Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 3382314 - 3384398


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
3382314  TCTACATATTCAAGAGGTGAATACCAGAAAAGTGCTCGGCCAACATGAAGACGGTTAATAGAATGATTCTAGGTTTTGCA  chr1.fa
3382314  TCTACATAATCAAGAGGTGAANARCNNAAAAGTACTCGGCCAACATGAAGACGGTTAATAGAATGATTCTAGGTTTTGCA  bay-0.fa
3382314  NNNNNNNATTCAAGAGGNGAATARCAGAAAAGTGCTCGGCCAACATGAAGACGGTTAANNNNNNNNTTCTAGGTTTTGCA  bor-4.fa
3382314  TCTACATATTCAAGAGGTGAATARCAGAAAAGTGCTCGGCCAACATGAAGNTNNNNNNNNNNNNNNTTCTAGGTTTTGCA  br-0.fa
3382314  NNNNNNNNANNNNNNGGNGAATNRCNGAAAAGTACTCGGCCAACATGAAGACGGTTAATAGAATGATTCTAGGTTTTGCA  bur-0.fa
3382314  TCTACATATTCAAGAGGTGAATARCAGAAAAGTGCTCGGCCAACATGAAGATNNNNNNNNNNATGATTCTAGGTTTTGCA  c24.fa
3382314  TCTACATATTCAAGAGGTGAATARCAGAAAAGTGCTCGGCCAACATGAAGACGGTTAATNNNNNNNTTCTAGGTTTTGCA  col-0.fa
3382314  TCTACATATTCAAGAGGTGAATARCNGAAAAGTGCTCGGCCAACATGANNNNNNNNNNNNNNNNGATTCTAGGTTTTGCA  cvi-0.fa
3382314  NNNNNNTATTCAAGAGGTGAATARCAGAAAAGTGCTCGGCCAACATGAANNNNNNNNNNNNNNNNNNTCTAGGTTTTGCA  est-1.fa
3382314  TCTACATATTCAAGAGGTGAATARCAGAAAAGTGCTCGGCCAACATGAANNNNNNNNNNNNNATGATTCTAGGTTTTGCA  fei-0.fa
3382314  NNNNNNNNANNNNNNNNNNANNNRNNNAAAAGTACTCGGCCAACATGAAGACGGTNNNNNNNNNNNNTCTAGGTTTTGCA  got-7.fa
3382314  NNNNNNTATTCANGNNGNGAANARCNGAAAAGTGCTCGGCCAACATGAAGACGGTTAATANNNNNNNTCTAGGTTTTGCA  ler-1.fa
3382314  NNNNNNNNNNNNNNNNNNNNNNNRCNGAAAAGTGCTCGGCCAACANNNNNNNNNNNNNNNNNNNNNNNCTAGGTTTTGCA  lov-5.fa
3382314  TCTACATATTCAAGAGGTGAATNRCAGAAAAGTGCTCGGCCAACATGANNNTNNNNNNNNNNNNNATTCTAGGTTTTGCA  nfa-8.fa
3382314  TCTACATATTCNAGAGGTGAATARCAGAAAAGTGCTCGGCCAACATGANNNNNNNNNNNNNNNNNNTTCTAGGTTTTGCA  rrs-10.fa
3382314  NNNNNNNATNCAAGAGGTGAATARCAGAAAAGTGCTCGGCCAACATGAAGACGGTTAATAGAATNATTCTAGGTTTTGCA  rrs-7.fa
3382314  NNNNNNNNANNNNNNNNNNNNNNRCAGAAAAGTGCTCGGCCAACATGAAGACGGTTAATAGANTGATTCTAGGTTTTGCA  sha.fa
3382314  TCTACATATTCAAGAGGNGAATARCAGAAAAGTGCTCGGCCAACATGANNNNNNNNNNNNNNNNNNNTCTAGGTTTTGCA  tamm-2.fa
3382314  TCTACATATTCAAGAGGTGAATARCAGAAAAGTGCTCGGCCAACATGAANNTNNNNNNNNNNNNNNTTCTAGGTTTTGCA  ts-1.fa
3382314  NNNNNNNNANNNNNNNNNNNNNARCNGAAAAGTGCTCGGCCAACATGAAGACGNTTNNNNNNNNNNNNCTAGGTTTTGCA  tsu-1.fa
3382314  NNNNNNNNNNNNAGAGGTGAATARCAGAAAAGTGCTCGGCCAACATGAAGACNNNNNNNNNNNNNNNNNNNNNNTTTGCA  van-0.fa
 
3382394  GACTATGGTACAGCCGCACAAGGACCAAGTAACTTACTTAGACCTTCCAGGTGAAGCTATAGCATTACCATCCATGTATG  chr1.fa
3382394  GACTATGGTACAGCCGCANNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGCATTACCATCCATGTATG  bay-0.fa
3382394  GACTATGGTACAGCCGCACAAGGACCAAGTAACTTACTTAGACCTTCCAGGTGAAGCTATAGCATTACCATCCATGTATN  bor-4.fa
3382394  GACTATGGCACAGCCGCACAGGGACCAAGTAACTTACTTAGACCTTCCAGGTGAAGCTATAGCATTACCATCCATGTATG  br-0.fa
3382394  GACTATGGTACAGCCGCANNGNNNCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGCATTACCATCCATGTATG  bur-0.fa
3382394  GACTATGGCACAGCCGCACAGGGACCAAGTAACTTACTTAGACCTTCCAGGTGAAGCTATAGCATTACCATCCATGTATG  c24.fa
3382394  GACTATGGTACAGCCGCACAAGGACCAAGTAACTTACTTAGACCTTCCAGGTGAAGCTATAGCATTACCATCCATGTATG  col-0.fa
3382394  GACTATGGCACAGCCGCACAGGGACCAAGNAACTTACTTAGACCTTCCAGGTGAAGCTATAGCATTACCATCCATGTATG  cvi-0.fa
3382394  GACTATGGCACAGCCGCACAGGGACCAAGNAACTTACTTAGACCTTCCAGGTGAAGCTATAGCATTACCATCCATGTATG  est-1.fa
3382394  GACTATGGCACNGCNGCNCAGGGACCAAGTAACTTACTTAGACCTTCCAGGTGAAGCTATAGCATTACCATCCATGTATG  fei-0.fa
3382394  GACTATGGTACAGCCGCACAGGGNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCATTACCATCCATGTANG  got-7.fa
3382394  GACTATGGTACAGCCGCACAAGGACCAAGNNNNNNNNNNAGACCTTCCAGGTGAAGCTATAGCATTACCATCNNNNNNTN  ler-1.fa
3382394  GACTATNGCNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNAGACCTTCCAGGTGAAGNNATAGCATTACCANNNNNNNNNN  lov-5.fa
3382394  GACTATGGCACNNNNNNNNAGGGACCANNNNNNTTACTTAGACCTTCCAGGTGAAGCTATAGCATTACCATCCATGTATG  nfa-8.fa
3382394  GACTATGGCACAGCCGCACAGGGACCAAGNAACTTACTTAGACCTTCCAGGTGAAGCTATAGCATTACCATCCATGTATG  rrs-10.fa
3382394  GACTATGGTACAGCCGCACAAGGACCAAGTAACTTACTTAGACCTTCCAGGTGAAGCTATAGCATTACCATCCANGTATG  rrs-7.fa
3382394  GACTATGGTACAGCCGCANNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCATTACCATCCATGTATG  sha.fa
3382394  GACTATGGCACNGCNGCNCAGGGACCAAGNAACTTACTTAGACCTTCCAGGTGAAGCTATAGCATTACCATCCATGNATG  tamm-2.fa
3382394  GACTATGGCACAGNNNNNNNGGGACCNNNNNNCTTACTTAGACCTTCCAGGTGAAGCTATAGCATTACCATCCATGTATG  ts-1.fa
3382394  GACTATGGTACAGCCGCACAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATTACCATCCATGTNNN  tsu-1.fa
3382394  GACTATGGNACAGCCGCACAGGGACCAAGTAACTTACTTAGACCTTCCAGGTGAAGCTATAGCATTACCATCCNNNNNNN  van-0.fa
 
3382474  ATAATTTAGGAGTGTATACTCTAATATCAGGGGAAAAGAGTATCTAACATCCTTACTGAATTCGGACAAAGTCTAGCTCA  chr1.fa
3382474  ATAATTTAGGAGTGNATACTCTAATATCAGGGGAAAAGAGTATCTAACATCCTTACTGAATTCGGACAAAGTCTAGCTCA  bay-0.fa
3382474  NNNNNNTNNNNNNNNNNNNNNNNNNNTCAGGGGAAAAGANNNNNNNNNNNCCTTACTGAATTCGGACAAAGTCTAGCTCA  bor-4.fa
3382474  ATAATTTAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTACTGAATTCGGACAAAGTCTAGCTCA  br-0.fa
3382474  ATAATTTAGGANNNNNNNCTCTAATATCAGGGGAAAAGAGTATCTAACATCCTTACTGAATTCGGACAAAGTCTAGCTCA  bur-0.fa
3382474  ATAATTTAGGANNNNNNACTCTAATNNNNNNNNNNNNNNNNNNNNNACATCCTTACTGAATTCGGACAAAGTCTAGCTCA  c24.fa
3382474  ATAATTNNNNNNNNNNNNNNNNNNNATCAGGGGAAAAGAGTATCTNACATCCTTACTGAATTCGGACAAAGTCTAGCTCA  col-0.fa
3382474  ATAATTTAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTACTGAATTCGGACAAAGTCTAGCTCA  cvi-0.fa
3382474  ATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTGAATTCGGACAAAGTCTAGCTCA  est-1.fa
3382474  ATAATTTAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCTTACTGAATTCGGACAAAGTCTAGCTCA  fei-0.fa
3382474  ATANNNNNNNNNNNNNNNNNNNNNNNNNANGNGAANNNNNNNNNNNNNNNCCTTACTGAATTCGGACAAAGTCTAGCTCA  got-7.fa
3382474  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGAAAAGAGNNNNNNNNANCCTTACTGAATTCGGACAAAGTCTAGCTCA  ler-1.fa
3382474  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTGAATTCGGACAAAGTCTAGCTCA  lov-5.fa
3382474  ATAATTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTACTGAATTCGGACAAAGTCTAGCTCA  nfa-8.fa
3382474  ATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTACTGAATTCGGACAAAGTCTAGCTCA  rrs-10.fa
3382474  ATANNNNNNNNNNNNNNNNNNNNNNNNNAGGGGAAAAGAGTANNNNNNNNNCTTACTGAATTCGGACAAAGTCTAGCTCA  rrs-7.fa
3382474  ATAANNNNNNNNNNNNNNNNNNNNNNNCAGGGGAAAAGAGTATCTAACATCCTTACTGAATTCGGACAAAGTCTAGCTCA  sha.fa
3382474  ATAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTGAATTCGGACAAAGTCTAGCTCA  tamm-2.fa
3382474  ATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTACTGAATTCGGACAAAGTCTAGCTCA  ts-1.fa
3382474  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAAANNNNNNNNNNNNNNNTTACTGAATTCGGACAAAGTCTAGCTCA  tsu-1.fa
3382474  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAAAGTCTAGCTCA  van-0.fa
 
3382554  ATAATATCGCATATCTAGATATCAATAGTGCCCTATGTTTGTTTCAGTTGACTTTGTTACCTTTCTGTAACTACAAGAAC  chr1.fa
3382554  ATAATATCGCATATCTAGATATCAATAGTGCCCTATGTTTGTTTCNGTTGACTTTGTTACCTTTCTGTAACTACAAGAAC  bay-0.fa
3382554  ATAATATCGNNNNNNNNNATATCAATAGTGCCCTATGTTTGTTTCAGTTGACTTTGTTACCTNNNNNNAACTACAAGAAC  bor-4.fa
3382554  ATAATATCGCATATCTAGATATCAATAGTGCCCTATGTTTGTTTCNGTTGACTTTGTTACCTTTCTGTAACTACAAGAAC  br-0.fa
3382554  ATAATATCGCATANCTAGATATCAATAGTGCCCTATGTTTGTTTCNGTTGACTTTGTTACCTTTCTGTAACTACAAGAAC  bur-0.fa
3382554  ATAATATCGCATATCTAGATATCAATAGTGCCCTATGTTTGTTTCAGTTGACTTTGTTACCTTTCTGTAACTACAAGAAC  c24.fa
3382554  ATAATATCGCANNNNNNNNTATCAATAGTGCCCTATGTTTGTTTCAGTTGACTTTGTTACCTTTCTGTAACTACAAGAAC  col-0.fa
3382554  ATAATATCGCATATCTAGATATCAATAGTGCCCTATGTTTGTTTCAGTTGACTTTGTTACCTTTCTGTAACTACAAGAAC  cvi-0.fa
3382554  ATAATATCNNNNNNNNNNNTATCAATAGTGCCCTATGTTTGTTTCAGTTGACTTTGTTACCTTTCNGTAACTACAAGAAC  est-1.fa
3382554  ATAATATCGCATNNNNNNATATCAATAGTGCCCTATGTTTGTTTCAGTTGACTTTGTTACCTTTCTGTAACTACAAGAAC  fei-0.fa
3382554  ATAATATCNNNNNNNNNNNNNTCAATAGTGCCCTATGTTTGTTTCNGTNNNNNNTGTTACNNNNNNNNNNNNNNNNGAAC  got-7.fa
3382554  ATAATANNNNNNNNNNNNNNATCAATAGTGCCCTATGTTTGTTTCNGTTGACTTTGTTACNNNNNNNNNNCNACAAGAAC  ler-1.fa
3382554  ATANNNNNNNNNNNNNNNNNNNNNANAGTGCCCTATGTTTGTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3382554  ATAATATCGCNNNNNNNNNTATCAATAGTGCCCTATGTTTGTTTCAGTTGACTTTGTTACCTTTCTGTAACTACAAGAAC  nfa-8.fa
3382554  ATAATATCGCNNNNNNNNNNATCAATAGTGCCCTATGTTTGTTTCAGTTGACTTTGTTACCTTTCTGTAACTACAAGAAC  rrs-10.fa
3382554  ATAATANNNNNNNNNNNNNNNTCAATAGTGCCCTATGTTTGTTTCAGTTGACTTTGTTACCTTNNNNNAACTACAAGAAC  rrs-7.fa
3382554  ATAATATCNNNNNNNNNNNNATCAATAGTGCCCTATGTTTGTTTCAGTTGACTTTGTTNCCNNNNNNNNNCTACAAGAAC  sha.fa
3382554  ATAATATCGNNNNNNNNNATATCAATAGTGCCCTATGTTTGTTTCAGTTGACTTTGTTACCTTNNNNNAACTACAAGAAC  tamm-2.fa
3382554  ATAATATCNNNNNNNNNNATATCAATAGTGCCCTATGTTTGTTTCAGTTGACTTTGTTACCTTNNNNNNACTACAAGAAC  ts-1.fa
3382554  ATAATATNNNNNNNNNNNNNNTCAATAGTGCCCTATGTTTGTTTCNGTTGACTTTGTTNNNNNNNNNNNNNNNNNNGAAC  tsu-1.fa
3382554  ATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
3382634  AAAACACACGATAACAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACCAGGGCAGCACCAGATCTTCCCCATCCAG  chr1.fa
3382634  AAAACACACGANAACAGCTCATGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCNNATCTTCNCCATCCAG  bay-0.fa
3382634  AAAACACACGATAACAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAG  bor-4.fa
3382634  AAAACACACGGTAACAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAG  br-0.fa
3382634  AAAACACACGATAACAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCNCCATCCAG  bur-0.fa
3382634  AAAACACACGGNAACAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAG  c24.fa
3382634  AAAACACACGATAACAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAN  col-0.fa
3382634  AAAACNCNNGGTAACAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAG  cvi-0.fa
3382634  AAANNNNNNNGTAACAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAN  est-1.fa
3382634  AAAACNCNNGGTNNCNGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAG  fei-0.fa
3382634  AAAACACACGATAACAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAN  got-7.fa
3382634  NAAACACACGATAACAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCNNATCTTCCCCATCCAN  ler-1.fa
3382634  NNNNNNNNNNGNNNNNNNTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCNGATCTTCNCCATCCAN  lov-5.fa
3382634  AAAACNCNNNGNNNNAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAG  nfa-8.fa
3382634  AAAACNCNNGGTAACAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAN  rrs-10.fa
3382634  AAAACACACGATAACAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAG  rrs-7.fa
3382634  AAAACACACGATAACAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAG  sha.fa
3382634  AANNNNNNNNGNNNNAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAN  tamm-2.fa
3382634  AAANNNNNNNGNNNNNGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAG  ts-1.fa
3382634  AAAACACACGATAACAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAN  tsu-1.fa
3382634  NNNNNNNNNNNNNNCAGCTCGTGGTTCAAGCAAGTGAAGATTGAAACTCACRRRRRRRRRRRCAGATCTTCCCCATCCAN  van-0.fa
 
