Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 37198 - 38897


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
37198  GAGAAACTGCAAAGGAGAAAGTACTTTATGAGAAATATTTATCCACAAACACTAAGATAAGAGTGATGAGCGAAATTCAA  chr1.fa
37198  GAGAAACTGCAAAGGAGAAAGNACTTTATGAGAAATATTTATCCACAAACACTAAGATAAGAGTGATGAGCGAAATTCAA  bay-0.fa
37198  GAGAAACTGCAAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGATGAGCGAAATTCAN  bor-4.fa
37198  GAGAAACTGCAAAGGAGAANNNNNNNNNNNNNNNNNNNNNANCCNNNNNNNNNNNGATAAGAGTGATGAGCGAAATTCAA  br-0.fa
37198  GAGAAACTGCAAAGGAGAAAGTNCNNNNNNNGAAATATTTATCCACAAACNNNNNNNNNNNNNNNNCNNNNNNNNNTCAA  bur-0.fa
37198  GAGAAACTGCAAAGGAGAAAGTACTTTATNAGAAATATTTATCCACAAACACTAAGATAAGAGTGATGAGCGAAATTCNA  c24.fa
37198  GAGAAACTGCAAAGGAGAANNNNNNNNNNNNNNNNNNNNTATCCACAANCACTAAGANAAGAGTGATGAGCGAAATTCAN  col-0.fa
37198  GAGAAACTGCAAAGGAGAANNNNNNNNNNNNNNNNNATTTATCCACAAACACNNNNNNNNNNNNNNCNNNNNNNNNTCAA  cvi-0.fa
37198  GAGAAACTGCAAAGGAGANNNNNNNNNNNNNNNNNNNNNNNTCCACNNNNNNNAAGATAAGAGTGATGAGCGAAATTCAA  est-1.fa
37198  GAGAAACTGCAAAGGAGAANNNNNNNNNNNNNNAATATTTATCCACAAACACTAAGATAAGAGTGATGAGCGAAATTCAA  fei-0.fa
37198  NAGAAACNGCAAAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
37198  GAGAAACTGCAAAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNAGTGATGAGCGAAATTCAA  ler-1.fa
37198  GAGAAACTGCAAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
37198  GAGAAACTGCAAAGGAGAANNNNNNNNNNNNNNNNTATTTATCCACAAACACTAAGATAAGAGTGATGAGCGAAATTCAA  nfa-8.fa
37198  NNNNNNNNNNNAANGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTAAGATAAGAGTGATGAGCGAAATTCAA  rrs-10.fa
37198  GAGAAACTGCAAAGGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATAAGAGTGATGAGCGAAATTCAA  rrs-7.fa
37198  GAGAAACTGCAAAGGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
37198  GAGAAACTGCAAAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
37198  GAGAAACNGCAAAGGAGANNNNNNNNNNNNNNNNNNNNNNATCCACAAANNNNNNNNNNNNAGTGATGAGCGAAATTCAN  ts-1.fa
37198  GAGAAACNGNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGATGAGCGAAATTCAA  tsu-1.fa
37198  GAGAAACTGCAAAGGAGAANNNNNNNNNNNNNNNNNNNNNNTCCANNNNNNNTAAGATAAGAGTGATGAGCGAAATTCAA  van-0.fa
 
37278  AAGAGAAATCTTTTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAAAAGAATTCCCTTTATTATTAT  chr1.fa
37278  NNNNNNNATCTTTTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAAAANAATTCCCTTTATTATTAT  bay-0.fa
37278  NNNNNNNNNNNNNTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAANNNNNNNNNNNNNNNNNNNNN  bor-4.fa
37278  ANNNNNNNNCTTTTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAAAAGNNNNNNNNNNNNNNNNNN  br-0.fa
37278  AAGNGAAATCTTTTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAAAAGAATTCCNNTNNNNNNNAT  bur-0.fa
37278  ANGANAAATCTTTTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAAAAGAATNCNNTNNNNNNNNAT  c24.fa
37278  NNNNNNNNNNNTTTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAAANNNNNNNNNNNNNNNNNNNN  col-0.fa
37278  AAGNNNNNNNNTTTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAAAAGNNNNNNNNNNNNNNNNNT  cvi-0.fa
37278  ANNNNNNNNNNNNTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAANNNNNNNNNNNNNNNNNNNNN  est-1.fa
37278  ANNNNNNNNNTTTTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAAAAGANNNNNNNNNNNNNNNAT  fei-0.fa
37278  NNNNNNNNNNNNNNCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAAANNNNNNNNNNNNNNNNNNNN  got-7.fa
37278  NNNNNNNNNNNNNNCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAAAANNNNNNNNNNNNNNNNNNN  ler-1.fa
37278  NNNNNNNNNNNNNTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAANNNNNNNNNNNNNNNNNNNNN  lov-5.fa
37278  ANNNNNNNNNNTTTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAAAAGNNNNNNNNNNNNNNNNNT  nfa-8.fa
37278  NNNNNNNNNNNNTTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAANNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
37278  NNNNNNNNNNNNNTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCANNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
37278  NNNNNNNNNNNTTTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAAAAGNNNNNNNNNNNNNNNNNN  sha.fa
37278  NNNNNNNNNNNNTTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAANNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
37278  NNNNNNNNNNNNNTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAAANNNNNNNNNNNNNNNNNNNN  ts-1.fa
37278  NNNNNNNNNNNNNNCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
37278  ANNNNNNNNNNNNTCAAAGTCCACCGTGAAACAGTCGCTGCTTCTCCAGCAGAACTCAAAANNNNNNNNNNNNNNNNNNN  van-0.fa
 
37358  TCACAAAAGCCTCACCCAAACGAATCCACCGCAGCCAAAACCTTCACAAATCTTCATATCAGTAATCAATCACCAGATTC  chr1.fa
37358  TCACAAAAGCCTCNNNNNAACGAATCCANCGNANCCAAAACCTTCACAAATCTTCATATCAGTAATCAATCACCAGATTC  bay-0.fa
37358  NNACAAAAGCCTCACCCAAACGAATCCACCGCAGCCAAAACCNTCACAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
37358  NNACAAAAGCCTCACNCAAACGAATCCACCNNNNNCAAAACCNTCACAAATCTNNNNNNNNNNNATCAATCACCAGATTC  br-0.fa
37358  TCACAAAAGCCTCACCNAAACGAATCCACCGNANCCAAAACCTTCACAAATCTTCATATCAGTAATCAATCACCAGATTC  bur-0.fa
37358  TCACAAAAGCCTCACCNAAACGAATCCACCGCANCCAAAACCNTCACAAATCTTCATATCAGTAATCAATCACCAGATTC  c24.fa
37358  NCACAAAAGCCTCACCCAAACGAATCCACCGCAGCCAAAANNNNNNCAAATCNNNNNNNNNNNAATCAATCACCAGATTC  col-0.fa
37358  TCACAAAAGCCTCACCCAAACGAATCCACCNNNNNNAAAACCTTCACAAATCTTCATATCAGTAATCAATCACCAGATTC  cvi-0.fa
37358  TCACAAAAGCCTCACCCAAACGAATCCACCGCAGCCAAAACCNTCACAAANNNNNNNNNNNNNNNNNAATCACCAGATTC  est-1.fa
37358  TCACAAAAGCCTCACCCAAACGAATCCACCGCANCCAAAACCTTCACAAATCTTCATATCAGNAATCAATCACCAGATTC  fei-0.fa
37358  NNNNNAAAGCCTCACCCAAACGAATCCACCGCAGCCAAAACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNCACCAGATTC  got-7.fa
37358  NNACAAAAGCCTCACCCAAACNNNNNNNNNNNNNNNNNANNNNNNNCAAATCTNNNNNNNNNNNNNCAATCACCAGATTC  ler-1.fa
37358  NNACAAAAGCCTCACCNAAACGAATCCACNNNNNNCAAAACCNTCACAANNNNNNNNNNNNNNNNNNNATCACCAGATTC  lov-5.fa
37358  TCACAAAAGCCTCACCNAAACGAATCCACCNNNNNNAAAACCNTCACAAATCTTCATATCAGNAATCAATCACCAGATTC  nfa-8.fa
37358  NNACAAAAGCCTCACCCAAACGAATCCACCGCAGCCAAAACCTTCACAAANNNNNNNNNNNNNNATCAATCACCAGATTC  rrs-10.fa
37358  NCACAAAAGCCTCACCNAAACGAATCCACCNNNNNCAAAACCNTCACAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
37358  NNACAAAAGCCTCACCNAAACGAATCCACCNNNNNCAAAACCNTCACAAATCTTNNNNNNNNNNNTCAANNNNNNNNNNN  sha.fa
37358  NNNCAAAAGCCTCACCCAAACGAANCCACCNNNNNCAAAANNNNNNCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
37358  NCACAAAAGCCNCACCCAAACGAANCCNCCNNNNCCAAAANNNNNNCAAATNNNNNNNNNNNNAATCAATCACCAGATTC  ts-1.fa
37358  NNACAAAAGCCTCACCCAAACGAATCCACCGCANCCAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNAATCACCAGATTC  tsu-1.fa
37358  NNNCAAAAGCCTCACCCAAACGAATCCACCGCAGCCAAAACCNTCACAAATCTNNNNNNNNNNNNNCAATNNNNNNNNNN  van-0.fa
 
37438  GTATCATTTATGCTAACTTTTAGAGCTAATAAGATTTAGTTAATCGCTTCTATAAGTTTCTCAGCAGCCAAACAGAGATC  chr1.fa
37438  GTATCATTTATGCTAACTTTTAGAGCTAATAAGATTTAGTTAATCGCTTCTATAAGTTTCTCAGCAGCCAAACAGAGATC  bay-0.fa
37438  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAGTTTCTCAGCAGCCAAACAGAGNNN  bor-4.fa
37438  GTATCATTTATGCTAACNNNNNNNNNNNNNNNNNNNNAGTTAANNNNNNCTATAAGTTTCTCAGCAGCCAAACAGAGATC  br-0.fa
37438  GTATCATTTATGCTAACTTTTAGAGCTAATAAGATTTAGTTAATCGCTTCTATAAGTTTCTCAGCAGCCAAACAGAGATC  bur-0.fa
37438  GTATCATTTATGCTAACTTTTAGAGCTANNNNNNTTTAGTTAATCGCTTCTATAAGTTTCTCAGCAGCCAAACAGAGATC  c24.fa
37438  GTATCATTTNTGCTAACTTTNNNNNNNNNNNNNNNNNAGTTNNNNNNNTCTATAAGTTTCTCAGCAGCCAAACAGAGANN  col-0.fa
37438  GTATCATTTATGCTAACTTTTNGNNNNNNNNNNNNTTAGTTAATCGCTTCTATAAGTTTCTCAGCAGCCAAACAGAGATC  cvi-0.fa
37438  GTATCATTTATGCTAACTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATAAGTTTCTCAGCAGCCAAACAGAGATN  est-1.fa
37438  GTATCATTTATGCTAACTTTTAGAGCTNNNNNNNTTTAGTTAATCGCTTCTATAAGTTTCTCAGCAGCCAAACAGAGATC  fei-0.fa
37438  GTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTTCTCAGCAGCCAAACAGAGATN  got-7.fa
37438  GTATCATTTATGNTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATAAGTTTCTCAGCAGCCAAACAGAGANN  ler-1.fa
37438  GTATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATAAGTTTCTCAGCAGCCAAACAGANNNN  lov-5.fa
37438  GTATCATTTATGCTAACTTTTAGANNNNNNNNNNNNTAGTTAATCGCTTCTATAAGTTTCTCAGCAGCCAAACAGAGATC  nfa-8.fa
37438  GTATCATNNNNNNNNANTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAGTTTCTCAGCAGCCAAACAGAGATN  rrs-10.fa
37438  NNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAGTTTCTCAGCAGCCAAACAGAGNNN  rrs-7.fa
37438  NNNNNNNNNNNNCTAACTTTTAGANNNNNNNNNNNNTAGTTAATCGCTTCTATAAGTTTCTCAGCAGCCAAACAGAGATC  sha.fa
37438  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAGTTTCTCAGCAGCCAAACAGANNNN  tamm-2.fa
37438  GNATCANNNNNNCTAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAGTTTCTCAGCAGCCAAACAGAGANN  ts-1.fa
37438  GTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTTCTCAGCAGCCAAACAGAGNNN  tsu-1.fa
37438  NNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNNNNNNNNTANNNNNNNNTATAAGTTTCTCAGCAGCCAAACAGAGATN  van-0.fa
 
37518  TTAGTATGTTATAGGAATCCTAGAAACTGCTCATAATGTAAACTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  chr1.fa
37518  TTAGTATGTTATAGGAATCCTAGAAACTGCTCANRATGTAAACTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  bay-0.fa
37518  NNNNNNNNNNNNNNNNATCCTAGAAACTGCTNNNRNNNNNNNNNNTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  bor-4.fa
37518  TTANNNNNNNNNNNNNATCCTAGAAACTGCTCATRANGTAAACTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  br-0.fa
37518  TTAGTATGTTATAGGAATCCTAGAAACTGCTCATRATGTAAACTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  bur-0.fa
37518  TTAGTATGTTATAGGAATCCTAGAAACTGCTCATRATGTAAACTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  c24.fa
37518  NNNNNNNNNNNNNNNNNTCCTAGAAACTGCTCNTRATNTAANCTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  col-0.fa
37518  TTANTATGTTATAGGAATCCTAGAAACTGCTCANRATGTAAACTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  cvi-0.fa
37518  NNNNNNNNNNNNNNNNNNCCTAGAAACTGCTCANRANNTAAANTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  est-1.fa
37518  TTAGTATGTTATAGGAATCCTAGAAACTGCTCANRATGTAAACTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  fei-0.fa
37518  NNNNNNNNNNNNNNNNNNCCNAGAAACTGCTNNNRNNNNNNNNNNNNNNACCCTTGAGAGTAGCCATGGAGGAGACAAGT  got-7.fa
37518  NNNNNNNNNNNNNNNNNNNCTAGAAACTGCTCNTRNNNNNNNCTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  ler-1.fa
37518  NNNNNNNNNNNNNNNNNNCCTAGAAACTGCTNNNRNNNNNNNNNNNNATNCCCTTGAGAGTAGCCATGGAGGAGACAAGT  lov-5.fa
37518  TTANTNTGTTATAGGAATCCTAGAAACTGCTCATRATGTAAACTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  nfa-8.fa
37518  NNNNNNNNNNNNNNNNNTCCTAGAAACTGCTCNNRANNTANNNNNNTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  rrs-10.fa
37518  NNNNNNNNNNNNNNNNNTCCTAGAAACTGCTNNNRNNNNNNNNTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  rrs-7.fa
37518  NNNNNATGTTATAGGAATCCTAGAAACTGCTCATRATGTAAACTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  sha.fa
37518  NNNNNNNNNNNNNNNNATCCTAGAAACTGCTNNNRNNNNNNNNTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  tamm-2.fa
37518  NNNNNNNNNNNNNNNNNNCCTAGAAACTGCTCNNRANNTAANCTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  ts-1.fa
37518  NNNNNNNNNNNNNNNNNNNCTAGAAACTGCTNNNRNNNNNNNNNNNNATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  tsu-1.fa
37518  NNNNNNNNNNNNNNNNNTCCTAGAAACTGCTCNNRATGTNAACTGTTATACCCTTGAGAGTAGCCATGGAGGAGACAAGT  van-0.fa
 
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCCCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGAAGCAAAAC  chr1.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGAANCNNNNN  bay-0.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGAAGCAANNN  bor-4.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGAANCAAANN  br-0.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTNNNTNGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGAAGCNNNNN  bur-0.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGAAGCANNNN  c24.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGAAGCANNNN  col-0.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTNNNNNNNNNNGTCATCGTTCCCGGAAATAATCAAATCGGAAGCANNNN  cvi-0.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGAAGCANNNN  est-1.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGAAGCANNNN  fei-0.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGNNNNNNNNNNNNNNNTCATCGTTCCCGGAAATAATCAAATCGGNNNNNNNNN  got-7.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGAAGNNNNNN  ler-1.fa
37598  ATGCAATCNGACTTATCATCTCACCGGNNNNNNNNNNNNNNNGTCATCGTTCCCGGAAATAATCAAATCGGNNNNNNNNN  lov-5.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGAAGCNNNNN  nfa-8.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGAAGCAANNN  rrs-10.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGAAGCANNNN  rrs-7.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAANNNNNNNNNNNNNN  sha.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCNNNNNNNNNNNNNNNN  tamm-2.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGNNNNNNNNN  ts-1.fa
37598  ATGCAATCNGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCNNNNNNNNNNN  tsu-1.fa
37598  ATGCAATCTGACTTATCATCTCACCGGGAACTCNCCGGAGAAGTCATCGTTCCCGGAAATAATCAAATCGGAANNNNNNN  van-0.fa
 
37678  AAAAAAAAATCTCTAAAAATAAATTTAAAAAACAGAGAGAAGAAGGAAGAAGATAACTGAAGAAGAAGAAGAAGAAGAAG  chr1.fa
37678  NNNAAAAANNNRNNNANAANNNNRNNNNNAAACNNNNNNNNNNNNNNNGAAGNNNNNNNNNNNRRRRRRRRRRRRRRRRR  bay-0.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRR  bor-4.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRR  br-0.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNGAAGANNNNNNNNNNRRRRRRRRRRRRRRRRR  bur-0.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNAAACNNNNNNNNNNNNNNNGAANNNNNNNNNNNNRRRRRRRRRRRRRRRRR  c24.fa
37678  NNNAAANNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRR  col-0.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRR  cvi-0.fa
37678  NNNNANNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRR  est-1.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNAGAANNNNNNNNNNNNRRRRRRRRRRRRRRRRR  fei-0.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRR  got-7.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRR  ler-1.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRR  lov-5.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNRRRRRRRRRRRRRRRRR  nfa-8.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNRRRRRRRRRRRRRRRRR  rrs-10.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRR  rrs-7.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRR  sha.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRR  tamm-2.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRR  ts-1.fa
37678  NNNNNNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRR  tsu-1.fa
37678  NNNANNNNNNNRNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRR  van-0.fa
 
37758  AAGAAGAAGAAGAAGGAAGACTGTTTTAGGCTGAAGAAGACTGGAAGAAGAAGAAGAGAAGCCAGAAGCAATCTCAGCCA  chr1.fa
37758  RRRRRRRRRRRNNNNNAAGACTGTTTTNGGCTGAAGAANNNNNNNNNNNNNNNNRRNNAANCCAGAAGCAANCTCAGCCA  bay-0.fa
37758  RRRRRRRRRRRNNNNNNNNNCTGTTTTAGGCTGAAGAAGACNNNNNNNNNNNNNRRNNNAGCCAGAAGCAATCTCAGCCA  bor-4.fa
37758  RRRRRRRRRRRNNNNNNNGACTGTTTTAGGCTGAAGAAGNNNNNNNNNNNNNNNRRNNNNNNNNGAAGCAATCTCAGCCA  br-0.fa
37758  RRRRRRRRRRRNNNNNNAGACTGTTTTAGGCTGAAGAAGACTGGANNNNNNNNNRRNNNAGCCAGAAGCAATCTCAGCCA  bur-0.fa
37758  RRRRRRRRRRRNNNNNNNGACTGTTTTAGGCTGAAGAAGACNNNNNNNNNNNNNRRNNNAGCCAGAAGCAATCTCAGCCA  c24.fa
37758  RRRRRRRRRRRNNNNNNNGACTGTTTTAGGCTGAAGAANNNNNNNNGANNNNNNRRNNNAGCCAGAAGCAATCTCAGCCA  col-0.fa
37758  RRRRRRRRRRRNNNNNNNGACTGTTTTAGGCTGAAGAAGACNNNNNNNNNNNNNRRNNNAGCCAGAAGCAATCTCAGCCA  cvi-0.fa
37758  RRRRRRRRRRRNNNNNNNGACTGTTTTAGGCTGAAGAAGACNNNNNNNNGNNNNRRNNNAGCCAGAAGCAATCTCAGCCA  est-1.fa
37758  RRRRRRRRRRRNNNNNNAGACTGTTTTAGGCTGAAGAAGACNNNNNNNNNNNNNRRNNNAGCCNGAAGCAATCTCAGCCA  fei-0.fa
37758  RRRRRRRRRRRNNNNNNNGACTGTTTTAGGCTGAAGAANNNNNNNNNNNNNNNNRRNNNAGCCAGAAGCAATCTCAGCCA  got-7.fa
37758  RRRRRRRRRRRNNNNNNAGACTGTTTTAGGCTGAAGAANNNNNNNNNNNNNNNNRRNNNAGCCAGAAGCAATCTCAGCCA  ler-1.fa
37758  RRRRRRRRRRRNNNNNNNGACTGTTTTAGGCTGAAGAAGNNNNNNNNNNNNNNNRRNNNNGCCAGAAGCAATCTCAGCCA  lov-5.fa
37758  RRRRRRRRRRRNNNNNNNGACTGTTTTAGGCTGAAGAANNNNNNNNNNNNNNNNRRNNNAGCCAGAAGCAATCTCAGCCA  nfa-8.fa
37758  RRRRRRRRRRRNNNNNNNGACTGTTTTAGGCTGAAGAAGACTGGANNNNNNNNNRRNNNAGCCAGAAGCAATCTCAGCCA  rrs-10.fa
37758  RRRRRRRRRRRNNNNNNNNACTGTTTTAGGCTGAAGAAGACNNNNNGNNNNNNNRRNNNAGCCAGAAGCAATCTCAGCCA  rrs-7.fa
37758  RRRRRRRRRRRNNNNNNNGACTGTTTTAGGCTGAAGAAGNNNNNNNNNNNNNNNRRNNNAGCCAGAAGCAATCTCAGCCA  sha.fa
37758  RRRRRRRRRRRNNNNNNNNACTGTTTTAGGCTGAAGAANNNNNNNNNNNNNNNNRRNNNAGCCAGAAGCAATCTCAGCCA  tamm-2.fa
37758  RRRRRRRRRRRNNNNNNNNACTGTTTTAGGCTGAAGAANNNNNNNNNNNNNNNNRRNNNNNCCAGAAGCAATCTCAGCCA  ts-1.fa
37758  RRRRRRRRRRRNNNNNNNNNCTGTTTTNGGCTGAAGANNNNNNNNNNNNNNNNNRRNNNNNNCAGAAGCAATCTCAGCCA  tsu-1.fa
37758  RRRRRRRRRRRNNNNNNNNACTGTTTTAGGCTGAAGAAGACTGGAAGANNNNNNRRNNNAGCCAGAAGCAATCTCAGCCA  van-0.fa
 
37838  CAACAATTTTTCCCCTAATTTTTGGAAAAATTTTAATTGAAAAGTTTATTTGAGGCTGGAACAGCACCAAGGGTATAAAT  chr1.fa
37838  CAACAATTTTTCCCCNNNNNNNNNNNNNNNNTTTAATTGAAAAGTTTATTTGAGGCTGGAACAGCACCAAGGGTATAAAN  bay-0.fa
37838  CAACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATTTGAGGCTGGAACAGCACCAAGGGTATANNN  bor-4.fa
37838  CAACAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATTTGAGGCTGGAACAGCACCAAGGGTATAAAN  br-0.fa
37838  CAACAATTTTTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTTATTTGAGGCTGGAACAGCACCAAGGGTATAAAT  bur-0.fa
37838  CAACAATTTTTCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTATTTGAGGCTGGAACAGCACCAAGGGTATAAAN  c24.fa
37838  CAACAATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATTTGAGGCTGGAACAGCACCAAGGGTATAAAN  col-0.fa
37838  CAACAATTTTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATTTGAGGCTGGAACAGCACCAAGGGTATAAAN  cvi-0.fa
37838  CAACAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATTTGAGGCTGGAACAGCACCAAGGGTATAANN  est-1.fa
37838  CAACAATTTTTCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATTTGAGGCTGGAACAGCACCAAGGGTATAAAN  fei-0.fa
37838  CAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNTTTGAGGCTGGAACAGCACCAAGGGTATANNN  got-7.fa
37838  CAACAATTTTNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGAGGCTGGAACAGCACCAAGGGTATAAAN  ler-1.fa
37838  CAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTTGAGGCTGGAACAGCACCAAGGGTATANAN  lov-5.fa
37838  CAACAATTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATTTGAGGCTGGAACAGCACCAAGGGTATAANN  nfa-8.fa
37838  CNACNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATTTGAGGCTGGAACAGCACCAAGGGTATAAAN  rrs-10.fa
37838  CAACAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATTTGAGGCTGGAACAGCACCAAGGGTATAAAN  rrs-7.fa
37838  CAACAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGCTGGAACAGCACCAAGGGTATAAAN  sha.fa
37838  CAACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTGGAACAGCACCAAGGGTATAAAN  tamm-2.fa
37838  CAACAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGAGGCTGGAACAGCACCAAGGGTATAAAN  ts-1.fa
37838  CAACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGAGGCTGGAACAGCACCAAGGGTANNNNN  tsu-1.fa
37838  CAACAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATTTGAGGCTGGAACAGCACCAAGGGTATAANN  van-0.fa
 
37918  GGAAAAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  chr1.fa
37918  GRAAAAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  bay-0.fa
37918  NRNNNAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  bor-4.fa
37918  NRNNNAAACAGAAGTCATCGCAGANCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  br-0.fa
37918  GRAAAAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  bur-0.fa
37918  GRAAAAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATNTCTCAAG  c24.fa
37918  NRNNNAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  col-0.fa
37918  NRNAAAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  cvi-0.fa
37918  NRNNNAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  est-1.fa
37918  GRAAAAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  fei-0.fa
37918  NRNNNAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATNTCNAG  got-7.fa
37918  NRNANAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  ler-1.fa
37918  NRNNNAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTNTTGGTATATCTCAAG  lov-5.fa
37918  NRAAAAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  nfa-8.fa
37918  NRNNNAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  rrs-10.fa
37918  NRNNNAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  rrs-7.fa
37918  NRNNNAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  sha.fa
37918  NRNNNAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  tamm-2.fa
37918  NRNNNAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  ts-1.fa
37918  NRNNNAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTNGTGGCTGTCTACTGCACTTTTTGGTNNNNNNNANG  tsu-1.fa
37918  NRNNNAAACAGAAGTCATCGCAGATCGACACGTGGTGATATTGTAGTGGCTGTCTACTGCACTTTTTGGTATATCTCAAG  van-0.fa
 
37998  TTGCTTCTCTACGAGCCAGAAGCTTCAATGTGAAGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  chr1.fa
37998  TTGCTTCTCTACGAGCCNNNNNNNNNNNNGNNNNNNNCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  bay-0.fa
37998  TTGCTTCTCTACGAGCCAGAAGCTNNNNNNNNAAGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  bor-4.fa
37998  TTGCTTCTCTACGAGCCAGAAGCTTCAATGTGAAGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  br-0.fa
37998  TTGCTTCTCTACGAGCCAGAAGCTTCAATGTGAAGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  bur-0.fa
37998  TTGCTTCTCTACGAGCCAGAAGCTNCAATGTGAAGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  c24.fa
37998  TTGCTTCTCTACGAGCCAGAAGCTNNNNNNNNNNGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  col-0.fa
37998  TTGCTTCTCTACGAGCCAGAAGCTNCAATGTGAAGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  cvi-0.fa
37998  TTGCTTCTCTACGAGCCAGAAGCTTCNATGTGAAGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  est-1.fa
37998  TTGCTTCTCTACGAGCCAGAAGCTTCAANGTGAAGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  fei-0.fa
37998  TTGCTTCTCTACGAGCCAGAAGCNNNNNNNNNNNGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  got-7.fa
37998  TTGCTTCTCTACGAGCCAGAAGNNNNNNNNNNNNNCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  ler-1.fa
37998  TTGCTTCTCTACGAGCCAGAAGCNNNNNNNNNNNGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  lov-5.fa
37998  TTGCTTCTCTACGAGCCAGAAGNNNNNNNNNNNAGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  nfa-8.fa
37998  TTGCTTCTCTACGAGCCAGAAGCTTCNNNNNNNAGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  rrs-10.fa
37998  TTGCTTCTCTACGAGCCAGAAGCTNCANNNTGAAGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  rrs-7.fa
37998  TTGCTTCTCTACGAGCCAGAAGNNNNNNNNNNNNGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  sha.fa
37998  TTGCTTCTCTACGAGCCAGAAGCTNNNNNNNNAAGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  tamm-2.fa
37998  TTGCTTCTCTACGAGCCAGAAGCNNNNNNNNNNNNCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  ts-1.fa
37998  TTGCTTCTCTACGAGCCAGAAGNNNNNNNNNNNNNCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGN  tsu-1.fa
37998  TTGCTTCTCTACGAGCCAGAAGCTTCAATGTGAAGCTCACGTAGGTAAAAGTGAGTGTGGTGGTCCACAATTGCTTACGT  van-0.fa
 
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  chr1.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCNGCTGTGATGGTGTACTGCTACGTATTG  bay-0.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  bor-4.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  br-0.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  bur-0.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCNACGTATTG  c24.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  col-0.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  cvi-0.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  est-1.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  fei-0.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  got-7.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  ler-1.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  lov-5.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  nfa-8.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  rrs-10.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  rrs-7.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  sha.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTNGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  tamm-2.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  ts-1.fa
38078  NNNAACGATTNTTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  tsu-1.fa
38078  GTAAACGATTATTGGTACAAACTTGGACGACTAAACAAGTGGGTACGGTGCCAGCTGTGATGGTGTACTGCTACGTATTG  van-0.fa
 
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCCTATTCTATATAAATTTGCGTATTAA  chr1.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCCTATTCTATATAAATTTGCGTATTAA  bay-0.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGNCATTGTATGGGCCTCACTTTTACGCNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCCNNNNNNNTATNNNNNNGCGTATTAA  br-0.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCCTATTCTATATAAATTTGCGTATTAA  bur-0.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCCTATTCTATATAAATTTGCGTATTAA  c24.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCNNNNNNNNTANNNNNNNGCGTATTAA  col-0.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCCTATTCTATATAANTTTGCGTATTAA  cvi-0.fa
38158  GCTATGCTGGATCTGGGCTTGTAATNNNNNATTGTATGGGCCTCACTTTTACGCNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCCTATTCTATATAAATTTGCGTATTAA  fei-0.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAANACATTGTATGGGCCTCACTTTTACNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGANATTGTATGGGCCTCACTTTTACGNNNNNNNNNNNNNNNNNNNNNNNTNNN  lov-5.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCCTATTCTATATANATTTGCGTATTAA  nfa-8.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCCNNNNNTATNNNNNNNNNNGTATTAN  rrs-10.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCCNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCCTATTCTATATAANTTTGCGTATTAA  sha.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCCNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
38158  GCTATGCTGGATCTGGGCTTGTNNNNNNNNNNNNNATGGGCCTCACTTTTACNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
38158  GCTATGCTGGATCTGGGCTTGTAATAAGACATTGTATGGGCCTCACTTTTACGCNNNNNNNATNNNNNNNNNNNNATNAA  van-0.fa
 
38238  CATAGTTGAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAAAAATCTTCATCTTTTCATATAAT  chr1.fa
38238  CATAGTTGAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAAAAATCTTCATCTTTTCATATAAT  bay-0.fa
38238  NNNNNNNNAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAANNNNNNNNNNNNNNNNNNNNNAT  bor-4.fa
38238  CATAGTTGAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAAAAANNNNNNNNNNNNNNNNNANT  br-0.fa
38238  CATAGTTGAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAAAAATCTTCATCNNNNNATATAAT  bur-0.fa
38238  CATAGTTGAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAAAAATCTTCATCTNNNNNTATAAT  c24.fa
38238  CANAGTTGAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAANNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
38238  CATNGTTGAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAAAAATCNNNNNNNNNNNNNATAAT  cvi-0.fa
38238  NNNNNTTGAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAAAANNNNNNNNNNNNNNNNNNNNN  est-1.fa
38238  CATAGTTGAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAAAAATCTTNNNNNNNNNNNNTAAT  fei-0.fa
38238  NNNNNNNNAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAAANNNNNNNNNNNNNNNNNNNNNN  got-7.fa
38238  NNNNNTTGAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAAAANNNNNNNNNNNNNNNNNNNNN  ler-1.fa
38238  NNNNNNNNAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATANNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
38238  CATAGTTGAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAAAAATCTNNNNNNNNNNNNNTAAT  nfa-8.fa
38238  NNNNNNNGAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAANNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
38238  NNNNNNNGAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATANNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
38238  CATAGTTGAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAAAAATCTNNNNNNNNNNNNNNANT  sha.fa
38238  NNNNNNNNAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGNATAAANNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
38238  NNNNNNNNAATTAAACCCGACAAGCTTGGACTGCTCGGGNAACTTGCGTCTGTATAAAANNNNNNNNNNNNNNNNNNNNN  ts-1.fa
38238  NNNNNNNNNATTAAACCCGACAAGCTTGGACTGCTCGGGGAACNNNNNNNNNTANNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
38238  NNNNNNNNAATTAAACCCGACAAGCTTGGACTGCTCGGGGAACTTGCGTCTGTATAANNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
38318  ATCATGCAATGCCTATACAAAATTTCAACAAATTATCATCGAGAACTTTGGTCAACTTGCTTATATAACATTTGTAGAAA  chr1.fa
38318  ATCATGCAATGCCTATACAAAATTTCAACAAATTATCATCGAGAACTTTGGTCAACTTGCTTATATAACATTTGTAGAAA  bay-0.fa
38318  ATCATGCAATGCCTATACAANNNNNNNNCNNNNNNNNATCGAGAACTTTGGTCAACTTGNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
38318  ATCATGCAATGCCTATACANNNNNNNNACAAATNATCATCGAGAACTTTGGTCAACTTGCTTANNNNNNNNNNNNNGNNN  br-0.fa
38318  ATCATGCAATGCCTATACAAAATTTCAACAAATTATCATCGAGAACTTTGGTCAACTTGCTTATATAACATTTGTAGAAA  bur-0.fa
38318  ATCATGCAATGCCTATACAAAATTTCAACAAATTATCATCGAGAACTTTGGTCAACTTGCTTATATAACATTNGTAGAAA  c24.fa
38318  NTCATGCAATGCCTATACAANNNNNNNNCAAATTNTCATCGAGAACTTTGGTCAACTTGCTTNNNNNNNNNNNNNNNNNN  col-0.fa
38318  ATCATGCAATGCCTATACAAAATTNCAACAAATTATCATCGAGAACTTTGGTCAACTTGCTTATATANNNNNNNNNGANN  cvi-0.fa
38318  NTCATGCAATNCCTATACANNNNNNNNACAAANNNNNATCGAGAACTTTGGTCAACTTGNNNNNNNNNNNNNNNNNNNNN  est-1.fa
38318  ATCATGCAATGCCTATACAAAATNTCAACAAATTATCATCGAGAACTTTGGTCAACTTGCTTATATAACNNNNNNAGAAA  fei-0.fa
38318  NNNNNNNNNNNNNNNTANNNNNNNNNNNNNNNNNNNNNTCGAGAACTTTGGTCAACTNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
38318  NNCATGCAATGCCTATACAANNNNNNNACAAATTATCATCGAGAACTTTGGTCAACTTGCTTNNNNNNNNNNNNNNNNNN  ler-1.fa
38318  NNNANGNNNNNCCTATACNNNNNNNNNNNAAATNATCATCGAGAACTTTGGTCAACTTGCNNNNNNNNNNNNNNNNNNNN  lov-5.fa
38318  ATCATGCAATGCCTATACAANNNNNNNACAAATTATCATCGAGAACTTTGGTCAACTTGCTTATATAANNNNNNNAGAAN  nfa-8.fa
38318  NTCATGCAATGCCTATACAAANNNNNNACAANTTATCATCGAGAACTTTGGTCAACTTGCTNNNNNNNNNNNNNNNNNNN  rrs-10.fa
38318  NNCATGCAATGCCTATACANNNNNNNNNNNNNNNNNNATCGAGAACTTTGGTCAACTTGNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
38318  ATCATGCAATGCCTATACAAANNNNNNACAAATTATCATCGAGAACTTTGGTCAACTTGCTTATATAANNNNNNNNGAAN  sha.fa
38318  NTCATGCAATGCCTATACAANNNNNNNNNNNNNNATCATCGAGAACTTTGGTCAACTTGCNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
38318  ATCATGCAATGCCTATACNNNNNNNNNACAAATNATCATCGAGAACTTTGGTCAACTTGCTTNNNNNNNNNNNNNNNNNN  ts-1.fa
38318  NNCATNNNNNNNNTATNNNNNNNNNNNNNNNNNNNNNNNCGAGAACTTTGGTCAACTNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
38318  ATCATGCAATGCCTATACAAAATNNCNACANNNNNNCATCGAGAACTTTGGTCAACTTGCTNNNNNNNNNNNNNNNNNNN  van-0.fa
 
38398  TTAAGGAACATTAATTACTCTTAAGTCTTAACCGAAGCATGTAGTATTTATTTATGGAATTCAGCAAACATCATTACACT  chr1.fa
38398  TTAAGGAACATTAATTACTCTRAAGTCTTAACCGAAGCATGTAGTATTTATTTATGGAATTCAGCAAACATNATTACACT  bay-0.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNNNTCTTAACCGAAGCATGTNNNNNNNNNNNNNNNNNNTCAGCAAACANNNNNNNNNN  bor-4.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNANTCTTAACCGAAGCATGNNNNNNNNNNNNNNNNAATTCAGCAAACATCNNNNNNNN  br-0.fa
38398  TTAAGGAACATNAATTACNCTRAAGTCTTAACCGAAGCATGTAGTATTTATTTATGGAATTCAGCAAACATNATTACACT  bur-0.fa
38398  TNNNNNNNNNNNNNNTACNNNRAAGTCTTAACCGAAGCATGTAGTATTTATTTATGGAATTCAGCAAACATCATNACACT  c24.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNNNTCTTAACCGAAGCATGTANNNNNNNNNNNNGGAATTCAGCAAACANNNNNNNNNN  col-0.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNAGTCTTAACCGAAGCATGTAGTATTTNTTTATGGAATTCAGCAAACATCNNNNNNNT  cvi-0.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNNNTCTTAACCGAAGCATGTNNNNNNNNNNNNNNNAATTCAGCAAACATCNNNNNNNN  est-1.fa
38398  NNNNNNNNNNNNNNNNACNNNRAAGTCTTAACCGAAGCATGTAGTANNNNNNTATGGAATTCAGCAAACATNATTACACT  fei-0.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNNNNCTTAACCGAAGCANNNNNNNNNNNNNNNNNNNNNNNNNCANNNNNNNNNNNNNN  got-7.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNNNTCTTAACCGAAGCATGTANNNNNNNNNNNNGGAATTCAGCAAACANNNNNNNNNN  ler-1.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNNNTCTTAACCGAAGCATGTNNNNNNNNNNNNNNNNNNTCAGCAAACANNNNNNNNNN  lov-5.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNAGTCTTAACCGAAGCATGTAGTANNNNNTTATGGAATTCAGCAAACATCATNACACT  nfa-8.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNNNTCTTAACCGAAGCNNNNNNNNNNNNNNNATGGAATTCAGCAAANNNNNNNNNNNN  rrs-10.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNNNTCTTAACCGAAGCATGTNNNNNNNNNNNNNNNNATTCAGCAAACANNNNNNNNNN  rrs-7.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNAGTCTTAACCGAAGCATGTAGTNNNNATTTATGGAATTCAGCAAACATCATTNCANT  sha.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNNGTCTTAACCGAAGCATGTNNNNNNNNNNNNNGGAATTCAGCAANNNNNNNNNNNNN  tamm-2.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNNGTCTTAACCGAAGCATGTAGTNNNNNNNNNNNGAATTCAGCAAACATNNNNNNNNN  ts-1.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNNNNCTTAACCGAAGCATNNNNNNNNNNNNNNNNNNNNNNAGCAAANNNNNNNNNNNN  tsu-1.fa
38398  NNNNNNNNNNNNNNNNNNNNNRNNGTCTTAACCGAAGCATGTNNNNNNNNNNNNNNNAATTCAGCAAACATNNNNNNNNN  van-0.fa
 
38478  CATTTTTTTAGATTCCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTAACATAGTTATAGATACTCTAATGTTG  chr1.fa
38478  CATTTTTTTNGRTTCCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTAACATAGTTATAGATACTRRRRRRRRR  bay-0.fa
38478  NNNNNNTTNNGRNNNCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTNNNNNNNNNNNNNNNNNNRRRRRRRRR  bor-4.fa
38478  NNNNTTTTNNGRTNNCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTAACATANNNNNNNNNNNTRRRRRRRRR  br-0.fa
38478  CATTTTTTTAGRTTCCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTAACATAGNNNNNNNNNCTRRRRRRRRR  bur-0.fa
38478  CATTTTTTTAGRTTCCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTAACATAGNNNNNNNTNNNRRRRRRRRR  c24.fa
38478  NNNNTTTTNNGRTTNCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTAACANNNNNNNNNNNNNNRRRRRRRRR  col-0.fa
38478  CNTTTTTTTAGRTTCCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTAACATAGNNNNNNNNNNNRRRRRRRRR  cvi-0.fa
38478  NNNNNNNNNNGRNNNCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTANNNNNNNNNNNNNNNNNRRRRRRRRR  est-1.fa
38478  CATTTTTTTAGRTTCCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTAACATAGNNNNNNNNNCNRRRRRRRRR  fei-0.fa
38478  NNNNNNNNNNNRNNNNNNCTTACAACTGTGTTTTGCTTAAAGNAGAAGCGTNNNNNNNNNNNNNNNNNNNNRRRRRRRRR  got-7.fa
38478  NNNTTTTTTAGRTTNCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTANNNNNNNNNNNNNNNNNRRRRRRRRR  ler-1.fa
38478  NNNNNTTTNAGRNNNNAGCTTACAACTGTGTTTTGCTNAAAGCAGAAGCGTNNNNNNNNNNNNNNNNNNNNRRRRRRRRR  lov-5.fa
38478  CNTTTTTTTAGRTTCCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTAACATNNNNNNNNNNNNNRRRRRRRRR  nfa-8.fa
38478  NNNNNTTTNNGRNNCCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTAANNNNNNNNNNNNNNNNRRRRRRRRR  rrs-10.fa
38478  NNNNNTTTTNGRTNNCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTNNNNNNNNNNNNNNNNNNRRRRRRRRR  rrs-7.fa
38478  CNTTTTTTTAGRTNCCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTAACATANNNNNNNNNNNNRRRRRRRRR  sha.fa
38478  NNNNTTTTNNNRNNNCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTNNNNNNNNNNNNNNNNNNRRRRRRRRR  tamm-2.fa
38478  NNNTTTTTNNGRTTCCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTANNNNNNNNNNNNNNNNNRRRRRRRRR  ts-1.fa
38478  NNNNNNNNNNNRNNNNNGCTTACAACTGTGTTTTGCTTAAAGNAGAAGCNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRR  tsu-1.fa
38478  NNNNTTTTTNGRNNNCAGCTTACAACTGTGTTTTGCTTAAAGCAGAAGCGTTTAANNNNNNNNNNNNNNNNRRRRRRRRR  van-0.fa
 
38558  GAGCAGAGCTTAGTTGCAATATTTTTTGAAGTTGACGGCCTCATCGGTCAGGAAGCCACTACAAAAGGTTACCGAGAACT  chr1.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  bay-0.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRNGGAAGCCACTACAAAAGGTTACCGNNNNNN  bor-4.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  br-0.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  bur-0.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  c24.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  col-0.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  cvi-0.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGNAAGCCACTACAAAAGGTTACCGAGAACT  est-1.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRNGGAAGCCACTACAAAAGGTTACCGAGAACT  fei-0.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  got-7.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  ler-1.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  lov-5.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  nfa-8.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  rrs-10.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGNNNNNN  rrs-7.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  sha.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  tamm-2.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  ts-1.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  tsu-1.fa
38558  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRTRAGGAAGCCACTACAAAAGGTTACCGAGAACT  van-0.fa
 
38638  TTGGTTAGTTCGGTTCGGTTCTAGGTTAACCAAAAAACAATAGACCAGTTTTTGTTACTAACCGAAGAACTGAACTACCC  chr1.fa
38638  TTGGTTRRTTNGGTTCGGTTCTAGGTTAACCAAAAAACAANAGACCAGTTTTTGTTACTAACCGAAGAACNGNNCNACCC  bay-0.fa
38638  NNNNNNRRNNNGGTTCGGTTCTAGGTTAACCAANNNNNNNNNNNNNAGNTTTTGTTACTAACCGAAGAACTGAACTACCC  bor-4.fa
38638  TTGGTTRRTTCGGTTCGGTTCTAGGTTAACCAAAAAACAANAGACCAGNTTTTGTTACTAACCGAAGAACNGAACTACCC  br-0.fa
38638  TTGGTTRRTTCGGTTCGNTTCTAGGNTAACCAAAAAACAATAGACCAGTTTTTGTTACTAACCGAAGAACTGAACTACCC  bur-0.fa
38638  TTGGTTRRTTNGGTTCGGTTCTAGGTTAACCAAAAAACAANAGACCAGTTTTTGTTACTAACCGAAGAACTGAACTACCC  c24.fa
38638  TTGGTTRRTTCGGTTCGGTTCTAGGTTAACCAAAAAANNNNANNNNNGTTTTTGTTACTAACCGAAGAACTGAACTACCC  col-0.fa
38638  TTGGTTRRTTCGGTTCGGTTCTAGGTTAACCAAAAAACAANAGACCAGTTTTTGTTACTAACCGAAGAACTGAACTACCC  cvi-0.fa
38638  TTGGTTRRTTCGGTTCGGTTCTAGGTTAACCAAAAAACAANNNNNNNNNNTTTGTTACTAACCGAAGAACTGAACTACCC  est-1.fa
38638  TTGGTTRRTTCGGTTCGGTTCTAGGTTAACCAAAAAACAATAGACCAGTTTTTGTTACTAACCGAAGAACTGAACTACCC  fei-0.fa
38638  TTGGTTRRTTCGGTTCGGTTCTAGGTNNNNNNNNNNNNNNNNNNNNNNNNNTTGTTACTAACCGAAGAACTGAACTACCC  got-7.fa
38638  TTGGTTRRTTNGGTTCGGTTCTAGGTTAACCAAAAAACNNNNNNNNNNNTTTTGTTACTAACCGAAGAACTGAACTACCC  ler-1.fa
38638  TTGGTTRRTTCGGTTCGGTTCNAGGTTAACCAAAAANNNNNNNNNNNNNTTTTGTTACTAACCGAAGAACNGAACTACCC  lov-5.fa
38638  TTGGTTRRTTCGGTTCGGTTCTAGGTTAACCAAAAAACAATAGNCCAGTTTTTGTTACTAACCGAAGAACTGAACTACCC  nfa-8.fa
38638  TTGGTTRRTTCGGTTCGGTTCTAGGTTAACCAAAAAACAANANNNNNNNTTTTGTTACTAACCGAAGAACTGAACTACCC  rrs-10.fa
38638  NNNNNNRRNTNGGTTCGGTTCTAGGTTANNNNNNAAACNNNNNNNCAGTTTTTGTTACTAACCGAAGAACNGAACTACCC  rrs-7.fa
38638  TTGGTTRRNTNGGTTCGGTTCTAGGTTAACCAAAAAACANNNNNNCAGTTTTTGTTACTAACCGAAGAACTGAACTACCC  sha.fa
38638  TTGGTNRRTTCGGTTCGGTTCTAGGTTAACCAAAAAANNNNNNNNNNNNNNTTGTTACTAACCGAAGAACTGAACTACCC  tamm-2.fa
38638  TTGGNTRRNNNGGTTCGGTTCTAGGTTAACCAAAAAACNNNNNNNNNNNTTTTGTTACTAACCGAAGAACNGAACTACCC  ts-1.fa
38638  TTGGTNRRTNNGGTTCGGTTCTAGGTTANNNNNNNAANNNNNNNNNNNNNNTTGTTNNNNACCGAAGAACNGAACTACCC  tsu-1.fa
38638  TTGGTTRRTTCGGTTCGGTTCTAGGTTAACCAAAAAACAATAGACCAGTTTTTGTTACTAACCGAAGAACTGAACTACCC  van-0.fa
 
38718  GAATCTAATTGAAATAACCGAAATTATTCCAAAATAACCAAACAAACCGGATTTAAATATTTCACAAATCTCTACGTTGA  chr1.fa
38718  GAATCTAATTGAAATAACCGAAANTATTCRAAAANAACCAAACAAACCGGATTTAAATATTTCACAAATCTCTACGTTGA  bay-0.fa
38718  GAATCNNNNNNNNNNNNNCGANNNNNNNNRNNNNNNNNNNAACAAACCNNNNNNNNNNNNNNNNNAAATCTCTACGTTGA  bor-4.fa
38718  GAATCTAATTGAAANAACCGANNNNNNNCRANNNNNNNCAAACNNNNNNNNNNNNNNNNNNNNNCAAATCTCTACGTTGA  br-0.fa
38718  GAATCTAATTGAAATAACCGAAATTATTCRAANANAACCAAACAAACCGGATTTAAATATTTCACAAATCTCTACGTTGA  bur-0.fa
38718  GAATCTAATTGAAATAACCGAAATTATTCRANNATAACCAAACAAACCGGATTTAAATATTTCACAAATCTCTACGTTGA  c24.fa
38718  GAATCTAATNNNNNNNNNCGANNNNNNNNRNNNNNNNNCAAACNAANCGNANNTNNNNNNNNNNCAAATCTCTACGTTGA  col-0.fa
38718  GAATCTAATTGAAANAACCGAAANTATTCRANNNNNNNCAAACAAACCGGATTTAAATNNNNNACAAATCTCTACGTTGA  cvi-0.fa
38718  GAATCNAATTGNNNNNACCGANNNNNNNNRNNNNNNNNNAANCAAANNNNNNNNNNNNNNNNNNCAAATCTCTACGTTGA  est-1.fa
38718  GAATCTAATTGAAANAACCGAAATTATTCRAANNNNNNCAAACAAACCGGATTTAAATATNTCACAAATCTCTACGTTGA  fei-0.fa
38718  GAATCNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNAANAANNNNNNNNNNNNNNNNNNNNNNATCTCTACGTTGA  got-7.fa
38718  GAATCTAATTGAAANAACCGAAATTANTNRNANNNNNNCAAACAAACCNGATTTANNNNNNNNNNAAATCTCTACGTTGA  ler-1.fa
38718  GAATCNNNNNNNNNNNNNNGANNNNNNTCRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTCTACGTTGA  lov-5.fa
38718  GAATCTAATTGNNNNNNCCGAAATTANTCRAAAANAACCAAACAAACCGNANTTAAATANTNCACAAATCTCTACGTTGA  nfa-8.fa
38718  GAATCTAATNNNNNNNNNNGNAANNATTCRNNNNNNNNNNAACAAACCGGNNNNNNNNNNNNNNNNNNNCTCTACGTTGA  rrs-10.fa
38718  GAATCTAATTGNNNNNNNCGANNNNNNTCRNNNNNNNNNNNNNAAACCNNNNTNNNNNNNNNNNNNAATCTCTACGTTGA  rrs-7.fa
38718  GAATCTAATTGNNNNNNCCGAAATTANNCRAAANNNNNNAANCAAACCGGATTTAAANNNNNCACAAATCTCTACGTTGA  sha.fa
38718  GAATCTAATTNNNNNNNNCNNNNNNNNNNRNNNNNNNNNNNNNAAANNNNNNNNNNNNNNNNNNNAAATCTCNACGTTGA  tamm-2.fa
38718  GAATCTAATTGANNNNNNCGAAANTANNCRANNNNNNNNNNNNAAANNNNNNNNNNNNNNNNNNNNAATCTCTACGTTGA  ts-1.fa
38718  GANNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
38718  GAATCTAATTGNNNNNNNNGANNNNNNNNRNNNNNNNNCAAACAAACCGGNNNNNNNNNNNNNNNNAATCTCTACGTTGA  van-0.fa
 
38798  TGTTTGGAATTATAAAATTTTATCTCTCATTACCTCTCCTTAAACATTAACTAGGACATAACAGTTATTTGAAACATACA  chr1.fa
38798  TGTTTGGAATTATAAAATTTTATCTCTCATTACCRCTCCTTAAACATTAACTAGGACATAACAGTTATTTGAAACATACA  bay-0.fa
38798  TGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
38798  TGTTNNNNNNNNNNNNNNNNNNNCTCTCATTNNNRCNNNNNNNNCATTNACTAGGACATAANAGNTANTTGANNNNNNNN  br-0.fa
38798  TGTTTGGAATTATAAAATTNTATCTCTCATTNCCRCTCCTTAAACATTAACTAGGACATAACAGTTATTTGAAACATACA  bur-0.fa
38798  TGTTTGGAATTATNNNNNNNNNNCTCTCATTNCCRCTCCTTAAACATTAACTAGGACATAACAGTTATTTGAAACATACA  c24.fa
38798  TGTTTGNNNNNNNNNNNNNNNNNNNNNCNTNNNNRNNNNNNNNNCATTAACNAGGACANAACAGTTNNNNNNNNNNNNNN  col-0.fa
38798  TGTTTGGAATTANNNNNNNNNNNCTCTCATTNCCRCTCCTTAAACATTAACTAGGACATAACAGTTATTTGAAACANNNN  cvi-0.fa
38798  TGNNNNNNNNNNNNNNNNNNNNNNNNNCNNTNNNRNNNNNNNNNCNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
38798  TGTTTGGAATTANNNNNNNNNNNCTCTCATTACCRCNCCTTAAACATTAACTAGGACATAACAGTTATTTGAAACATACA  fei-0.fa
38798  TGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
38798  TGTTTNNNNNNNNNNNNNNNNNNNTCTCNNNNNNRNNNNNNNNNNATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
38798  TGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
38798  TGTTTGGAATTANNNNNNNNNNNNTCTCATTNCCRCNCCTTAAACATTAACTAGGACATAACAGTTATTTGAAACANANN  nfa-8.fa
38798  TGTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNGNNNNNNNNNNTTNNNNNNNNNNNNNN  rrs-10.fa
38798  TG