNNNNCCGCCGTTACAGTGACCCTGCGC  br-0.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGNNNNNNCCGCCGTTACAGTGACCCTGCGC  bur-0.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  c24.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  col-0.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  cvi-0.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  est-1.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  fei-0.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  got-7.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  ler-1.fa
3376939  CNCCGCTGCTAATGGACCCTCAGACTNNNNNNCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  lov-5.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  nfa-8.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  rrs-10.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  rrs-7.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  sha.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCACAGCCGCCGTTACAGTGACCCTGCGC  tamm-2.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  ts-1.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  tsu-1.fa
3376939  CTCCGCTGCTAATGGACCCTCAGACTCATTGTCAAAGTACGGTTCCGGTGGTCNCAGCCGCCGTTACAGTGACCCTGCGC  van-0.fa
 
3377019  AGAACGGAGATGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCACCACCCCCAATCGGTTGCCACCAGCACCACCGCCT  chr1.fa
3377019  AGAACGGAGANNNNNNNNCACCAGGGTCTGGTAGCAACCGCCNNNNNNNNNNNNNTCGGTTGCCACCAGCACCACCGCCT  bay-0.fa
3377019  AGAACGGAGATGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCANCANCCCCAATCGGTTGCCACCAGCACCACCGCCT  bor-4.fa
3377019  AGAACGGAGANGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCACNNNNNNNAATCGGTTGCCACCAGCACCACCGCCT  br-0.fa
3377019  AGAACGGAGANGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCANNNNNNNNAATCGGTTGCCACCAGCACCACCGCCT  bur-0.fa
3377019  AGAACGGAGANGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCACNNNNNNNAATCGGTTGCCACCAGCACCACCGCCN  c24.fa
3377019  AGAACGGAGATGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCACCACCCCCAATCGGTTGCCACCAGCACCACCGCCT  col-0.fa
3377019  AGAACGGAGATGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCACNNNNNNNAATCGGTTGCCACCAGCACCACCGCCT  cvi-0.fa
3377019  AGAACGGAGATGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCACNNNNNNNAATCGGTTGCCACCAGCACCACCGCCT  est-1.fa
3377019  AGAACGGAGANGCAGCATCACCAGGGTCTGGTNGCAACCGCCGCACNNNNNNNAATCGGTTGCCACCAGCACCACCGCCT  fei-0.fa
3377019  AGAACGGAGATGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCACNNNNNNCAATCGGTTGCCACCAGCACCACCGCCT  got-7.fa
3377019  AGAACGGAGNNNNNGCATCACCAGGGTCTGGTAGCAACCGCCGNNNNNNNCCCAATCGGTTGCCACCAGCACCACCGCCT  ler-1.fa
3377019  AGAACGGAGANGNNNNNNNNCCAGGGNCTGGTAGCAACCGCCNNNNNNNNNNNNATCGGTTGCCACCANCACCACCGCCT  lov-5.fa
3377019  AGAACGGAGATGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCACNNNNNNNNATCGGTTGCCACCAGCACCACCGCCT  nfa-8.fa
3377019  AGAACGGAGATGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCACNNNNNNNAATCGGTTGCCACCAGCACCACCGCCT  rrs-10.fa
3377019  AGAACGGAGATGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCACCACCCCCAATCGGTTGCCACCAGCACCACCGCCT  rrs-7.fa
3377019  AGAACGGAGANGCAGCANCACCAGGGTCTGGTAGCAACCGCCGCACNNNNNNNAATCGGTTGCCACCAGCACCACCGCCT  sha.fa
3377019  AGAACGGAGATGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCACCNNNNNNAATCGGTTGCCACCAGCACCACCGCCT  tamm-2.fa
3377019  AGAACGGAGANGCAGCANCACCAGGGTCTGGTAGCAACCGCCGCACCNNNNNNAATCGGTTGCCACCAGCACCACCGCCT  ts-1.fa
3377019  AGAACGGAGATGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCACNNNNNNNAATCGGTTGCCACCAGCACCACCGCCT  tsu-1.fa
3377019  AGAACGGAGATGCAGCATCACCAGGGTCTGGTAGCAACCGCCGCACNNNNNNNAATCGGTTGCCACCAGCACCACCGCCT  van-0.fa
 
3377099  ACAGGTTCAGCTTATAGGTATTAGAACCTGAAGAAAAAACCCTGGAAGCGCATTGTGTCCCGTTTTCTGGGACTACGTTA  chr1.fa
3377099  ACAGGTTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNGAAGCGCATTGTGTCCCGTTTNNNNNNNNNNNNNNN  bay-0.fa
3377099  ACAGGTTCAGCTTATAGNNNNNNNNNNNNNNNGAAAAAACCCTGGAAGCGCATTGTGTCCCGTTTTCTGGGACTACGTTA  bor-4.fa
3377099  ACAGGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNGGAAGCGCATTGTGTCCCGTTTTCTGGGANNNNNNNN  br-0.fa
3377099  ACAGGTTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNGAAGCGCATTGTGTCCCGTTTTCTNGNNNNNNNNNN  bur-0.fa
3377099  ACAGGTTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNGGAAGCGCATTGTGTCCCGTTTTCTGNNNNNNNNNNN  c24.fa
3377099  ACAGGTTCAGCTTATAGNNNNNNNNNCCTGAAGAAAAAACCCTGGAAGCGCATTGTGTCCCGTTTTCTGGGACTACGTTA  col-0.fa
3377099  ACAGGTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNGGAAGCGCATTGTGTCCCGTTTTCTGGGNNNNNNNNN  cvi-0.fa
3377099  ACAGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAGCGCATTGTGTCCCGTTTTCTGNGNNNNNNNNN  est-1.fa
3377099  ACAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNGGAAGCGCATTGTGTCCCGTTTNNNNNNNNNNNNNNN  fei-0.fa
3377099  ACAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNGAAGCGCATTGTGTCCCGTTNNNNNNNNNNNNNNNN  got-7.fa
3377099  ACAGGTTCANNNNNNNNNNNNNNNNNNNNNNAGAAAAAACCCTGGAAGCGCATTGTGTCCCGTTTTCTGGGACTACGTTN  ler-1.fa
3377099  ACAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATTGTGTCCCGTNNNNNNNNNNNNNNNNN  lov-5.fa
3377099  ACAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNGGAAGCGCATTGTGTCCCGTTNNNNNNNNNNNNNNNN  nfa-8.fa
3377099  ACAGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNGAAGCGCATTGTGTCCCGNNNNNNNNNNNNNNNNNN  rrs-10.fa
3377099  ACAGGTTCAGCTTATANNNNNNNNNNNNNNNAGAAAAAACCCTGGAAGCGCATTGTGTCCCGTNTTCTGGGACTACGTTA  rrs-7.fa
3377099  ACAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNGAAGCGCATTGTGTCCCGTNNNNNNNNNNNNNNNNN  sha.fa
3377099  ACAGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNAAGCGCATTGTGTCCCGTTTTNNNNNNNNNNNNNN  tamm-2.fa
3377099  ACAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNGAAGCGCATTGTGTCCCGTNNNNNNNNNNNNNNNNN  ts-1.fa