3382714  AAGACATATTTACAATAATTCCTTGCTTGCGTGGGAGCATCAAAGGGATAAAATGGCGCAGCACATTTGCAACTCCTTTA  chr1.fa
3382714  AARRRRRRTTTNCARTAATTCCTTGCTTGCGTGGNARCATCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  bay-0.fa
3382714  ANRRRRRRNNNNNNRNNNNTCCTTGCTTGCGTGGGARCATCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  bor-4.fa
3382714  AARRRRRRNNNNNNRNNATTCCTTGCTTGCGTGGGARCATCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  br-0.fa
3382714  AARRRRRRNNNNCARNAATTCCTTGCTTGCGTGGGARCANCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  bur-0.fa
3382714  AARRRRRRNNNNNARNAATTCCTTGCTTGCGTGGGARCATCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  c24.fa
3382714  NNRRRRRRNNNNNNRNNATTCCTTGCTTGCGTGGGARCATCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  col-0.fa
3382714  AARRRRRRNNNNNNRNNATTCCTTGCTTGCGTGGGARCATCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  cvi-0.fa
3382714  NNRRRRRRNNNNNNRNNNTTCCTTGCTTGCGTGGGARCNTCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  est-1.fa
3382714  AARRRRRRNNNNNNRNAATTCCTTGCTTGCGTGGGNRCATCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  fei-0.fa
3382714  NNRRRRRRNNNNNNRNNNNTCCTTGCTTGCGTGGGARCATCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  got-7.fa
3382714  NNRRRRRRNNNNNNRNNNNTCCTTGCTTGCGTGGGARCATCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  ler-1.fa
3382714  NNRRRRRRNNNNNNRNNNNNCCTTGCTTGCGTGGGARCNTCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  lov-5.fa
3382714  NNRRRRRRNNNNNNRNNATTCCTTGCTTGCGTGGGARCANCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  nfa-8.fa
3382714  AARRRRRRNNNNNNRNNANTCCTTGCTTGCGTGGGARCATCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  rrs-10.fa
3382714  NNRRRRRRNNNNNNRNNNTTCCTTGCTTGCGTGGGARCATCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  rrs-7.fa
3382714  NNRRRRRRNNNNNNRNNNTTCCTTGCTTGCGTGGGARCANCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  sha.fa
3382714  NNRRRRRRNNNNNNRNNNTTCCTTGCTTGCGTGGGARCANCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  tamm-2.fa
3382714  NARRRRRRNNNNNNRNNNNTCCTTGCTTGCGTGGGARCNNCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  ts-1.fa
3382714  NNRRRRRRNNNNNNRNNNNTCCTTGCTTGCGTGGGARCATCRRRRRRRRRRRATGGCGCAGCACATTTGCAACTCCTTTA  tsu-1.fa
3382714  NNRRRRRRNNCNNNRNNNNNCCTTGCTTGCGTGGGARCATCRRRRRRRRRRRATGGCGCAGCACATTNNNNNNNNNNNNN  van-0.fa
 
3382794  ACGTTTGTATCCATGACATTGTCAAAATCTTCAGCAGAGACTTCCCAAATCTTGCTGTTCTTATTGATGGTACCAGCATT  chr1.fa
3382794  ACGTTTGTATCCATGACATTGNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGTTCTTATTGARRRRRRRRRRRRR  bay-0.fa
3382794  ACGTTTGTATCCATGACATTGTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNNNTTATTGARRRRRRRRRRRRR  bor-4.fa
3382794  ACGTTTGTATCCATGACATTGTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGTNCTTATTGARRRRRRRRRRGRR  br-0.fa
3382794  ACGTTTGTATCCATGACATTGTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNTCTTATTGARRRRRRRRRRRRR  bur-0.fa
3382794  ACGTTTGTATCCATGACATTGTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGTTCTTATTGARRRRRRRRRRGRR  c24.fa
3382794  ACGTTTGTATCCATGACATTGTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNTCTTATTGARRRRRRRRRRRRR  col-0.fa
3382794  ACGTTTGTATCCATGACATTGTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNTCTTATTGARRRRRRRRRRGRR  cvi-0.fa
3382794  ACGTTTGTATCCATGACATTGTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNTCTTATTGARRRRRRRRRRGRR  est-1.fa
3382794  ACGTTTGTATCCATGACATTGNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGTTCTTATTGARRRRRRRRRRGRR  fei-0.fa
3382794  ACGTTTGTATCCATGACATTGTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCTTATTGARRRRRRRRRRRRR  got-7.fa
3382794  ACGTTTGTATCCATGACATTGNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCTTATTGARRRRRRRRRRRRR  ler-1.fa
3382794  ACGTTTGTATCCANGACATNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNTATTGNRRRRRRRRRRGRR  lov-5.fa
3382794  ACGTTTGTATCCATGACATTGTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNNCTTATTGARRRRRRRRRRGRR  nfa-8.fa
3382794  ACGTTTGTATCCATGACATTGTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNNCTTATTGARRRRRRRRRRGRR  rrs-10.fa
3382794  ACGTTTGTATCCATGACATTGTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNTCTTATTGARRRRRRRRRRRRR  rrs-7.fa
3382794  ACGTTTGTATCCATGACATTGNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNNCTTATTGARRRRRRRRRRRRR  sha.fa
3382794  ACGTTTGTATCCATGACATTGNRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGNNNTTATTGARRRRRRRRRRGRR  tamm-2.fa
3382794  ACGTTTGTATCCATGACATTGTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGTNCTTATTGARRRRRRRRRRGRR  ts-1.fa
3382794  ACGTTTGTATCCATGACATTGTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNCNTATTGARRRRRRRRRRRRR  tsu-1.fa
3382794  NNNNNNNNNNNNATGACATTGTRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRGTTCTTATTGARRRRRRRRRRGRR  van-0.fa
 
3382874  GTTAACTGCAACATGCATATACCAACATCTAAGAGTTCAAAATTTACAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  chr1.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRCAACATCTAAGAGTTCAAAATTTNCAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  bay-0.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRCANCNNNNNNNNGTTNNNNNNNNNNNGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  bor-4.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRCAACATCTAAGAGTTCAAAATNTACAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  br-0.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRCAACATCTAAGAGTTCAAAATTTACAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  bur-0.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRCAACATCTAAGAGTTCAAAATTTACAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  c24.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRCAACATCTAAGAGTTCAAAANTTACAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  col-0.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRCAACANCTAAGAGTTCAAAATTTACAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  cvi-0.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNCNNNNNNNNNNNNGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  est-1.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNCNNNNNNNNTACAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  fei-0.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRCNNCNNNNNNNNNNNNNNNNNNNNNNGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  got-7.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRNNNCANCTNAGNGTTCAAAATTNACAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  ler-1.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAACGANGCAAAGAAGCAATGTGCCCAGA  lov-5.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRCANCATCTAAGAGTTCAAAATTTACAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  nfa-8.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRCNNNNNNNNNNAGTTCANNNNNNNCAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  rrs-10.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRCANCNNNNNAGAGTTCAANNNNNACAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  rrs-7.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRCNNCATCNAAGAGTTCAAAATTTACAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  sha.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRCAACATCNAAGAGTTCANNNNNNNCAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  tamm-2.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNCNNNNNNNNNNNAGTAAAACGATGCANAGAAGCAATGTGCCCAGA  ts-1.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNAGAGTTCAAANNNNNCAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  tsu-1.fa
3382874  RRRRRRRRRRRRRRRRRRRRRRCAACATCTAAGAGTTCAANANNTNCAGTAAAACGATGCAAAGAAGCAATGTGCCCAGA  van-0.fa
 
3382954  ATGTGCAGGAGATGTTGATCATGTAACCATCAAACCTACAATTTACAGATATCAACCTCGAGAAAAATGAAATGAATTCT  chr1.fa
3382954  ATGTGCAGGAGATGTTGATCATGTAACCATCAAACCNACAATTTACAGATATCAACCTCGAGAAAAATGAAATGAATTCT  bay-0.fa
3382954  ATGTGCAGGAGATGTTGATCATGTAACCATCAAACCTACANNNNNCAGATATCAACCTCGAGAAANNNNNNNNNNNNNNN  bor-4.fa
3382954  ATGTGCAGGAGATGANNNNNNTGTAACCATCNNNNNANNNNNNNNNNGATATCAACCTCGAGANNNNNNNNNNNNNNNNN  br-0.fa
3382954  ATGTGCAGGAGATGTTGATCATGTAACCATCAAACCTACAATTTACAGATATCAACCTCGAGAAAAATGAAANGAATTCT  bur-0.fa
3382954  ATGTGCAGGAGATGATGATCATGTAACCATCAAACCAANNNNNNNNNGATATCAACCTCGAGAAAANNNNNNNNNNNNNT  c24.fa
3382954  ATGTGCAGGAGATGTTGATCATGTAACCATCAAACCTACAATTTACAGATATCAACCTCGAGAAAAATGNNNNNNNNNCT  col-0.fa
3382954  ATGTGCAGGAGANNANNNNNNNGTAACCATCANNNNANNNNNNNNNNNANATCAACCTCGAGAANNNNNNNNNNNNNNNN  cvi-0.fa
3382954  ATGTGCAGGNGNNNANNNNNNNNTAACCANNNNNNNANNNNNNNNNNNATATCAACCTCGAGAANNNNNNNNNNNNNNNN  est-1.fa
3382954  ATGTGCAGGAGANNANNNTCATGTAACCATCAAANNANNNNNNNNCAGATATCAACCTCGAGAANNNNNNNNNNNNNNNN  fei-0.fa
3382954  ATGTGCAGGAGATGTTGATCATGTAACCATCAAACCTACANNNNNNNNNNNNCAACCTCGAGAAANNNNNNNNNNNNNNN  got-7.fa
3382954  ATGTGCAGGAGATGTTGATCATGTAACCATCAAACCTACAATTNNNNGATATCAACCTCGAGAAAAANNNNNNNNNNNNT  ler-1.fa
3382954  ATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACCTCGAGANNNNNNNNNNNNNNNNN  lov-5.fa
3382954  ATGTGCAGNNNNNNANNNNNNNNNAACCATCNNNNNANNNNNNNNNNNNNATCAACCTCGAGANNNNNNNNNNNNNNNNN  nfa-8.fa
3382954  ATGTGCAGGAGATGANNNNNNNGTAACCNNNNNNNNANNNNNNNNNNGATATCAACCTCGAGNNNNNNNNNNNNNNNNNN  rrs-10.fa
3382954  ATGTGCAGGAGATGTTGATCATGTAACCATCAAACCTACAATTTNCNNANATCAACCTCGAGAAAANNNNNNNNNNNNNN  rrs-7.fa
3382954  ATGTGCAGGAGATGTTGATCATGTAACCATCAAACCTACAATTTACAGATATCAACCTCGAGAAAAATGNNNNNNNTTCT  sha.fa
3382954  ATGTGCAGNNNNNNANNNNNNNNNAACCANNNNNNNANNNNNNNNNNNATATCAACCTCGAGANNNNNNNNNNNNNNNNN  tamm-2.fa
3382954  ATGTGCAGNNNNNNANNNNNNNNNNACCATCAANNNANNNNNNNNNNGATATCAACCTCGAGANNNNNNNNNNNNNNNNN  ts-1.fa
3382954  ATGTGCAGGAGATGTTGATCANGTAACCATCAAACCTACANNNNNNNGATATCAACCTCGAGAAANNNNNNNNNNNNNNN  tsu-1.fa
3382954  ATGTGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
3383034  TAGATGACAACAATAGAAACAACTGAAGATGGGGTAGAGCGTCTATCTCAGGGTTCAATCTACCAATGAAAATATATACC  chr1.fa
3383034  TAGATGACAACAATNGAAACAACTGAAGATGGGGTAGAGCGTCNANNNTNNNGTTCAATCTACCAATGAAAATATATACC  bay-0.fa
3383034  NANNNNNNNNNNNNNNNAACAACTGAAGATGGGGTAGAGCGTCTATCTCAGGGTTCAATCTACCNNNNNNNNNNNNNNNN  bor-4.fa
3383034  TAGATGACAACNNNNNNAACAACTGAAGATGGGGTAGAGCGTCTATCTCAGGGTTCAATCTACNNNNNNNNNNNNNNNNN  br-0.fa
3383034  TAGATGACAACAANAGAAACAACTGAAGATGGGGTAGAGCGTCTATCTTNNNNNNNNNNNNNNNNNNNNNNNNNNATACC  bur-0.fa
3383034  TAGATGACAACAATAGAAACAACTGAAGATGGGGTAGAGCGTCTATCTCAGGGTTCAATCTACCAANNNNNNNNNNNNNN  c24.fa
3383034  TAGATGACAACNNNNNNAACAACTGAAGATGGGGTAGAGCGTCTATCTCAGGGTTCAATCTACCNNNNNNNNNNNNNNNN  col-0.fa
3383034  TAGATGACAACAATAGAAACAACTGAAGATGGGGTAGAGCGTCTATCTCAGGGTTCAATCTACCNNNNNNNNNNNNNNNN  cvi-0.fa
3383034  NAGATGACAACAATNGAAACAACTGAAGATGGGGTAGAGCGTCTATCTCAGGGTTCAATCNNNNNNNNNNNNNNNNNNNN  est-1.fa
3383034  NAGATGACAACAATAGAAACAACTGAAGATGGGGTAGAGCGTCTATCTCAGGGTTCAATCTNNNNNNNNNNNNNNNNNNN  fei-0.fa
3383034  NNNNNNNNNNNNNNNNNNNNNNNNNNNGATGGGGTAGAGCGTCNNNNNTNNNNNNNNNNNNANNNNNNNNNNNNNNNNNN  got-7.fa
3383034  TAGATGACNACAATANAAACAACTGAAGATGGGGTAGAGCGTCTATCTCAGGGTTCAATCTACNNNNNNNNNNNNNNNNN  ler-1.fa
3383034  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTAGAGCGTCTATCTCAGGGTTCAATCTANNNNNNNNNNNNNNNNNN  lov-5.fa
3383034  TAGATGACAACNNNNNNAACAACTGAAGATGGGGTAGAGCGTCTATCTCAGGGTTCAATCTACCNNNNNNNNNNNNNNNN  nfa-8.fa
3383034  TAGATGACAACAATAGAAACAACNGAAGATGGGGTAGAGCGTCTATCTCAGGGTTCAATCTANNNNNNNNNNNNNNNNNN  rrs-10.fa
3383034  TAGATGNCAACAANAGAAACAACTGAAGATGGGGTAGAGCGTCTATCTCAGGGTTCAATCTANNNNNNNNNNNATATACC  rrs-7.fa
3383034  TAGATGACAACNNNNNNNNCNNCNNNNGATGGGGTAGAGCGNNNNNNNTNNNNNNNNATCTACCAATNNNNNNNNNTNNC  sha.fa
3383034  NAGATGACAACNNNNNNNNNNNNNNNNNNNNNGGTAGAGCGTCTATCTCAGGGTTCAATCTACNNNNNNNNNNNNNNNNN  tamm-2.fa
3383034  NAGATGACAACNNNNNNAACAACTGAAGATGGGGTAGAGCGTCTATCTCAGGGTTCAATCNGNNNNNNNNNNNNNNNNNN  ts-1.fa
3383034  NNNNNNNNNNNNNNNNNNNNANCTGAAGATGGGGTAGAGCGNNNNNNNTNNNNNNNNATCTACCNNNNNNNNNNNNNNNN  tsu-1.fa
3383034  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGTAGAGCGTCTATCTCAGGGTTCAATCTACNNNNNNNNNNNNNNNNN  van-0.fa
 
3383114  TAGAGCAAAGAAAGCACCTATATTACAACGGCTACCAAACACTTGAGGAACAATCAAAACAATCCAAAACAACTAGCAGG  chr1.fa
3383114  NAGAGCAAAGAAAGCACCTATATTACAARGGCTACCAAANARTTGAGGAACAATCANNNNNNNNCAAAACAACNAGCAGG  bay-0.fa
3383114  NNGAGCAAAGAAAGCACCTATATTACAARGGCTACCAAACARTTGAGGAACAATCANNNNNNNNNNAAACAACTAGCAGG  bor-4.fa
3383114  NNNNNNNNNNNNNANNNNNNNATTACAARGGCTACCAAACARTTGAGGAACAANCNNNNNNNNNCAAAACAACTAGCAGG  br-0.fa
3383114  TAGAGCAAAGAAAGCACCTATATTACAARGGCTACCAAACARTTGAGGAACAANCNNNNNNNNNCAAAACAACTAGCAGG  bur-0.fa
3383114  NNNNNCANNNNNNANNNNNATATTACAARGGCTACCAAACARTTGAGGAACAATCAANNNNNNNCAAAACAACTAGCAGG  c24.fa
3383114  NAGAGCAAAGAAAGCACCTATATTACAARGGCTACCAAACARTTGAGGAACAATCAANNNNNNNCAAAACAACTAGCAGG  col-0.fa
3383114  NNNNNNNNNNNNNANNNNNNNATTACAARNGCTACCAAACARTTGAGGAACAATCAAAANNNNCCAAAACAACTAGCAGG  cvi-0.fa
3383114  NNNNNNNNNNNNNNNNNNNATATTACAARGGCTACCAAACARTTGAGGAACAANCAAAANNNNNCAAAACAACTAGCAGG  est-1.fa
3383114  NNNNNNNNNNNNNNNNNNNNNATTACAARGGCTACCAAACARNTGAGGAACAATCANNNNNNNCCAAAACAACTAGCAGG  fei-0.fa
3383114  NNNAGCAAAGAAAGCANCTATATTACAARGGCTACCAAACARNTGAGGAACAANCNNNNNNNNCCAAAACAACTAGCAGG  got-7.fa
3383114  NNNNGCAAAGAAAGCACCTATATTACAARGGCTACCAAACARTNGAGGAACAANCNNNNNNNNNCAAAACAACTAGCAGG  ler-1.fa
3383114  NNNNNNNNNNNNNNNNNNNNNNNNACNARGGCTACCAAACARTNNAGGNNNNNNNNNNNNNNNNNNNNNCAACTAGCAGG  lov-5.fa
3383114  NNNNNNNNNNNNNNNNNNNNTATTACAARGGCTACCAAACARTTGAGGAACAANCNNNNNNNNCCAAAACAACTAGCAGG  nfa-8.fa
3383114  NNNNNNNNNNNNNANNNNNNNATTACAARGGCTACCAAACARTTGAGGAACAATCAAANNNNNCCAAAACAACTAGCAGG  rrs-10.fa
3383114  TAGAGCAAAGAAAGCACCTATATTACAARGGCTACCAAACARTTGAGGAACAANCAAAANNNNNNNAAACAACTAGCAGG  rrs-7.fa
3383114  NAGAGCAAAGAAAGCACCTATATTACAARGGCTACCAAACARNTGAGGAACAANCANNNNNNNNCAAAACAACTAGCAGG  sha.fa
3383114  NNNNNNNNNNNNNNNNNNNNNNTTACAARGGCTACCAAACARTTGAGGAACAANCNNNNNNNNCCAAAACAACTAGCAGG  tamm-2.fa
3383114  NNNNNNNNNNNNNNNNNNNNNATTACAARGGCTACCAAACARTTGAGGAACAANCNNANNNNNNCAAAACAACTAGCAGG  ts-1.fa
3383114  NNNNGCAAAGAAAGCACCTATATTACAARGGCTACCAAACARTTGAGGAACAANCANAANNNNNNNAAACAACTAGCAGG  tsu-1.fa
3383114  NNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNACCAANNNRNNNNNNNNNNNNNNNNNNNNNCCAAAACAACTAGCAGG  van-0.fa
 
3383194  TGCACAAAAGGCAGAGACTTGAAAGTTGTTTTCTTGAGACAAAGGTTGAAGACTCTCAGACGCAAAGTGTCAAGAAATAT  chr1.fa
3383194  TGCACAAAAGGCAGAGACTTGAAAGTTGTTTTCTTGAGACAAAGGTTGAAGACTCTCAGACGCAAAGTGTCAAGAAATAT  bay-0.fa
3383194  TGCACAAAAGGCAGAGACTTGAAANNNNNNNNCTTGAGACAAAGGTTGAAGACTCTCAGACGCAAAGTGTCAANNNNNNN  bor-4.fa
3383194  TGCACAAAAGGCAGAGACTTGAAAGTTGTTTTCTTGAGACAAAGGTTGAAGACTCTAAGACGCAAAGTGTCAAGNNNNNN  br-0.fa
3383194  TGCACAAAAGGCAGAGACTTGAAAGTTGTTTTCTTGAGACAAAGGTTGAAGACTCTCAGACGCAAAGTGTCAAGAAATAT  bur-0.fa
3383194  TGCACAAAAGGCAGAGACTTGAAAGTTGTTTTCTTGAGACAAAGGTTGAAGACTCTAAGACGCAAAGTGTCAAGAAATAT  c24.fa
3383194  TGCACAAAAGGCAGAGACTTGAAAGTTGTTTTCTTGAGACAAAGGTTGAAGACTCTCAGACGCAAAGTGTCAAGAANNNN  col-0.fa
3383194  TGCACAAAAGGCAGAGACTTGAAAGTTGTTTTCTTGAGACAAAGGTTGAAGACTCTAAGACGCAAAGTGTCAAGAAANNN  cvi-0.fa
3383194  TGCACAAAAGGCNNNNNNNNNNNNNNNNNNNNCTTGAGACAAAGGTTGAAGACNNNANNNCGCAAAGTGTCAANNNNNNN  est-1.fa
3383194  TGCACAAAAGGCANNNNNNNNNNNNNNNNNTTCTTGAGACAAAGGTTGAAGACTNNANNNCGCAAAGTGTCAAGAAANNN  fei-0.fa
3383194  TGCACAAAAGGCAGAGACTTGAAAGTTGTTTTCTTGAGACAAAGGTTGAAGACTCTCAGACGCAAAGTGTCAAGNNNNNN  got-7.fa
3383194  TGCACAAAAGGCAGAGACTTGAANGTTGTTTTCTTGAGACAAAGGTTGAAGACTCTCAGACGCAAAGTGTCAANNNNNNN  ler-1.fa
3383194  TGCACAAAAGGCAGAGNNNNNNNNNNNNNNNNCNTGAGACAAAGGTNNNNNNNNNNANNNNNNNAAGTGTCANNNNNNNN  lov-5.fa
3383194  TGCACAAAAGGCAGAGACTTGAAAGTTGTTTTCTTGAGACAAAGGTTGAAGACTCTANNNCGCAAAGTGTCAAGAAANNN  nfa-8.fa
3383194  TGCACAAAAGGCAGAGACTTGAAAGTTGTTTTCTTGAGACAAAGGTTGAAGACTCTAAGACGCAAAGTGTCAAGANNNNN  rrs-10.fa
3383194  TGCACAAAAGGCAGAGACTTGAAAGTTGTTTTCTTGAGACAAAGGTTGAAGACTCTCAGACGCAAAGTGTCAAGNNNNNN  rrs-7.fa
3383194  TGCACAAAAGGCAGAGACTTGAAAGTTGTTTTCTTGAGACAAAGGTTGAAGACTCTCAGACGCAAAGTGTCAAGNNNNNN  sha.fa
3383194  TGCACAAAAGGCAGAGACTTGAAAGTTGTTTTCTTGAGACAAAGGTTGAAGACNNNANNACGCAAAGTGTCAAGNNNNNN  tamm-2.fa
3383194  TGCACAAAAGGCANNNNNNNNNNNNNNNNNNTCTTGAGACAAAGGTTGAAGACNNNANNACGCAAAGTGTCAANNNNNNN  ts-1.fa
3383194  TGCACAAAAGGCAGAGACTTGAAAGTNNNNNNNNTGAGACAAAGGTTGAAGACTCTCAGACGCAAAGTGTCAANNNNNNN  tsu-1.fa
3383194  TGCACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGAAGACTCTNAGACGCAAAGTGTCAAGNNNNNN  van-0.fa
 
3383274  GTAAATATACCTATGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  chr1.fa
3383274  GTAAATATACCTATGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  bay-0.fa
3383274  NNNNNNNNNNNNNTGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  bor-4.fa
3383274  NNNNNNNNNNNNATGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  br-0.fa
3383274  GTANNNNNNNCTATGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  bur-0.fa
3383274  GNNNNNNNNNNNATGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  c24.fa
3383274  NNNNNNNNNNNNATGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  col-0.fa
3383274  NNNNNNNNNNNNATGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  cvi-0.fa
3383274  NNNNNNNNNNNNNTGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  est-1.fa
3383274  NNNNNNNNNNNNATGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  fei-0.fa
3383274  NNNNNNNNNNNNNNNNTATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  got-7.fa
3383274  NNNNNNNNNNNNNNNATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  ler-1.fa
3383274  NNNNNNNNNNNNNNNNTATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  lov-5.fa
3383274  NNNNNNNNNNNNATGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  nfa-8.fa
3383274  NNNNNNNNNCCNATGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  rrs-10.fa
3383274  NNNNNNNNNNNNNNNNTATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  rrs-7.fa
3383274  NNNNNNNNNNNNATGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  sha.fa
3383274  NNNNNNNNNNNNNNNATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  tamm-2.fa
3383274  NNNNNNNNNNNNNNGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  ts-1.fa
3383274  NNNNNNNNNNNNNNNNTATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  tsu-1.fa
3383274  NNNNNNNNNNNTATGATATCTGGGACACCCTTCTTCTCCACAATTGTGTGTGCCATTTCTTCGACACTGCTGTTTGATTT  van-0.fa
 
3383354  CTGCAAACATAAGACCATAAATCTTCCTCACTTCAAAAACCGAACTCAAATGAAAAATAAATTAGGCCGTTGCTGAACAA  chr1.fa
3383354  CTGCAAACATAAGACCATAAATCTTCCTCACTTCAAAAACCGAACTCANNNNNNAAATAAATTAGGCCGTTGCTGAACAA  bay-0.fa
3383354  CTGCAAACATAAGACCANAAATCTTCNTCACTTCAAAAACCGAANNNNNNNNNNNNNNAAATTAGGCCGTTGCTGAACAA  bor-4.fa
3383354  CTGCAAACATAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGCCGTTGCTGAACAA  br-0.fa
3383354  CTGCAAACATAAGACCATAAATCTTCCTCACTTCAAAAACCGAACTCAAATGAAAAATAAATTAGGCCGTTGCTGAACAA  bur-0.fa
3383354  CTGCAAACATAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGCCGTTGCTGAACAA  c24.fa
3383354  CTGCAAACATAAGACCATAAATCTTCCNNNNNTCAAAAACCGAACNCNNNNNNNNAATAAATTAGGCCGTTGCTGAACAA  col-0.fa
3383354  CTGCAAACATAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGCCGTTGCTGAACAA  cvi-0.fa
3383354  CTGCAAACATAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTGCTGAACAA  est-1.fa
3383354  CTGCAAACATAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGCCGTTGCTGAACAA  fei-0.fa
3383354  CTGCAAACANNNNNNNANAAATCTTCCTCACTTCAAAAACCGAACNNNNNNNNNNNNNAAATTAGGCCGTTGCTGAACAA  got-7.fa
3383354  CTGCAAACATAANANNANAAATCNNNNNNNCTTCAAAAACCGAACNCNNNNNNNNAANAAATTAGGCCGTTGCTGAACAA  ler-1.fa
3383354  CNGCAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNGCTGAACAA  lov-5.fa
3383354  CTGCAAACATAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNGCCGTTGCTGAACAA  nfa-8.fa
3383354  CTGCAAACATAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNGCCGTTGCTGAACAA  rrs-10.fa
3383354  CTGCAAACATAAGACCATAAATCTTCCTCACTTCAAAAACCGAACNNNNNNNNNNNNNNAATTAGGCCGTTGCTGAACAA  rrs-7.fa
3383354  CTGCAAACATAANACCATAAATCTTCCTCACTTCNAAAACCGAACNNNNNNNNNNNANAAATTAGGCCGTTGCTGAACAA  sha.fa
3383354  CTGCAAACATAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNGCCGTTGCTGAACAA  tamm-2.fa
3383354  CTGCAAACATAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGCCGTTGCTGAACAA  ts-1.fa
3383354  CTGCAANNNNNNNNNNNNNNATCTTCCNCACTTCAAAAACCGAACTNNNNNNNNNNNNNNATTAGGCCGTTGCTGAACAA  tsu-1.fa
3383354  CTGCAAACATAAGACCANAAATCTTCCTCACTTCAAAAACCGAACTCANNNNNNNNNNNNNNCNNNCCGTTGCTGAACAA  van-0.fa
 
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCAATAAAACTATCTTTATCAAAACTTGGGCAACTTCCAATTCATT  chr1.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCAATAAAACTATCTTTATCAAAACTTGGGCAACTTCCAATTCATT  bay-0.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCAANANNNNNNNNNNNNNCAAAACTTGGGCAACTTCCAATTCATT  bor-4.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAACTTCCAATTCATT  br-0.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCAATAAAACTATCTTTATCAAAACTTGGGCAACTTCCAATTCATT  bur-0.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNTNNAACTTCCAATTCATT  c24.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCAANNNNNNNNNNNNNNNCAAAACTTGGGCAACTTCCAATTCATT  col-0.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNTNNAACTTCCAATTCATT  cvi-0.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNACNTCCAATTCATT  est-1.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGNCNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNACTTCCAATTCATT  fei-0.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCAANNNNNNNNNNNNNNNCAAAACTTGGGCAACTTCCAATTCATT  got-7.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGNCCAATNNNNNNNNNNNNNTCAAAACTTGGGCAACTTCCAATTCATT  ler-1.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNAATTCATN  lov-5.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNACTTCCAATTCATT  nfa-8.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNTNNAACTTCCAATTCATT  rrs-10.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCNNNNNNNNNNNNNNNNNNAAAACTTGGGCAACTTCCAATTCATT  rrs-7.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCAATANNNNNNNNNNNNTCAAAACTTGGGCAACTTCCAATTCATT  sha.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNCTTCCAATTCATT  tamm-2.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNCTTCCAATTCATT  ts-1.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCNNNNNNNNNNNNNNNNNCAAAACTTGGGCAACTTCCAATTCATT  tsu-1.fa
3383434  CAAATTCACCAGGAAAGCAACGATTCATCCAAGTCCAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAATTCATT  van-0.fa
 
3383514  TGACATCACACATTTTTGTGGAACAAAAAATATTATCAATCATCAGCGCCCAGAAAGTTTCTTAATTACAGATAACTAGC  chr1.fa
3383514  TGACATCACACATTTNNNNNNNNNNNAAANNNNNATCAATCATCAGCGCCCAGAAAGTTTCTTAATTACAGATAACTAGC  bay-0.fa
3383514  TGACATCACACATTNNNNNNNNNNNNNNNNNNNNNNCAATCATCAGCGCCCAGAAAGTNNNNNNNNNNNNNNNNNNNAGC  bor-4.fa
3383514  TGACATCACACATTTTTNNNNNNNNNNNNNNNNNNNNNATCATCAGCGCCCAGAAAGTTTCNNNNNNNNNNNNNNNTAGC  br-0.fa
3383514  TGACATCACACATTTTNNNNNNNNNNNNAANATTATCAATCATCAGCGCCCAGAAAGTTTCTTAATTACAGATAACTAGC  bur-0.fa
3383514  TGACATCACACATTTTNNNNNNNNNNNNNNNNNNNNNNATCATCAGCGCCCAGAAAGTTTCTTAATTACAGATAACTAGC  c24.fa
3383514  TGACATCACACATTTTTNNNNNNNNNNNNNNNNNNNCAATCATCAGCGCCCAGAAAGTTNNNNNNNNNNNGATAACTAGC  col-0.fa
3383514  TGACATCACACATTTNNNNNNNNNNNNNNNNNNNNNNNNTCATCAGCGCCCAGAAAGTTTCTNNNNNNNAGATAACTAGC  cvi-0.fa
3383514  TGACATCACACATTTTNNNNNNNNNNNNNNNNNNNNNNNTCATCAGCGCCCAGAAAGTNNNNNNNNNNNNNNNNNNNAGC  est-1.fa
3383514  TGACATCACACATTTNNNNNNNNNNNNNNNNNNNNNNNNNCATCAGCGCCCAGAAAGTTTCTNNNNNNNNGATAACTAGC  fei-0.fa
3383514  TGACANCACACATTTNNNNNNNNNNNNNNNNNNNNNCAATCATCAGCGCCCAGAAAGNNNNNNNNNNNNNNNNNNNNNNC  got-7.fa
3383514  TNNNNNCACACATTNNNNNNNNNNNNNNNNNNNNNNNAATCATCAGCGCCCAGAAAGTNNNNNNNNNNNNNNNNNNNAGC  ler-1.fa
3383514  TGNCANCACACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCCAGAAAGNNNNNNNNNNNNNNNNNNNNNGC  lov-5.fa
3383514  TGACATCACACATTTNNNNNNNNNNNNNNNNNNNNNNNNNCATCANCGCCCAGAAAGTTTNNNNNNNNNNNATAACTAGC  nfa-8.fa
3383514  TGACATCACACATTTTNNNNNNNNNNNNNNNNNNNNNNNNNATCAGCGCCCAGAAAGTTNNNNNNNNNNNGATAANTAGC  rrs-10.fa
3383514  TGACATCACACATTNNNNNNNNNNNNNNNNNNNNNNCAATCATCAGCGCCCAGAAAGTNNNNNNNNNNNNNNNAACTAGC  rrs-7.fa
3383514  TGNNNNCACACATTNNNNNNNNNNNNNNNNNNNNNNCAATCATCAGCGCCCAGAAAGTTTNNNNNNNNNNNNNNNNNAGC  sha.fa
3383514  TGACATCACACATTNNNNNNNNNNNNNNNNNNNNNNNNNTNANNNNNGCCCAGAAAGTTNNNNNNNNNNNNNNNNNNNGC  tamm-2.fa
3383514  TGACATCACACATTTNNNNNNNNNNNNNNNNNNNNNNNNTCATCANCGCCCAGAAAGNNNNNNNNNNNNNNNNNACTAGC  ts-1.fa
3383514  TGACANCACACATTNNNNNNNNNNNNNNNNNNNNNNNAATCATCAGCGCCCAGAAAGTNNNNNNNNNNNNNNNNNNNNNC  tsu-1.fa
3383514  TGACATCACACATTTNNNNNNNNNNNNNNNNNNNNNNAATCATCAGCGCCCAGAAAGTTNNNNNNNNNNNNNNNNCTAGC  van-0.fa
 
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAAGCACGGGAGTCGGAAGAGCGGCAATTACCACATCAGCGGTGAGGAGG  chr1.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAAGCACGGGAGTCGGAAGAGCGGCAATTACCACATCAGCGGTGAGGAGG  bay-0.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAAGCACGGGAGTCGGAAGAGCGGCAATTACCACATCAGCGGTGAGGAGG  bor-4.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAAGCANGNNNNNNNNNNNNNAGGCAATTACCACATCAGCGGTGAGGAGG  br-0.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAAGCACGGGAGTCGGAAGAGCGGCAATTACCACATCAGCGGTGAGGAGG  bur-0.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAAGCANGNNNNNNNNAAGAGAGGCAATTACCACATCAGCGGTGAGGAGG  c24.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAAGCACGGGAGTCGGAAGAGCGGCAATTACCACATCAGCGGTGAGGAGG  col-0.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAAGCANGNNNNNNNNAANNNAGGCAATTACCACATCAGCGGTGAGGAGG  cvi-0.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAANNNGNNNNNNNNNAAGAGAGGCAATTACCACATCAGCGGTGAGGAGG  est-1.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAANNNGNNNNNNNNNNAGAGAGGCAATTACCACATCAGCGGTGAGGAGG  fei-0.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAAGCACGGGAGTCGGAAGAGCGGCAATTACCACATCAGCGGTGAGGAGG  got-7.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAAGCACGGGAGTCGGAAGAGCGGCAATTACCACATCAGCGGTGAGGAGG  ler-1.fa
3383594  ATCAAATTNCANACNGAACACGGAAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACCACATCAGCGGTGAGGAGG  lov-5.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAAGCANGNNNNNNNNNANNNAGGCAATTACCACATCAGCGGTGAGGAGG  nfa-8.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAANNNGNNNANNNNNNNNNNAGGCAATTACCACATCAGCGGTGAGGAGG  rrs-10.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAAGCACGGGAGTCGGAAGAGCGGCAATTACCACATCAGCGGTGAGGAGG  rrs-7.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAAGCACGGGAGTCGGAAGAGCGGCAATTACCACATCAGCGGTGAGGAGG  sha.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCANNNNNNNNNNNNNNNNNNNAGGCAATTACCACATCAGCGGTGAGGAGN  tamm-2.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCANNNNGNNNNNNNNNNNNNNAGGCAATTACCACATCAGCGGTGAGGAGG  ts-1.fa
3383594  ATCAAATTTCACACAGAACACNNNNNNNNNNNNNCACGGGAGTCGGAAGAGCGGCAATTACCACATCAGCGGTGAGGAGG  tsu-1.fa
3383594  ATCAAATTTCACACAGAACACGGAAGAAATCAAGCANNNNAGTCGGAAGAGCGGCAATTACCACATCAGCGGTGAGGAGG  van-0.fa
 
3383674  AGATGATTGGTCGAAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  chr1.fa
3383674  AGATGATTGGTCGANNNNNAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  bay-0.fa
3383674  AGATGATTGGTCGAAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  bor-4.fa
3383674  AGATGATTGGTCGGAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  br-0.fa
3383674  AGATGATTGGTCGAAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  bur-0.fa
3383674  AGATGATTGGTCGGANAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  c24.fa
3383674  AGATGATTGGTCGAAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  col-0.fa
3383674  AGATGATTGGTCGGAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  cvi-0.fa
3383674  AGATGATTGGTCGGAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  est-1.fa
3383674  AGATGATTGGTCGGAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  fei-0.fa
3383674  AGATGATTGGTCGAAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  got-7.fa
3383674  AGATGATTGGTCGAAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  ler-1.fa
3383674  NNNNNNNNNNNNNGNNNNNNNNNCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  lov-5.fa
3383674  AGNTGATTGGTCNGNNNGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  nfa-8.fa
3383674  AGATGATTGGTCGGAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  rrs-10.fa
3383674  AGATGATTGGTCGAAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  rrs-7.fa
3383674  AGNTGATTGGTCGAAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  sha.fa
3383674  NNNNGATTGGTCGGNNNNGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  tamm-2.fa
3383674  AGATGNTTGGTCGGAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  ts-1.fa
3383674  AGATGATTGGTCGAAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCTTGACTACGAGCGCATCCTATCACAGTGTG  tsu-1.fa
3383674  AGATGATTGGTCGGAGAGGAAAGCTCCGATTGAAGAGCGGTGAGCTTCTCCTGACTACGAGCGCATCCTATCACAGTGTG  van-0.fa
 
3383754  ACCCCTCTTGGCCAGCTCGAGAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  chr1.fa
3383754  ACCCCTCTTGGCCAGCTCGAGANCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  bay-0.fa
3383754  ACCCCTCTTGGCCAGCTCGAGAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  bor-4.fa
3383754  ACCCCTCTTGGCCAGCTCGANAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  br-0.fa
3383754  ACCCCTCTTGGCCAGCTCGAGANCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  bur-0.fa
3383754  ACCCCTCTTGGCCAGCTCGAGAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  c24.fa
3383754  ACCCCTCTTGGCCAGCTCGAGAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  col-0.fa
3383754  ACCCCTCTTGGCCAGCTCGAGAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  cvi-0.fa
3383754  ACCCCTCTTGGCCAGCTCGAGAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  est-1.fa
3383754  ACCCCTCTTGGCCAGCTCGAGAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  fei-0.fa
3383754  ACCCCTCTTGGCCAGCTCGAGAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  got-7.fa
3383754  ACCCCTCTTGGCCAGCTCGAGNNNNNNNGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  ler-1.fa
3383754  ACCCCTCTTGGCCAGCNCNNNNNNNNNNNNNCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  lov-5.fa
3383754  ACCCCTCTTGGCCAGCTCGAGAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  nfa-8.fa
3383754  ACCCCTCTTGGCCAGCTCGAGAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  rrs-10.fa
3383754  ACCCCTCTTGGCCAGCTCGAGAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  rrs-7.fa
3383754  ACCCCTCTTGGCCAGCTCGAGANNNNNNNNNNNNNNTNNNCCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  sha.fa
3383754  ACCCCTCTTGGCCAGCTCGAGAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  tamm-2.fa
3383754  ACCCCTCTTGGCCAGCTCGAGNGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  ts-1.fa
3383754  ACCCCTCTTGGCCAGCTCGAGAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  tsu-1.fa
3383754  ACCCCTCTTGGCCAGCTCGAGAGCTAGGGCTCTTCCCAGACCTTTGCTCACTCCCGTTATCAGAACGGTCCTCGCCGCCA  van-0.fa
 
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCATCGTCATCGTGGCCGATTACCTTCTCTTTCTCTCGTCTCAAAAT  chr1.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGNCATCGTCATCGTGGCCGATTACCTTCTCTTTCTCTCGTCTCAAAAT  bay-0.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCATCGTCATCGTGGCCGATTACCTTCTCNNNNTCTCGTCTCAAAAT  bor-4.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAANGCGTCGNCATCGTCATCGTGGCCGATTACCNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGNCGTCGCCATCGTCATCGTGGCCGATTACCTTCTCTTTCTCTCGTCTCAAAAT  bur-0.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGNCATCGTCATCGTGGCCGATTACCNNNNNNNNNNNNNNNNNNNNNAT  c24.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCATCGTCATCGTGGCCGATTACCTTCTCNNNNNCNNGNCTCAAAAT  col-0.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCATCGTCATCGTGGCCGATTACCNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCATCGTCATCGTGGCCGATTACCNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGNCATCGTCATCGTGGCCGATTACCNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCATCGTCATCGTGGCCGATTACCTTCTNNNNNNNNNNNCTCAAAAT  got-7.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCATCGTCATCGTGGCCGATTACCTTCTCTNNNNNNNNNNNNAAAAT  ler-1.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCATCGTCATCGTGGCCGATTACNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCATCGTCATCGTGGCCGATTACCNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCNTCGTCATCGTGGCCGATTACCTNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCATCGTCATCGTGGCCGATTACCTNNNNNNNNNNTCGTCTCAAAAT  rrs-7.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGNCATCGTCATCGTGGCCGATTACCTTNNNNNNNNNNCGTCTCAAAAT  sha.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCATCGTCATCGTGGCCGATTACNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCATCGTCATCGTGGCCGATTACCNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCATCGTCATCGTGGCCGATTACCTTNNNNNNNNNNNGTCTCAAAAT  tsu-1.fa
3383834  CAATAGAGTTCGCAGCCCCACTGAAAGGCGTCGCCATCGTCATCGTGGCCGATTACCTNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
3383914  GACAAAATGTGCCGCGAAGAATATGTATACATACAGACTTTTTTATTTCATTTATTTACCTTAGCATAACTAGTATTAAA  chr1.fa
3383914  GACAAAATGTGCCGCGAAGAATATGTNNNNNNNCAGACTTTTTTNTTTCATTTNTTTACCTTAGCATAACTAGTATTAAA  bay-0.fa
3383914  GACAAAATGTGCCGCGAAGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
3383914  GACAAAATGTGCCGCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
3383914  GACAAAATGTGCCGCGAAGAATATGTNNNNNNNNAGACTTTTTTNNNNNNNNNNNNTACCTTAGCATAACTAGTANNNNN  bur-0.fa
3383914  GACAAAATGTGCCGCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  c24.fa
3383914  GACAAAATGTGCCGCGAAGAATNNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
3383914  NACAAAATGTGCCGCGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  cvi-0.fa
3383914  NNCAAAATGTGCCGCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
3383914  GACAAAATGTGCCGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  fei-0.fa
3383914  GACAAAATGTGCCGCGAAGAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
3383914  GACAAAATGTGCCGCGAAGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
3383914  NNNAAAATGTGCCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3383914  NNNAAAATGTGCCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  nfa-8.fa
3383914  NACAAAATGTGCCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN