Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 3380229 - 3382313


<
Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATAAGCCATGCATATCTCTATATATCAAGCTTATGTGTCCTTCACTTG  chr1.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATAAGCCATGRATATCTCTATATATCAAGCTTATGTGTCCTTCACTTG  bay-0.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATAAGCCANGRNNNNNNNNNNNNNNNNNNNTTATGTGTCCTTCACTTG  bor-4.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATAAGCCATGRATATCTCTATATNTCAAGCTTATGTGTCCTTCACTTG  br-0.fa
3380229  ANCCAGTGATCAGGTAACAAGGGCTCATTAGTATAAGCCATGRATATCTCTATATATCAAGCTTATGTGTCCTTCACTTG  bur-0.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATAAGCCATGRATATCTCTATATATCAAGCTTATGTGTCCTTCACTTG  c24.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATAAGCCATGRATATCTCTATATNTCAAGCTTATGTGTCCTTCACTTG  col-0.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATAAGCCATGRATATCTCTATATATCAAGCTTATGTGTCCTTCACTTG  cvi-0.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGNNNNCNNNNNNRNNNTCTCNNNNNNNNNNNNTTATGTGTCCTTCACTTG  est-1.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTNNNCNNNNNNRNNNTCTCTATATATCAAGCTTATGTGTCCTTCACTTG  fei-0.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATANNNNNNNRNNNNNNNNNNNNNNNNNNNTTATGTGTCCTTCACTTG  got-7.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATANGNNNNNRNNNNNNNNNNNNNNNNNNNTTATGTGTCNTTCACTTG  ler-1.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTN  lov-5.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATAAGCCATGRANNTCNNNNNNNNTCAAGCTTATGTGTCCTTCACTTG  nfa-8.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATAAGCCATGRATNTCTCTANNNNNNNNGCTTATGTGTCCTTCACTTG  rrs-10.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATAAGCCNNGRANNTNNNNNNNNNNNNNGCTTATGTGTCCTTCACTTG  rrs-7.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATAAGCCNNGRNNNTCNNNNNNNNNCAAGCTTATGTGTCCTTCACTTG  sha.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATAAGCCNTGRNNNTCNNNNNNNNNNAAGCTTATGTGTCCTTCACTTG  tamm-2.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTNNNCNNNNNNRNNNTCTNNNNNNNTCAAGCTTATGTGTCCTTCACTTG  ts-1.fa
3380229  AACCAGTGATCAGGTAACAAGGGCTCATTAGTATAANNNNNNRNNNNNNNNNNNNNNNNNNCTTATGTGTCCTTCACTTN  tsu-1.fa
3380229  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNAGCTTATNNNNNNNNNNNNNN  van-0.fa
 
3380309  TACTTTTATTATATGACTCATATAAAACATTGTGGTTAGCAAGCTGTAGCAAAAAGAGATGATAATATGGCGCATTGGGT  chr1.fa
3380309  TACTTTTATTNNNNRNNNNNNNNNNNNTANTGTGGTTAGCAAGCTGTAGCAAAAAGAGATNNNNNNNNNNTNNNNNNGGN  bay-0.fa
3380309  NNNNNNNNNNNNNNRNNNNNNNNNNAACATTGTGGTTAGCAAGCTGTAGCAAAAAGNGATGATAATATGGCGCATTGGGT  bor-4.fa
3380309  TACTTTTANNNNNNRNNNNNNNNNNNNNNNNNTGGTTAGCAAGCTGTAGCAAAAAGAGNNNNNNNNNNNNTNNNNNGGGT  br-0.fa
3380309  TACTTTTATNNNNNRNNNNNNNNNNNNTNNNNNGGTTAGCAAGCTGTAGCAAAAAGAGATNNNNNNNNNNTNNNTTGGNT  bur-0.fa
3380309  TACTTTTATTNNNNRNNNNNNNNNNNNTNNNNNGGTTAGCAAGCTGTAGCAAAAAGAGATNNNNNNNNNGTGCATTGGGT  c24.fa
3380309  TNNNNNNNNNNNNNRNNNNNNNNNAAACATTGTGGTTAGCAAGCTGTAGCAAAAAGNGATGATAATATGGCGCATTGGGT  col-0.fa
3380309  TACTTTTNNNNNNNRNNNNNNNNNNNNTNNNNNNGTTAGCAAGCTGTAGCAAAAAGAGANNNNNNNNNNNTNNNNNGGGT  cvi-0.fa
3380309  TACNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNTAGCAAGCTGTAGCAAANNNNNNNNNNNNNNNNNTNNNTTGGGT  est-1.fa
3380309  TACTTTTNNNNNNNRNNNNNNNNNNNNTNNNNTGGTTAGCAAGCTGTAGCAAAAAGAGANNNNNNNNNGGTGCATTGGGT  fei-0.fa
3380309  TNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNTAGCAAGCTGTAGCAAANNNNNNNNNNNNNNNNNTNNNTTGGGT  got-7.fa
3380309  TNNNNNNNNNNNNNRNNNNNNNNNAAACATTGTGGTTAGCAAGCTGTAGCAAAAAGAGNTGATAATATGGCGCATTGGGT  ler-1.fa
3380309  NNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNCAAGCTGTAGCAAANNNNNNNNNNNNNNNNNTNNNNNNNNT  lov-5.fa
3380309  TACTTTNNNNNNNNRNNNNNNNNNNNNTNNNNNNNTTAGCAAGCTGTAGCAAAAAGAGANNNNNNNNNNNTNNNNNGGGT  nfa-8.fa
3380309  TNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNGGTTAGCAAGCTGTAGCAAAAANNNNNNNNNNNNNNNTNNNTTGGGT  rrs-10.fa
3380309  NNNNNNNNNNNNNNRNNNNNNNNNNAACATTGTGGTTAGCAAGCTGTAGCAAAANNNNNNGATAATATGGCGCATTGGGT  rrs-7.fa
3380309  TACTNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGCAAAAAGAGNNNNNNNNNNNNTNNNNNGGNT  sha.fa
3380309  NNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNGTTAGCAAGCTGTAGCAAAAAGNNNNNNNNNNNNNNTNNNNNGGGT  tamm-2.fa
3380309  TACTNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNTTAGCAAGCTGTAGCAAAAAGAGANNNNNNNNNNNTNNNTTGGGT  ts-1.fa
3380309  NNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNAGCAAGCTGTAGCAAANNNNNNNNNNNNNNNNNNNNNNNGGGT  tsu-1.fa
3380309  NNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
3380389  TTCTGCAGGGGGACTATGCAGATGATGAACGGTTTGAGGATTATCTATCAAGTTTTGGATTTGGAAGCTTTTTACTTACT  chr1.fa
3380389  TTNNNNNGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNRNNTNNNNNNNNNNNNNNNNNRN  bay-0.fa
3380389  TTCTGCAGGGGGACTATGCAGATGATGAACGGTTTGAGGANNNNNNNNNNNNNTNNGRNTNTNNNNNNNNNNNNNNNNRN  bor-4.fa
3380389  TTCTGCAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRN  br-0.fa
3380389  TTNTGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTNNNNNNNNNNNNNNNNRN  bur-0.fa
3380389  TTCTGCAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNTTNNNNNNNNNNNNNNNNRN  c24.fa
3380389  TTCTGCAGGGGGACTATGCAGATGATGAACGGTTTGAGGATTATCTATCAAGTTTTGRNNTTNNNNNNNNNNNNNNNNRN  col-0.fa
3380389  TTCTGCAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTGNNNNNNNNNNNNNNNRN  cvi-0.fa
3380389  TTCTGCAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTNNNNNNNNNNNNNNNNRN  est-1.fa
3380389  TTCTGCAGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTGNNNNNNNNNNNNNNNRN  fei-0.fa
3380389  TTCTGCAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRN  got-7.fa
3380389  TTCTGCAGGGGGACTATGCAGATGATGAACGGTTTGAGGATTNTCTANNNNNNTNNGRNTNTGGNANNNNNNNNNNNNRN  ler-1.fa
3380389  TTCTGCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRN  lov-5.fa
3380389  TTCTGCAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTNNNNNNNNNNNNNNNNRN  nfa-8.fa
3380389  TTCTGCAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNTNNNNNNNNNNNNNNNNRN  rrs-10.fa
3380389  TTCTGCAGGGGGACTATGCAGATGATGAACGGTTTGAGGATTNTCTATCAAGTTTTGRNNTTGGAAGNNTNNNNNNNNRN  rrs-7.fa
3380389  TTCTGCAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRN  sha.fa
3380389  TTCTGCAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRN  tamm-2.fa
3380389  TTCTGCAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRN  ts-1.fa
3380389  TTCTGCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNRN  tsu-1.fa
3380389  NNNNNNNNNNGGACTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGRATTTGGNNNNNNNNNNNNNNRN  van-0.fa
 
3380469  TTTGTTTTACTATTTTTGGATTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGAGAAGAGAGTTGATTGTTTGG  chr1.fa
3380469  NNNNNNNNNNNNNNTTTGGATTTTNTCGGCATTTGTTATTCACGTTGGACGAAATGTAGAGAAGAGANTTGATTGTTTGG  bay-0.fa
3380469  NNNNNNNNNNNNNNNTTGGATTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGNNNNNNNNNTTGATTGTTTGG  bor-4.fa
3380469  NNNNNNNNNNNNNNNNNNNNNTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGAGAAGAGNGTTGATTGTTTGG  br-0.fa
3380469  NNNNNNNNNNNNNNNNNNGATTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGAGANGAGAGTTGNTTGTTTGG  bur-0.fa
3380469  NNNNNNNNNNNNNNNNTGGATTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGAGAAGAGAGTTGATTGTTTGG  c24.fa
3380469  NNNNNNNNNNNNNNTTTGGATTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGAGAANAGAGTTGATTGTTTGG  col-0.fa
3380469  NNNNNNNNNNNNNNNNNGGATTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGAGAAGAGNGTTGATTGTTTGG  cvi-0.fa
3380469  NNNNNNNNNNNNNNNNNNNATTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGANNNNNNNGTTGATTGTTTGG  est-1.fa
3380469  NNNNNNNNNNNNNNNNTNGATTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGAGAAGAGAGTTGATTGTTTGG  fei-0.fa
3380469  NNNNNNNNNNNNNNNNNNNNNTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGNNNNNNNNNNNGATTGTTTGG  got-7.fa
3380469  NNNNNNNNNNNNNNNTTGGATTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGNNNNNNNNNNNGATTGTTTGG  ler-1.fa
3380469  NNNNNNNNNNNNNNNNNNGNTTTTCTCGGCATTTGTTATTCACGTTGGACGAAANNNNNNNNNNNNNNNNNNTTGTTTGG  lov-5.fa
3380469  NNNNNNNNNNNNNNNNNNGATTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTNGNNNNNNNAGTTGATTGTTTGG  nfa-8.fa
3380469  NNNNNNNNNNNNNNNNNNNNTTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGAGAAGAGAGTTGATTGTTTGG  rrs-10.fa
3380469  NNNNNNNNNNNNNNTTTGGATTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGAGAAGAGAGTTGATTGTTTGG  rrs-7.fa
3380469  NNNNNNNNNNNNNNNNNNNNNTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTNGNNNNNNNNNNNGNTTGTTTGG  sha.fa
3380469  NNNNNNNNNNNNNNNNNNNNNTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGAGNNNNNNNNNGATTGTTTGG  tamm-2.fa
3380469  NNNNNNNNNNNNNNNTTGGATTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGTAGAGAAGNGAGTTGATTGTTTGG  ts-1.fa
3380469  NNNNNNNNNNNNNNNNNNNNNTTTCTCGGCATTTGTTATTCACGTTGGACGAAATGNNNNNNNNNNNNTTGATTGTTTGG  tsu-1.fa
3380469  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
3380549  AGACAGCTATGAGTGATCAATTGTGGTTTTTAGATGTTTTGAATTTTTTTATACTTGGAAATTGCAATAGTTTTTTTTTT  chr1.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTTTNNNNNNNTNNNNNNNTTNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  bay-0.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTGNNNRNNRNNRRRRRRR  bor-4.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  br-0.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  bur-0.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTNNNNNNNNNTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  c24.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTNNNNNNNNNNNNNNNNNTTNNNNNNCTTGGNNNTTGNNNRNNRNNRRRRRRR  col-0.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  cvi-0.fa
3380549  AGACAGCTATGAGTGATCAATTGTGNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  est-1.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  fei-0.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  got-7.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  ler-1.fa
3380549  AGACAGCTATGAGTGATCAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  lov-5.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  nfa-8.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  rrs-10.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  rrs-7.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  sha.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  tamm-2.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  ts-1.fa
3380549  AGACAGCTATGAGTGATCAATTGTGGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  tsu-1.fa
3380549  NNNCAGCTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNRRRRRRR  van-0.fa
 
3380629  TTTTTTAAATTGCAATAGTTATAATGTTATCGTTGATCCTGCAATAAATACATAGTACTTGCTTATCATAATTTTAAAGC  chr1.fa
3380629  RRRRNNNNNNNNNNNNNGTTATAATGTTATCGTTGATCCTGCAATAAATANNNNNNNNNNNNNNNNNATAATNNNNNNNN  bay-0.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNNNNGTTATCGTTGATCCTGCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC  bor-4.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNNNNGTTATCGTTGATCCTGCAATAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
3380629  RRRRNNNNNNNNNNNNNNNNATAATGTTATCGTTGATCCTGCAATAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bur-0.fa
3380629  RRRRNNNNNNNNNNNNNNNTATAATGTTATCGTTGATCCTGCAATAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNAATGTTATCGTTGATCCTGCAATAAANNNNNNNNNNNNNCTTATCATAATTTTNAAGC  col-0.fa
3380629  RRRRNNNNNNNNNNNNNNNNATAATGTTATCGTTGATCCTGCAATAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNNNTGTTATCGTTGATCCTGCAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
3380629  RRRRNNNNNNNNNNNNNNNNATAATGTTATCGTTGATCCTGCAATAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNNNNNTTATCGTTGATCCTGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNNNNNNNATCGTTGATCCTGCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTGATCCTGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNNNNGTTATCGTTGATCCTGCAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNNNNGTTATCGTTGATCCTGCAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNNNNNNNATCGTTGATCCTGCAATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGN  rrs-7.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNNNTGTTATCGTTGATCCTGCAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNNNNNTTATCGTTGATCCTGCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNNNNNNTATCGTTGATCCTGCAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTGATCCTGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
3380629  RRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
3380709  ACTTACAACTATCATAACCTTGATGCAATTACAATACTGATCGTTATAACTTATAGGATAATTTTGAAAATTGTCATATT  chr1.fa
3380709  NNNNNNNNNNNNNNNNNNNNNGATGCNNCNNRANNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  bay-0.fa
3380709  ACTTACAACTATCATAACCTTGATGCAATTARAATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  bor-4.fa
3380709  NNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  br-0.fa
3380709  NNNNNNNNNNNNNNNNNNNNNGANGNNACNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  bur-0.fa
3380709  NNNNNNNNNNNNNNNNNNNNNNNNGNNACNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  c24.fa
3380709  ACTTNCAACTATCATAACCTTGATGCAATTARAATACTGATCGTTATNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  col-0.fa
3380709  NNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  cvi-0.fa
3380709  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  est-1.fa
3380709  NNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  fei-0.fa
3380709  NNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  got-7.fa
3380709  NNTTNCAACTATCATAACCTTGATGCAANNARAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  ler-1.fa
3380709  NNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  lov-5.fa
3380709  NNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  nfa-8.fa
3380709  NNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  rrs-10.fa
3380709  ACTTNCAACTATCATAACCTTGATGCAATTARAANACTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  rrs-7.fa
3380709  NNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  sha.fa
3380709  NNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  tamm-2.fa
3380709  NNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  ts-1.fa
3380709  NNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  tsu-1.fa
3380709  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNN  van-0.fa
 
3380789  TTTGAGTTTTTGTTTGAAAATTATACTCTATCCTATTTTTTAAATAATAATATAATTTTAAATATGTTAAATGATTTTTC  chr1.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNTN  bay-0.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNATTTTTC  bor-4.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  br-0.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  bur-0.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  c24.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNTTTTTC  col-0.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  cvi-0.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  est-1.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  fei-0.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  got-7.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNTTTTTC  ler-1.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  lov-5.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  nfa-8.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  rrs-10.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNATTTTTC  rrs-7.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  sha.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  tamm-2.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  ts-1.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  tsu-1.fa
3380789  NRNRRRRRRRRRRRRRRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRNNNNRRRRRRRRRRNNNNNNNNNNNNNNN  van-0.fa
 
3380869  GGTTCAGATTTAAAACAAAAAGATTATTTTTAATTAATTAAAATTAAATACAAATTTTTGAAAAAAAAGAATAAACTTAA  chr1.fa
3380869  GGNTCNGATTTAAAARNNNAANANNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  bay-0.fa
3380869  GGTNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  bor-4.fa
3380869  NNNNCNGNNTNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  br-0.fa
3380869  GGTTCAGATTNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  bur-0.fa
3380869  NNNTCAGATTTANNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  c24.fa
3380869  GGTTCNGNNNNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  col-0.fa
3380869  NNNTCNGATTTANNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  cvi-0.fa
3380869  NNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  est-1.fa
3380869  NNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  fei-0.fa
3380869  NNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  got-7.fa
3380869  GGTTCNGANNNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  ler-1.fa
3380869  NNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  lov-5.fa
3380869  NNNTCNGNNTNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  nfa-8.fa
3380869  NNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  rrs-10.fa
3380869  GGTNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  rrs-7.fa
3380869  NNNNNNGNNNNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  sha.fa
3380869  NNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  tamm-2.fa
3380869  NNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  ts-1.fa
3380869  NNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  tsu-1.fa
3380869  NNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNRRRRRNNRNRRRRRRRRRRRRNNNNNNNNNNNNNNNNNRRRRRRRR  van-0.fa
 
3380949  TTTAAAATCTTAATTATTATTTTACTATTTTAAGATAAAGAAAGTTTATATATTTTAAATATTAAAATCTAACATGATAT  chr1.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRAAGNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  bay-0.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  bor-4.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  br-0.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  bur-0.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  c24.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  col-0.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  cvi-0.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  est-1.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  fei-0.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  got-7.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  ler-1.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  lov-5.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  nfa-8.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  rrs-10.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  rrs-7.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  sha.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  tamm-2.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  ts-1.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  tsu-1.fa
3380949  RRRRRRRRRRRRRRNNNNNRNNNNNNNNNNNNNNNNRNNNNRNRNNNRNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRN  van-0.fa
 
3381029  TATCAAAAACAAATATTTTAAAGTTGATCACTTTGTCACATTATATATAAAAAATCAATCTAACTCCAAACCTATAATTC  chr1.fa
3381029  NNNNNAAAACNNNNNNNNRRRNNNTGATCACTTTGTCACNNNNNNNNNNNNAAATCAATCNAACTCCAAACCTANNNRNN  bay-0.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNNNCACTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNN  bor-4.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCCANNNNNNNNNRNN  br-0.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNGATCACTTTGTCNNNNNNNNNNNNNNNNNNNNNNNNAACTCCAAANNNNNNNRNN  bur-0.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANTCNAACTCCAAACCNNNNNRNN  c24.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNGNTCACTTTGTCNNNNNNNNNNNNNNNNNNNNNNNNNACTCCAANNNNNNNNRNN  col-0.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNGATCACTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNAANTCNNNNNNNNNNNRNN  cvi-0.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNNTCACTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCNNNNNNNNNNNRNN  est-1.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNTGATCACTTTGTCNNNNNNNNNNNNNNNNNNNNNTCTAACTCCNANNNNNNNNRNN  fei-0.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNRNN  got-7.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNTTTGTCNNNNNNNNNNNNNNNNNNNNNTCNAANTNNNNNNNNNNNNRNN  ler-1.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNN  lov-5.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAANTNNNNNNNNNNNNRNN  nfa-8.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNRNN  rrs-10.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNNNNACTTTGTNNNNNNNNNNNNNNNNNNNNANTCNAANTCNNNNNNNNNNNRNN  rrs-7.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNNNCACTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNAACTCCNNNNNNNNNNRNN  sha.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNATCACTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNACTCCNNNNNNNNNNRNN  tamm-2.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNNTCACTTTGTCNNNNNNNNNNNNNNNNNNNNNNNNAACTCCANNNNNNNNNRNN  ts-1.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNNTCACTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNN  tsu-1.fa
3381029  NNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNN  van-0.fa
 
3381109  TTTTTTTCTTCTTTGTCTTGTAACAATATTTTCCTTTATAAATATATTCAAAATAAAATTATATGGAAAATTGTTAGTTA  chr1.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  bay-0.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  bor-4.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  br-0.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  bur-0.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  c24.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  col-0.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  cvi-0.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  est-1.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  fei-0.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  got-7.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  ler-1.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  lov-5.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  nfa-8.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  rrs-10.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  rrs-7.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  sha.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  tamm-2.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  ts-1.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  tsu-1.fa
3381109  NNNNNNNNNRRNNRRRRRRRRRRRRRRRRRRNNNNNNNRNNNNNRNNNNNNRNRNNRRRRRRRRRRRRRRRRRRRRRRRR  van-0.fa
 
3381189  GTTACATCAAATATTTTAAAATTCAATTTTTTTTTTTGTGTTGACAAATAAATAAAACTGATTGTTGTTTTAAATATAAA  chr1.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNTTNNNRRNRNRNNNAANNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  bay-0.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNTNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  bor-4.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  br-0.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  bur-0.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  c24.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  col-0.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  cvi-0.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNTTTNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  est-1.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  fei-0.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNTTTNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  got-7.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  ler-1.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNTTTNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  lov-5.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  nfa-8.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  rrs-10.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNTNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  rrs-7.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  sha.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  tamm-2.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  ts-1.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  tsu-1.fa
3381189  RRRRRRRRRRRNNNNNNNNNNNNNNNRNNNNNNNNNRRNRNRNNNNNNNNRNRNNNNNNNNNNRNNRNNNNNNNNNNNRN  van-0.fa
 
3381269  TAAAACAAAATTATTAGTAAATTTTGCTAAAGATATTTTTGTAATTTTATATTTTTTTATATTTTAGAAAATAAATTTTA  chr1.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRTNNNRNRNNRRRRRRRNNNNRRNNNNNNATTTTA  bay-0.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  bor-4.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  br-0.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  bur-0.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  c24.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  col-0.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  cvi-0.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  est-1.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  fei-0.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  got-7.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  ler-1.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  lov-5.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  nfa-8.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  rrs-10.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  rrs-7.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  sha.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  tamm-2.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  ts-1.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  tsu-1.fa
3381269  NNNNRRNNRNNNNNNNNNNNNNNNNRRNNNNNNNNNNRRRRRRRRRNNNNRNRNNRRRRRRRNNNNRRNNNNNNNNNNNN  van-0.fa
 
3381349  GAATCTGGGTCGGTTACGTTGCTTAATTTTTCTTTTGATTTCTAGTCTCTGCCTTTATTTCACTGATCATTAATAATTGC  chr1.fa
3381349  GAATNNNNNNTNNNTNNNNNNNNNNNNNNNNNTTNTGNTNNNNNNNCTCNNNNNNNTNNNNNNNNNNNNNNNNCNNNNNC  bay-0.fa
3381349  NAATCTGGGTCGGTTACGTTGCNNNNNNNNNNNNNNGNNNNNTAGTCTCTGCCTTTATTTCNNNNNNNNNNNATAATNNN  bor-4.fa
3381349  NNNNNNNNNTTGNNTNCGNTNNNNNNNNNNNNNNNNNNNNNCTNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNCNNNNNN  br-0.fa
3381349  NNNNNNNNNTTGNNTNNNNNNNNNNNNNNNNNNNNNNNNTNCTNGTCTCNNNNNNNTNNNNNNNNNNNNNNNNCNNNNNN  bur-0.fa
3381349  NNNNNNNNNNTNNNTNCGTTGCNNNNNNNNNNNNNNGNTTTCTAGTCTCNNNNNNNTTNNNNNNNNNNNNNNNCNNNNNN  c24.fa
3381349  NAATCTGGGTCGGTTACGTTGCNNNNNNNTTNTNNNNNNNNNTAGTCTCTGCCTTTATTTCANNNNNNATTAATAATTGC  col-0.fa
3381349  NNNNNNNNNNTNNNTNCGTTGNNNNNNNNNNNNNNNNNNNTCTAGTNNNNNNNNNNTNNNNNNNNNNNATTAATAATTGC  cvi-0.fa
3381349  NNNNNNNNNNNNNNTNCGTTGNNNNNNNNNNNNNNNNNTTTCTAGTCNNNNNNNNNTNNNNNNNNNNNNNTAATAATTGN  est-1.fa
3381349  NNNNNNNNNNTNNNTNCGTTGCNNNNNNNNNNNNNNNNNNTCTAGTCNNNNNNNNNTTTTCNNNNNNNNTTAATAATTGC  fei-0.fa
3381349  NNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
3381349  GAATCTGGGTCGGTTNCGTTGCTTNATTTTTNTNNNNNTTNCTNGTCTCTGCCTTTATTTCANNNNNNNNNNNNNNNNGC  ler-1.fa
3381349  NNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3381349  NNNNNNNNNNTNNNTNCGNTGNNNNNNNNNNNNNNNNNNNNCTNGTCTNNNNNNNNTNNNNNNNNNNNNNNNNCNNNNNN  nfa-8.fa
3381349  NNNNNNNNNNTGGTTACGTTNNNNNNNNNNNNNNNNNNNNTCTAGTNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
3381349  NNATCTGGGTCGGTTACGTTGCNNNNNNNNNNNNNNGNTTTCTAGTCTCTGCCTTTATTTCNNNNNNNNNNNATAATTGC  rrs-7.fa
3381349  NNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTNGTNNNNNNNNNNTNNNNNNNNNNNNNNNNCNNNNNN  sha.fa
3381349  NNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNTNNNNNNNNNNNNNNNNNAATTGC  tamm-2.fa
3381349  NNNNNNNNNNTNNNTNCNNNNNNNNNNNNNNNNNNNNNTTNCTNGTCTNNNNNNNNTNNNNNNNNNNNNNNNATAATTNC  ts-1.fa
3381349  NNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
3381349  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
3381429  TGGAGTTTTAATTTACATATTATAAAGGGACCAATTGTTATCATTGTATGAATCTTTTTTCTTGCAAATTATAACCGTCA  chr1.fa
3381429  TGGAGTTTTAATTTACATATTATAAAGGGACCAATTGTTATCATTGTNTGAARNTTTTTTCTTGCAANNNNNNNNNANNN  bay-0.fa
3381429  NNNAGTTTNNNNNNNNNNNNNNNNNNNNNNNCAATTGTTNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNTATAACCGTCA  bor-4.fa
3381429  NNNNNNTTTNNNNNNNNNNNNNNNNNGGGACCAATTGTTANCANNNNNNNNNRNNNTTTNNNNNNNNNNNNNNNNNANNN  br-0.fa
3381429  NNGAGTTTTAANNNNNNNNNNNTAAAGGGACCAATTGTTATCATTGTATGNARNTTTTTTCTTGCAANNNNNNNNNANNN  bur-0.fa
3381429  NGGAGTTTTAANNNNNNNNNNATAAAGGGACCAATTGTTATCATTGTATGAARCTTTTTTCTTGCAANNNNNNNNNANNN  c24.fa
3381429  TGGAGTTTTNNNNNNNNNNNNNNNNNGGGACCAATTGTTNNNNNNNNNNNNNRNNNTTTTCTTNCAAATTATAACCGTCA  col-0.fa
3381429  TGGAGTTTTAANNNNNNNNNNNTAAAGGGACCAATTGTTATCATTGTATNNNRNNNTTTTCTNNNNNNNNNNNNNNANNN  cvi-0.fa
3381429  TGGAGTTTTANNNNNNNNNNNNNNNNNGGACCAATTGTTATNNNNNNNNNNNRNNNNNTNNNNNNNNNNNNNNNNNNNNN  est-1.fa
3381429  TGGAGTTTTAATNNNNNNNNNNNAAAGGGACCAATTGTTATCATTGTATNNARNNTTTTTCTTNNNNNNNNNNNNNANNN  fei-0.fa
3381429  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTGTTNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
3381429  TGGAGTTTTANNNNNNNNNNNNNNNNNNNNNCAATTGTTNNNNNNNNNNNNNRNNNNNNNNNNNNNNATTATAACCGTCA  ler-1.fa
3381429  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3381429  NNNNGTTTTAATNNNNNNNNNNNNNAGGGACCAATTGTTATCATTGTNTNNNRNNNTTTTCTTNNNNNNNNNNNNNNNNN  nfa-8.fa
3381429  NNNNNNNNNNNNNNNNNNNNNNNNNNGGNACNAATTGTTNNNNNNNNNNNNNRNNNTTTTCTNNNNNNNNNNNNNNNNNN  rrs-10.fa
3381429  TGGAGTTTTANNNNNNNNNNNNNNNNNGGACCAATTGTTNNNNNNNNNNNNNRNNNTNTNNNNNNNNNTTATAACCGTNA  rrs-7.fa
3381429  NNNNNTTTTAANNNNNNNNNNNNNNNGGGACCAATTGTTNNNNNNNNNTNNNRNNNTTTTCTTNNNNNNNNNNNNNANNN  sha.fa
3381429  NGGAGTTTTANNNNNNNNNNNNNNNNNNNACCAATTGTTNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
3381429  TGGAGTTTTNNNNNNNNNNNNNNNAAGGGACCAATTGTTATNNNNNNNNNNNRNNNTTTTCNNNNNNNNNNNNNNNNNNN  ts-1.fa
3381429  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTGTNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
3381429  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
3381509  TTATTGGAAAAGAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGGTTTGTGCATCCCACTTGGAAACAA  chr1.fa
3381509  NNATTGGAAAAGAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAA  bay-0.fa
3381509  TTATTNNNNNNNAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAN  bor-4.fa
3381509  NNNNNNNNNNNNAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAN  br-0.fa
3381509  NNNNNNNNNNAGAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAA  bur-0.fa
3381509  NNNNNNNAAAAGAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAA  c24.fa
3381509  TTATTGGAAAAGAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAA  col-0.fa
3381509  NNNNNNNNNNAGAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAA  cvi-0.fa
3381509  NNNNNNNNNNAGAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAA  est-1.fa
3381509  NNNNNNNNNNAGAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAA  fei-0.fa
3381509  NNNNNNNNNNNNAANAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAN  got-7.fa
3381509  TTATTNNNNNNNAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAANNN  ler-1.fa
3381509  NNNNNNNNNNNNNNNNNNAACGCCCACGATTGTAATTAGANNNNNNNNNNNNNNNRNRRRRNNNTCCCACTTGGAAACNN  lov-5.fa
3381509  NNNNNNNNNNNGAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAN  nfa-8.fa
3381509  NNNNNNNNNNNGAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAN  rrs-10.fa
3381509  TTATTGGNAAAGAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAA  rrs-7.fa
3381509  NNNNNNNNNNNGAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAA  sha.fa
3381509  NNNNNNNNNNNNAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAA  tamm-2.fa
3381509  NNNNNNNNNNAGAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAACAN  ts-1.fa
3381509  NNNNNNNNNNNNAATAGAAACGCCCACGATTGTAATTAGATGCTAGGTCTTCAAGRTRRRRGCATCCCACTTGGAAANNN  tsu-1.fa
3381509  NNNNNNNNNNNNNNTAGAAACGCCCACGATNNNNNNNNNNNNNNNNNNNNNNNNNRNRRRRNNANCNCANNNNNNNNNNN  van-0.fa
 
3381589  ACAATAAACACAAATTAGGAGTAATTATGAAACTAATGGCCCATTTTCTAATCATTTGTAGTCTGTTTCATTTGGTTTTA  chr1.fa
3381589  ANNNRNNNNARAAANRAGGAGTAATTATRAAACTNATGGCCCATTTTCTAATCATTTGTRNTNNGNNTNATTTGGTTTTN  bay-0.fa
3381589  NNNNRNNNNNRNNNNRNNNNNNNNNNNNRNNNCTAATGGCCCATTTTCNNNNNNNNNNNRNNNNNNNNNNTTTGGTTNNN  bor-4.fa
3381589  NNNNRNNNNNRNNNNRNNNNNNNNNNNNRNNACTAATGGCCCATTTTCTAATCNTNNNNRNNNNNNNNNNNNTGGTTTTN  br-0.fa
3381589  ANNNRNNNNNRAAANRAGGNGTAATNNTRAAACTNATGGCCCATTTTCTAATCATTTGNRNNNTGTTTCATTTGGTTTTN  bur-0.fa
3381589  ANNNRNNNNNRNNNNRNNNNNNNNNNNTRAAACTAATGGCCCATTTTCTAATCATTTGTRGTNTGTTTCATTTGGTTTTN  c24.fa
3381589  ANNNRNNNNNRNNNNRNNNNNNNNNNNNRNNNCTAATGGCCCATTTTCTANNNNNNNNNRNNNNNNNNNNNNTGGTTTTN  col-0.fa
3381589  NNNNRNNNNNRNNNNRNNNNNNNNNNNNRNAACTAATGGCCCATTTTCTAATCNTTNNNRNNNTGTTTCATTTGGTTTTN  cvi-0.fa
3381589  ANNNRNNNNNRNNNNRNNNNNNNNNNNNRAAACTAATGGCCCATTTTCTAATCANNNNNRNNNTGTTTCATTTGGTTTTN  est-1.fa
3381589  ANNNRNNNNNRNNNNRNNNNNNNNNNNNRAANCTAATGGCCCATTTTCTAATCATTTNTRNNNTGTTTNNTTTGGTTTTN  fei-0.fa
3381589  NNNNRNNNNNRNNNNRNNNNNNNNNNNNRNNNCTAATGGCCCATTTTCNNNNNNNNNNNRNNNNGTNTCNTNTGGTTNNN  got-7.fa
3381589  NNNNRNNNNNRNNNNRNNNNNNNNNNNNRNNNCTNATGGCCCATTTTCTAANNNNNNNNRNNNNNNNNNNNNNGGNNNNN  ler-1.fa
3381589  NNNNRNNNNNRNNNNRNNNNNNNNNNNNRNNNNNNNNNGCCCANNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3381589  NNNNRNNNNNRNNNNRNNNNNNNNNNNNRNNNCTAATGGCCCATTTTCTAANNNNNNNNRNNNTGTTTCNTTTGGTTTTN  nfa-8.fa
3381589  NNNNRNNNNNRNNNNRNNNNNNNNNNNNRNNNCTAATGGCCCATTTTCTAATCNNNNNNRNNNNGTTTCATTTGGTTTTA  rrs-10.fa
3381589  ANNNRNNNNNRNNNNRNNNNNNNNNNNNRNNNCTAATGGCCCATTTTCTANNNNNNNNNRNNNNNNNTCNTTTGGTTTTN  rrs-7.fa
3381589  NNNNRNNNNNRNNNNRNNNNNNNNNNNNRNNNCTAATGGCCCATTTTCTAANNNNNNNNRNNNNGNNNNNNNTGGTNNNN  sha.fa
3381589  NNNNRNNNNNRNNNNRNNNNNNNNNNNNRNAACTAATGGCCCATTTTCTNNNNNNNNNNRNNNNNNNNNNTTTGGTTTTN  tamm-2.fa
3381589  NNNNRNNNNNRNNNNRNNNNNNNNNNNNRNNACTAATGGCCCATTTTCTAANNNNNNNNRNNNNNTNTNNTTTGGTTTTN  ts-1.fa
3381589  NNNNRNNNNNRNNNNRNNNNNNNNNNNNRNNNCTAATGGCCCATTTTCNNNNNNNNNNNRNNNNNNNNNNNNTGGTTTTN  tsu-1.fa
3381589  NNNNRNNNNNRNNNNRNNNNNNNNNNNNRNNNNNNNNGGCNNNNNNNNNNNNNNNNNNNRNNNNNNNTCNTTTGGTTTTN  van-0.fa
 
3381669  CGTTTGTTATTTCTAACCTTATCCATAACACTCTAATTGAAAATAAATGAGTAGCTTTATTAGTTGTTAGACTGTGAGAG  chr1.fa
3381669  CGTTTGTTATTTCTAACCTTATCCATAACACTCTAATTGAAAATAAATGAGTAGCTTTATTAGTTGTTAGACTGTGAGAG  bay-0.fa
3381669  NNNNNNNNNNNNNNNNNNNNNNNCATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGTTAGACTGTGAGAG  bor-4.fa
3381669  CGTTTGTTNTNNNNNNNNTTATCCATAACACNCTNATNNNNNNNNNNNNNNNNNNNNTNTTAGTTGTTAGACTGTGAGAG  br-0.fa
3381669  CGTTTGTTATTTCTAACCTTATCCATAACACTCTAATTGAAAANAAATGNNNNNNTTTATTAGTTGTTAGACTGTGAGAG  bur-0.fa
3381669  CGTTTGTTATTTCTAACCTTATCCATAACACTCTAATTGAAAANAAATGAGTNGCTTTATTAGTTGTTAGACTGTGAGAG  c24.fa
3381669  CGTTTGTTNTTNNNNNNNTTATCCANANNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGTTAGACTGTGAGAG  col-0.fa
3381669  CGTTTGTTATTTCTAACCTTATCCATAACACTCTAATTGAAAANNNNNNNNNNNNNTTNTTAGTTGTTAGACTGTGAGAG  cvi-0.fa
3381669  CGTTTNNNNNNNNNNNNNNNATNCANANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGTTAGACTGTGAGAG  est-1.fa
3381669  CGTTTGTTATTTCTAACCTTATCCATAACACTCTAATTGAAAATAAATGNNNNNNTTTATTAGTTGTTAGACTGTGAGAG  fei-0.fa
3381669  NNNNNNNNNNNNNNNNNNNNATNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGACTGTGAGAG  got-7.fa
3381669  CGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTNGACTGTGAGAG  ler-1.fa
3381669  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTGAGAG  lov-5.fa
3381669  CGTTTGTTATTTCTNACCTTATCCATAACACTCNAATTGANNNNNNNNNNNNNNNNNNNTTAGTTGTTAGACTGTGAGAG  nfa-8.fa
3381669  CGTNTNTTATTTCTNACCTTATCCATAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAGTTGTTAGACTGTGAGAG  rrs-10.fa
3381669  CGTTTGTTNTTNNNNNNNNNNNNCATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGTTAGACTGTGAGAG  rrs-7.fa
3381669  NNTTTGTTATTTCTAACCTNATNCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTGTTNGACTGTGAGAG  sha.fa
3381669  CGTTTGTTNTNNNNNNNNNTATCCANAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGTTAGACTGTGAGAG  tamm-2.fa
3381669  CGTTTGTTNTTNCTNANNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNGTTGTTAGACTGTGAGAG  ts-1.fa
3381669  CGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNAGACTGTGAGAG  tsu-1.fa
3381669  CGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGACTGTGAGAG  van-0.fa
 
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAATCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  chr1.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAANCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  bay-0.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAANCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  bor-4.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAANCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  br-0.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAANCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  bur-0.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAANCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  c24.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAATCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  col-0.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAATCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  cvi-0.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAATCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  est-1.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAANCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  fei-0.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAATCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  got-7.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAANCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  ler-1.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAANCATCGTCGCAGCCTTCACAGNCCTGTTACATTTGACATCANNNNNN  lov-5.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAANCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  nfa-8.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAANCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  rrs-10.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAANCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  rrs-7.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAANCATCGTCGCAGCCTTCACANCCCTGTTACATTTGACATCACATAAC  sha.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAANCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  tamm-2.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAANCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  ts-1.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAATCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  tsu-1.fa
3381749  ATCCGCCATTGTCACCCGCTGTAAGATTCAGAATCATCGTCGCAGCCTTCACAGCCCTGTTACATTTGACATCACATAAC  van-0.fa
 
3381829  ACAGGTTTAGAGTTTCAGGCAATAGATTCTTAAGAAGAAGAAAAACAGAATCGGACAGATCAAACAGAGCAGGATCATGG  chr1.fa
3381829  ACAGGTTTAGAGTTTCAGGCAATAGATNCNNRRRRAGANNNRNNNCAGAATCGGACANATCAAACAGAGCAGGATCATGG  bay-0.fa
3381829  ACAGGTTTAGAGTTTCAGGCANNNNNNNNNNRRRRNNNNNNRNNACAGAATCGGACAGATCAAACAGAGCAGGATCATGG  bor-4.fa
3381829  ACAGGTTTAGAGTTTCAGGCAATAGANNNNNRRRRNNNNNNRNNNCAGAATCGGACAGATCAAACAGAGCAGGATCATGG  br-0.fa
3381829  ACAGGTTTAGAGTTTCAGGCAATAGATNCNNRRRRNNNNNNRNNNCAGAATCGGACNGATCAAACAGAGCAGGATCATGG  bur-0.fa
3381829  ACAGGTTTAGAGTTTCAGGCAATAGATTNNNRRRRANNNNNRAANCAGAATCGGACAGATCAAACAGAGCAGGATCATGG  c24.fa
3381829  ACAGGTTTAGAGTTTCAGGCAATAGATNNNNRRRRNNNNNNRANNCAGAATCGGACAGATCAAACAGAGCAG