3377099  ACAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNGGAAGCGCATTGTGTCCCGTTNNNNNNNNNNNNNNNN  tsu-1.fa
3377099  ACAGGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAGCGCATTGTGTCCCGTTTTCNGGGANNNNNNNN  van-0.fa
 
3377179  CTCTTATTTTTTCTAGTTTAAGACAGTGATTGGATGATTGTACTACTGTTTTTTGGTCTTTGTAGATAGATATTATCACA  chr1.fa
3377179  NNNNNNNNNRNNNTAGTTTAAGACAGTGATTGGATGATTGTNCTACTGTTTTTTGGTNTTTGTNGATAGATATTATCACN  bay-0.fa
3377179  NNNNNNNNNRNNNNNNNNNNNNNNNGTGATTGGATNNNNNNNNNNNNNNTTTTTGGNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
3377179  NNNNNNNNNRNNNNNNNNTAAGACAGTGATTGGATGATTGTNNNNNNNTTTTTTGGTNNNNNNNNNNNNNNNNTATCACA  br-0.fa
3377179  NNNNNNNNNRNNNNAGTTTAAGACNGTGATTGGATGATTGTNCTACTGTTTTTTGGNCTTTGTAGANAGATATTATCACA  bur-0.fa
3377179  NNNNNNNNNRNNNNNNNTTNANNCNGTGATTGGATGATTGTNNNNCTGTTTTTTGGTCTTTGTAGATAGATATTATCACA  c24.fa
3377179  CNNNNNNNNRNNNNNNNNNNNNNNNNTGATTGGATGNTNNTNNNNNNNNTTTTTGGTNTNNNNNNNNNNNNNTTATCACA  col-0.fa
3377179  NNNNNNNNNRNNNNNNNTNAANACNGTGATTGGATGATTGTACTACTGTTTTTTGGTCTTTGNNNNNNNNNATTATCACA  cvi-0.fa
3377179  NNNNNNNNNRNNNNNNNNNNNNNNNGTGATTGGATGATTGTNNNNCTGTTTTTTGGNNNNNNNNNNNNNNNNNNNTCACA  est-1.fa
3377179  NNNNNNNNNRNNNNNNTTTAAGACNGTGATTGGATGATTGTACTACTGTTTTTTGGTCTTTGTAGATNGATATTATCACA  fei-0.fa
3377179  NNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
3377179  NNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
3377179  NNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3377179  NNNNNNNNNRNNNNNNNNNNNNNNNNTGATTGGATGNTNNTNNNNCTGTTTTTTGGTNTTTGTANNNNNNNNNNATCACA  nfa-8.fa
3377179  NNNNNNNNNRNNNNNNNNNNNNNNAGTGATTGGNNNNNNNTNNNNNNNNNNTTTGNNNNNNNNNNNNNNNNNNNNNNNNA  rrs-10.fa
3377179  CNNNNNNNNRNNNNNNNNNNNNNNNNNNATTGGNNNNNNNNNNNNNNNNNTTTTGGNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
3377179  NNNNNNNNNRNNNNNNNNNNNNNNNNNNNTTGGATGNTNNNNNNNNTGTTTTTTGGTCTTNNNNNNNNNNNNNNANNNCA  sha.fa
3377179  NNNNNNNNNRNNNNNNNNNNNNNNNNTGATTGGATNNNNNNNNNNNNNTTTTTTGGTNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
3377179  NNNNNNNNNRNNNNNNNNNNNNNNNNNNATTGGATGNTTGTACTNNNNNTTTTTGGTNTNNNNNNNNNNNNNNTANNNNN  ts-1.fa
3377179  NNNNNNNNNRNNNNNNNNNNNNNNNNTGATTGGNNNNNNNNNNNNNNNNNNTTTGGTCNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
3377179  NNNNNNNNNRNNNNNNNNNNAGACAGTGATTGGATGATTGTNNNNNNNNTTTTTGGTNNNNNNNNNNNNNNNNNNTCACA  van-0.fa
 
3377259  CACATGTGTTGGCAGCTAAAAAAGAGTTTGGTCTCATGAGTCAAATGTCTGTTTGAATTTTTGTTTTATTTCTTATTCAA  chr1.fa
3377259  CACATGNGTTGGCAGCNAAAAAANAGTTTGNNNNNNNGNGTCAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA  bay-0.fa
3377259  NACATGTGTTGGCAGCTAAAAAAGAGTTTGNNNNNNTGAGTCAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
3377259  CACATGTGTTGGCAGCTAAAAAAGAGTTTGGTCTCATGAGTCAAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
3377259  CACATGTGTTGGCAGCTAAAAAAGAGTTTGNNNNNNTGAGTCAAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
3377259  CACATGTGTTGGCAGCTAAAAAAGAGTTTGGTCTCATGAGTCAAATGTCNGTNNNNNNNNNNNNNNNNNNNNNNNNNNNA  c24.fa
3377259  CACATGTGTTGGCAGCTAAAAAAGAGTTTGGTCNCATGAGTCAAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
3377259  CACATGTGTTGGCAGCTAAAAAAGAGTTTGGTCTCATGAGTCAAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
3377259  CACATGTGTTGGCAGCTAAAAAAGAGTTTGGTNTCATGAGTCAAATGTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
3377259  CACATGTGTTGGCAGCTAAAAAAGAGTTTGGTCNCATGAGTCAAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
3377259  NNCATGTGTTGGCAGCTAAAAAAGNGTTTGGTNNNNTGAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
3377259  NNNNNNNNNTGGCAGCTAAAAAAGAGTTTGGTNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
3377259  NNNNNNNNNNGGCAGCNAAAAAAGAGTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3377259  CACATGTGTTGGCAGCTAAAAAAGAGTTTGNNNNNNTGAGTCAAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
3377259  CACATGTGTTGGCAGCTAAAAAAGAGTTTGGTCTCATGAGTCAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
3377259  NACATGTGTTGGCAGCTAAAAAAGAGTTTGGTNTCATGAGTCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
3377259  CNNNNGTNTTGGCAGCTAAAAAAGAGTTTGNNNNNNNNNNTNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
3377259  NNNNNNNGTTGGCAGCTAAAAAAGAGTTTGNNNNNNNGAGTCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
3377259  NNCATGTGTTGGCAGCTAAAAAAGAGTTTGGTCNCNNGNGTCAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
3377259  NACATGTGTTGGCAGCTAAAAAAGAGTTTGGTCNCATGAGTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
3377259  CACATGTGTTGGCAGCTAAAAAAGAGTTTGGTCTCATGAGTCAAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
3377339  CTTTTCTTGGCATCCATTTTTTGAGCACGCTATGCTGTAGTAGTTATAGAATGAATTTTGTATCTGATATTCTTATGAAT  chr1.fa
3377339  CTTTTCNNNNNNNCCATTTTTTGAGCACGCTATGCTGTAGTAGTTATAGAATGAATTTTGTNTCNNNNNNNNTTATGAAT  bay-0.fa
3377339  NNTTTCTTGGCATCCATTTTTTGAGCACGCTATGCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
3377339  NNNTTCNNNNNATCCATTTTTTGAGCACGCTATGCTGTAGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGANT  br-0.fa
3377339  NTTTTCNNNNNATCCATTTTTTGAGCACGCTATGCTGTAGTAGTTATAGAATGAATTTTGTATCNNNNNNNNTTATGAAT  bur-0.fa
3377339  CTTTTCTTGNCATCCATTTTTTGAGCACGCTATGCTGTAGTAGTTATAGAATGAATTTTGNNNNNNNNNNNNNNATGAAT  c24.fa
3377339  NNNTTCTTGGCATCCATTTTTTGAGCACGCTATGCTGTAGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAT  col-0.fa
3377339  NNTTTCTNGNCATCCATTTTTTGAGCACGCTATGCTGTAGTAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
3377339  NNNTTCTTGGCATCCATTTTTTGAGCACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT  est-1.fa
3377339  NNTTTCTNGGCATCCATTTTTTGAGCACGCNATGCTGTNGTAGTTNTNNNNNNNNNTTTNNNNNNNNNNNNNNNNNNAAT  fei-0.fa
3377339  NNNNNNNNNNNNTCCATTTTTTGAGCACGCTATGCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
3377339  NNTTTCTNGGCATCCATTTTTTGAGCACGCTATGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
3377339  NNNNNCTTNNNNNNNATTTTTTGAGCACGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3377339  NNTTTCTNGGCATCCATTTTTTGAGCACGCTATGCTGTAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAT  nfa-8.fa
3377339  NTTTTCTTGNCATCCATTTTTTGAGCACGCTATGCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
3377339  NNNTTCTTNNNNTCCATTTTTTGAGCACGCTATGCTGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
3377339  NNNTTCTTGNCATCCATTTTTTGAGCACGCTATGCTGTAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
3377339  NNNTTCTTGNCATCCATTTTTTGAGCACGCTATGCTGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
3377339  NNNTTCTNGGCATCCATTTTTTGAGCANNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
3377339  NNNNNNTNGGCATCCATTTTTTGAGCACGCTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
3377339  NNTTTCTTGGCATCCATTTTTTGAGCACGCTATGCTGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT  van-0.fa
 
3377419  CTGAACTGTTTGGGTAAATTACTAAATTTATAAAATCGAAGTTTCATAGACTACTTCCATTGTTTAAGCCTTGAGAGAAT  chr1.fa
3377419  CTGAACTGTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTCATAGACTACTTCCATTGTTTAAGCCTTGAGAGAAT  bay-0.fa
3377419  NTGAACTGTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTTNATNGNNNNNNNCCATTGTTTAAGCCTNGAGAGAAT  bor-4.fa
3377419  CTGAACTGTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACTACTTCCATTGTNNNNNNNNNNNNNNNAT  br-0.fa
3377419  CTGAACTGTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGACTACTTCCATTGTTTAAGCCTTGNGAGAAT  bur-0.fa
3377419  CTGAACTGTTTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATAGACTACTTCCATTGTTTAAGCNNNNNNNNNAT  c24.fa
3377419  CTGAACTGTTTGGGTNNNNNNNNNNNNNNNNNNNNNNGAAGTTTCATAGACTACTTCCATTGTTTAAGCCTTGAGAGAAT  col-0.fa
3377419  NTGAACTGTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTACTTCCATTGTNNNNNNNNNNNNNNNAT  cvi-0.fa
3377419  CTGAACTGTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNTACTTCCATTGTNNNNNNNNNNNNNNNNT  est-1.fa
3377419  CTGAACTGTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTACTTCCATTGTNNNNNNNNNNNNNNAAT  fei-0.fa
3377419  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
3377419  NNNNNNNNNTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNTTGTTTAAGCCTNNNGAGAAN  ler-1.fa
3377419  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3377419  CTGAACTGTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCCATTGTNNNNNNNNNNNNNNNAT  nfa-8.fa
3377419  NTGAACTGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCATTGNNNNNNNNNNNNNNNNNN  rrs-10.fa
3377419  NNGAACTGNTTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCNNNNNNNNNNNCCATTGTTTAAGCCTTGANAGAAT  rrs-7.fa
3377419  NNGAACTGTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNCCNTTNNNNNNNNNNNNNNNNNAT  sha.fa
3377419  NTGAACTGTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATTGTNNNNNNNNNNNNNNNNN  tamm-2.fa
3377419  NNNAACTGTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCCATTGTNNNNNNNNNNNNNNNNT  ts-1.fa
3377419  NNNNNNNGNTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
3377419  CTGAACTGTTTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGACTACNTCCATTGNNNNNNNNNNNNNNNAAT  van-0.fa
 
3377499  ACTTTCAGGGCTAGTTGATGAAATCACTAAATTTTGGGGTTTATTGGTAAAGTTGTCGTATGCGGTAGTACGTAGTTGCA  chr1.fa
3377499  ACTTTCAGGGCTAGTTGATGAAATCACTAAATTTTGGGNNNNNNNNNNNNNATTGTCGTATGCGGTAGTACGTAGNNNNN  bay-0.fa
3377499  ACTTTCAGGGCTAGTTGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGTTGTCGTATGCGGTAGTACGTAGTTGCA  bor-4.fa
3377499  ACTTTCAGGGCTAGTTGATGAANTNNCNAAATTTTNNNNNNNNNNNNNNNNANTGTCGTATGCGGTAGTACGTAGTTGCN  br-0.fa
3377499  ACTTTCAGGGCTAGTTGATGAAATCACTAAATTTTGGGGNNNNNNNNNNNNANNGTCGTATGCGGTAGTACGTAGTTGNN  bur-0.fa
3377499  ACTTTCAGGGCTAGTTGATGAAATCACTAAATTTTGGGGNNNNNNNNNNNNANNGTCGTATGCGGTAGTACGTAGTTGNN  c24.fa
3377499  ACTTTCAGGGCTAGTTGATNNNNNNNNNAAATTTNNNNNNNNNNNNGNAAAGTTGTCGTATGCGGTAGTACGTAGTTGCA  col-0.fa
3377499  ACTTTCAGGGCTAGTTGATGAANTCACTAAATTTTGGGGNNNNNNNNNNNNANNGTCGTATGCGGTAGTACGTAGTTGCA  cvi-0.fa
3377499  ACTTTCAGGGCTAGTTGATGAAANNNNNNNNTTTTGNNNNNNNNNNNNNNNNNNNTCGTATGCGGTAGTACGTNNNNNNN  est-1.fa
3377499  ACTTTCAGGGCTAGTTGATGAAATCACTAAATTTNGGGGNNNNNNNNNNNNANTGTCGTATGCGGTAGTACGNNNNNNNN  fei-0.fa
3377499  NNNNTCAGGGCTAGTTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNTATGCGGTAGTACGTAGTTNNN  got-7.fa
3377499  ACTTTCAGGGCTAGTTGNNNNNNNNNNNNNNTTNTNNNNNNNNNNNNNNAAGTTGTCGTATGCGGTAGTACGTAGTTGCA  ler-1.fa
3377499  NNNNNCAGGGCTAGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNTATGCGGTAGTACGTANNNNNN  lov-5.fa
3377499  ACTTTCAGGGCTAGTTGATNNNNNNNCTAANTTTTGGGGNNNNNNNNNNNNANNGTCGTATGCGGTAGTACGTAGNNNNN  nfa-8.fa
3377499  ACTTTCAGGGCTAGTTGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNGTCGTATGCGGTAGTACGTAGTTGCN  rrs-10.fa
3377499  ACTTTCAGGGCTAGTTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGTTGTCGTATGCGGTAGTACGTAGTTGCA  rrs-7.fa
3377499  ACTTTCAGGGCTAGTTGANNNNNNNNNTAAATTTNGGGGNNNNNNNNNNNNANNNTCGTATGCGGTAGTACGTANNNNNN  sha.fa
3377499  ACTTTCAGGGCTAGTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNGTCGTATGCGGTAGTACGTAGTNNNN  tamm-2.fa
3377499  ACTTTCAGGGCTAGTTGANNNNNNNNNNANNTNTNNGNNNNNNNNNNNNNNANNNTCGTATGCGGTAGTACGNNNNNNNN  ts-1.fa
3377499  NCTTTCAGGGCTAGTTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATGCGGTAGTACGTANNNNNN  tsu-1.fa
3377499  ACTTTCAGGGCTAGTTGATGNNNNNACTAAATTTTNNNNNNNNNNNNNNNNNNNGTCGTATGCGGTAGTACGTAGTTGCA  van-0.fa
 
3377579  AATGCACCGCAAGTATTTTCTTTATTCAGAAAGCCTAAAATTAGCCAAACGGCATCGGATTATCCCTCGAACCAAATTAG  chr1.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATTAGCCAAACGGCATCGGATTATCCCTCGAACCNNNNNNN  bay-0.fa
3377579  AATGCACCGCAAGTATTTTNNNNNNNNNNNNNNNCTAAAATTAGCCAAACGGCATCGGATTATCCCTCGAACCAAANNNN  bor-4.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTAGCCAAACGNNNNNNNATTATCCCTCGAANNNNNNNNN  br-0.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAAAATTAGCCAAACGGCATCGGATTATCCCTCGAANNNNNNNNN  bur-0.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATTAGCCAAACGGCATCGGATTATCCCTCGNNNNNNNNNNN  c24.fa
3377579  AATGCACCGCAAGTATTTTNNNNNNNNNNNNNGCCTAAAATTAGCCAAACGGCATCGGATTATCCCTCGAACCAAATNNN  col-0.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAAAATTAGCCAAACGGCATCGGATTATCCCTCNNNNNNNNNNNN  cvi-0.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAATTAGCCAAACGGCATCGGATTATCCCTCNNNNNNNNNNNN  est-1.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAATTAGCCAAACGGCATCGGATTATCCCTCGNNNNNNNNNNN  fei-0.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTAGCCAAACGGCATCGGATTATCCCTCNNNNNNNNNNNN  got-7.fa
3377579  AATGCACCGCAAGTATTTNNNNNNNNNNNNNNNCCTAAAATTAGCCAAACGGCATCGGATTATCCCTCGAACCAANNNNN  ler-1.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTAGCCAAACGGCATCGGATTATCCCTCGNNNNNNNNNNN  lov-5.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATTAGCCAAACGGCNNNNGATTATCCCTCGAANNNNNNNNN  nfa-8.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATTAGCCAAACGGCATCGGATTATCCCTCNNNNNNNNNNNN  rrs-10.fa
3377579  AATGCACCGCAAGTATNNNNNNNNNNNNNNNNNNNNAAAATTAGCCAAACGGCATCGGATTATCCCTCGAACCAANNNNN  rrs-7.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATTAGCCAAACGGCATCGGATTATCCCTCNNNNNNNNNNNN  sha.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTAGCCAAACGGCATCGGATTATCCCTCGNNNNNNNNNNN  tamm-2.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATTAGCCAAACGGCATCGGATTATCCCTCGNNNNNNNNNNN  ts-1.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTAGCCAAACGGCATCGGATTATCCCTCNNNNNNNNNNNN  tsu-1.fa
3377579  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAATTAGCCAAACGGCATCGGATTATCCCTCGNNNNNNNNNNN  van-0.fa
 
3377659  TAACATACAATTTCTTATAAGTAATTTTAACTTTGTTAAACACCAGGGTTTAAATGAGATTTTCCTGAACATATGGTGTT  chr1.fa
3377659  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTAAATGAGATNNNNNCNNNNNNNNNNTGTT  bay-0.fa
3377659  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAAATGAGATTTTCCTGAANNNNNNNNNNN  bor-4.fa
3377659  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTAAATNNNNNNNNNNCNNNNNNNNNNNNNN  br-0.fa
3377659  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTTTAAATGAGATNNNNNCNNNNNNNNNNNNTT  bur-0.fa
3377659  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTAAATGAGNNNNNNNCNNNNNNNNNNNGTT  c24.fa
3377659  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAATGAGATTTTCCTGAANNNNNNNNNNN  col-0.fa
3377659  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTAAATGNNNNNNNNNCNNNNNNNNNNNNNN  cvi-0.fa
3377659  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTAAANNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
3377659  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTAANNNNNNNNNNNNCNNNNNNNNNNNNNT  fei-0.fa
3377659  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNN  got-7.fa
3377659  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCNNNNNNNNNNNNNNNN  ler-1.fa
3377659  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNN