Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 40598 - 42297


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
40598  TCGTGGCTTCTAAATTTCTACTTGCATGTTAGAATACAGAATTTTCACTATCTCCTATTTCGATCAACATATCAAACCTT  chr1.fa
40598  TCGTGGCTTCTAAATTTCTACTTGCATGTTAGAATACAGAATTTTCACTATCTCCTATTTCGATCAACATATCAAACCTT  bay-0.fa
40598  TCGTGGCTTCTAAATTTCTACTNNNNNNNNNNNNNNNNNNNTTTTCACTATCTCCTATTTCGATCAACANATCAAACCTT  bor-4.fa
40598  TCGTGGCTTCTAAATTTCTACTTGNNNNNTAGAATACNGAATTTTCACTATCTCCTATTTCGATCAACATATCAAACCTT  br-0.fa
40598  TCGTGGCTTCTAAATTTCTACTTGCATGTTAGAATACAGAATTTTCACTATCTCCTATTTCGATCAACATATCAAACCTT  bur-0.fa
40598  TCGTGGCTTCTAAATTTCTACTTGCATGTTAGAATACAGAATTTTCACTATCTCCTATTTCGATCAACATATCAAACCTT  c24.fa
40598  TCGTGGCTTCTAAATTTCTACTTGCNNNTTAGAATACAGAATTTTCACTATCTCCTATTTCGATCAACATATCAAACCTT  col-0.fa
40598  TCGTGGCTTCTAAATTTCTACTTGCATGTTAGAATACAGAATTTTCACTATCTCCTATTTCGATCAACATATCAAACCTT  cvi-0.fa
40598  TCGTGGCTTCTAAATTTCTACTTNNNNNNNNNAATACAGANTTTTCACTATCTCCTATTTCGATCAACATATCAAACCTT  est-1.fa
40598  TCGTGGCTTCTAAATTTCTACTTGCATGTTAGAATACAGAATTTTCACTATCTCCTATTTCGATCAACATATCAAACCTT  fei-0.fa
40598  TCGTGGCTTCTAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTCGATCAANNNNNNNAACCTT  got-7.fa
40598  TCGTGGCTTCTAAATTTCTACTNNNNNNNNNGAATACNNNNTTTTCACTATCTCCTATTTCGATCAACATATCAAACCTT  ler-1.fa
40598  TCGTGGCTTCTAAATTTCNNNNNNNNNNNNNGAATNNNNNNNNNTCACNANNNNNTATTTCGATCANNNNNNCAAACCTT  lov-5.fa
40598  TCGTGGCTTCTAAATTTCTACTTGCATGTTAGAATACAGAATTTTCACTATCTCCTATTTCGATCAACATATCAAACCTT  nfa-8.fa
40598  TCGTGGCTTCTAAATTTCTACTNNNNNNNNAGAATACANANTTTTCACTANCTCCTATTTCGATCAACATATCAAACCTT  rrs-10.fa
40598  TCGTGGCTTCTAAATTTCNACNNNNNNNNTAGAATACNGAATTTTCACNATCTCCTATTTCGATCAACANATCAAACCTT  rrs-7.fa
40598  NNNNNNNTTCTAAATTTCTACTTGCATGTTAGAATACAGAATTTTCACTATCTCCTATNNNNNNNNNNNNNNNNNNNCTT  sha.fa
40598  NNNNNNNNNCTAAATTNNNNNNNNNNNNNNNNNATNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  tamm-2.fa
40598  TCGTGGCTTCTAAATTTCTACNNNNNNNNNNNNATNNAGANTTTTCACNATCTCCTATTTCGATCAACATATCAAACCTT  ts-1.fa
40598  TCGTGGCTTCTAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCGNNNNNNNNNNNNAACCTT  tsu-1.fa
40598  TCGTGGCTTCTAAATTTCTACTTGCNNNNNNGAATACAGAANTTTCACTATCTCCTATTTCGATCAACATATCAAACCTT  van-0.fa
 
40678  TCCAAGACATAGGCAAAGGGAACCAAAATTAAAGCGGAAATAGCCATTCGATAAGCACCAATGACCATATGGTTCACACC  chr1.fa
40678  TCCAAGACATAGGCAAAGGGAACCAAAATTAAANCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  bay-0.fa
40678  TCCAAGACATAGGCAAAGGGAACCAAAATTAAAGCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  bor-4.fa
40678  TCCAAGACATAGGCAAAGGGAACCAAAATNAAAGCGGAANNARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  br-0.fa
40678  TCCAAGACATAGGCAAAGGNNNNCNNNCNNNAAGCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  bur-0.fa
40678  TCCAAGACATAGGCAAAGGGAACCAAAATTAAAGCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  c24.fa
40678  TCCAAGACATAGGCAAAGGGAACCAAAATTAAAGCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  col-0.fa
40678  TCCAAGACATAGGCAAAGGGAACCAAAATTAAAGCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  cvi-0.fa
40678  TCCAAGACATAGGCAAAGGGAACCAAAATNNNNNNNGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  est-1.fa
40678  TCCAAGACATAGGCAAAGGGAACCAAAATTAAAGCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  fei-0.fa
40678  TCCAAGACATAGGCAANNNNNNNNNNNCNNNNNNCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  got-7.fa
40678  TCCAAGACATAGGCAAAGGGAACCAAAATTAAAGCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  ler-1.fa
40678  TCCAAGACATAGGCAAAGGGAACCAAAATTAAAGCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  lov-5.fa
40678  TCCAAGACATAGGCAAAGGGAACCAAAATTAAAGCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  nfa-8.fa
40678  TCCAAGACATAGGCAAAGGGAACCAAAATNAAAGCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  rrs-10.fa
40678  TCCAAGACATAGGCAAAGGGAACCAAAATTAAAGCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  rrs-7.fa
40678  TCCAAGACATAGGCAAAGGGAACCANNNNGNNNGCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  sha.fa
40678  TCCAAGACATAGGCAAAGGNANNNNNNNNGNNNNCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  tamm-2.fa
40678  TCCAAGACANAGGCAAAGGGAACCAAAATTAAAGCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  ts-1.fa
40678  TCCAAGACATNGGCAAAGGGAACCAAAATTAAAGCGGAAANARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  tsu-1.fa
40678  TCCAAGACATAGGCAAAGGGAACCAAAATTAAAGCGGAAATARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR  van-0.fa
 
40758  AACATCAAGAGCTTTCTTCACAAGTGCATTCACCGAACCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  chr1.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  bay-0.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  bor-4.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCNATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  br-0.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGNCATCACCATCACTATGACCGGTGAAT  bur-0.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  c24.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  col-0.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  cvi-0.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  est-1.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  fei-0.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  got-7.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  ler-1.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  lov-5.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  nfa-8.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  rrs-10.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  rrs-7.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  sha.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  tamm-2.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  ts-1.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  tsu-1.fa
40758  RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRCCATCGCTACATTTGACATCACCATCACTATGACCGGTGAAT  van-0.fa
 
40838  ATTTTTCTACTACTCTCACTCCTTGCATATCTCCAGCCATATCTCTCTCTATATGTGAGTTATTTTTGTGTGTATTACTT  chr1.fa
40838  ATTTTTCTACTACTCTCACTCCTTGCATATCTCCAGCCATATCTCTCTCTATATGTGAGTTNTTTTTGTGTGTNTTACTT  bay-0.fa
40838  ATTTTNNNNNNNNNCTCACTCCTTGCATATCTCCAGCCATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
40838  ATTTNNNNNNTACTCTCACTCCTTGCATATCTCCAGCCATATCTCTCNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNN  br-0.fa
40838  ATTTTTCTACTACTCTCACTCCTTGCATATCTCCAGCCATATCTCTCTCTATATGTGAGTTATTTTTGTGTGTATTACTT  bur-0.fa
40838  ATTTTTCTACTACTCTCACTCCTTGCATATCTCCAGCCATATCTCTCTCTATATGTGAGTTATTTTTGTGTGTNTTACTT  c24.fa
40838  ATTTTTCTACTACTCTCACTCCTTGCATATCTCCAGCCANATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
40838  ATTTTTCTACTACTCTCACTCCTTGCATATCTCCAGCCATATCTCTCTCNNNNNGTGAGTTATTTTNNNNNNNNNTACTT  cvi-0.fa
40838  ATTTTTNTNCTACTCTCACTCCTTGCATATCTCCAGCCATATCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
40838  ATTTTTCTACTACTCTCACTCCTTGCATATCTCCAGCCATATCTCTCTCTNTATGTGAGTTATTTTTGTGTGTATTACTT  fei-0.fa
40838  ATTTNNNNNNNNCTCTCACTCCTTGCATATCTCCAGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
40838  ATTTTTCTACTACTCTCACTCCTTGCATATCTCCAGCCATATNNNNNNNNNNNNNNNNNNNNTTTTNNNNNNNNNNNNNN  ler-1.fa
40838  ATTTNNNNNNNACTCTCACTCCTTGCATATCTCCAGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
40838  ATTTTTCTACTACTCTCACTCCTTGCATATCTCCAGCCATATCTCTCTCNNNNNGTGAGTTNTTNTNNNNNNNNNNNCTT  nfa-8.fa
40838  ATTTNNNNNNNNNTCTCACTCCTTGCATATCTCCAGCCATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
40838  ATTTTNNNNNNNCTCTCACTCCTTGCATATCTCCAGCCATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
40838  ATTTTTCTACTACTCTCACTCCTTGCATATCTCCAGCCANATNTNNNNNNNNNNNNNNNNNNTTTTTGTNNNNNNNNNNT  sha.fa
40838  ATTTNNNNNNNNCTCTCACTCCTTGCATATCTCCAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
40838  ATTTTTCTNNNNNNCTCACTCCTTGCATATCTCCAGCCATANNNNNNNNNNNNNNNNNNNNNNNTTTGNNNNNNNNNNNN  ts-1.fa
40838  NTTNNNNNNNNNCTCTCACTCCTTGCATATCTCCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
40838  ATTTTTCNNNNNCTCTCACTCCTTGCATATCTCCAGCCATATCTCTNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNN  van-0.fa
 
40918  AGAGAGAGATAAGCCCCAATGTGCTTTGAGTTTGGCAACCACAAAGCTTCCCATATTTATAAGAAAAGTGTGTATGTGTT  chr1.fa
40918  AGAGAGAGATAAGCCCCAATGTGNRRRRRRRRRRRRRRRCANAAAGCTTCCCATATTTATAAGAAAAGTGTGTATGTGTT  bay-0.fa
40918  NNNNNGAGATAAGCCCCAATGTGCRRRRRRRRRRRRRRRCANAAAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  bor-4.fa
40918  NNNNAGAGATAAGCCCCAATGTGCRRRRRRRRRRRRRRRCANAAANCTTCNNNNNNNNNNNNNNAAAGTGNNNNNNTGTT  br-0.fa
40918  AGAGAGAGATAAGCCCCAATGTGCRRRRRRRRRRRRRRRCANAAANCTTCCCATATTTATAAGAAANGTGTGTATGTGTT  bur-0.fa
40918  AGAGAGAGATAAGCCCCAATGTGCRRRRRRRRRRRRRRRCANAAANCTTCCCATNTTTATAAGAAAAGTGTGTATGTGTT  c24.fa
40918  NNNNAGAGATAAGCCCCAATGTGCRRRRRRRRRRRRRRRCACAANNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNTGTT  col-0.fa
40918  AGAGAGAGATAAGCCCCAATGTGCRRRRRRRRRRRRRRRCANAAAGCTTCCNNNNNNTATAAGAAAAGTGTGTATGTGTT  cvi-0.fa
40918  NNNGAGAGATAAGCCCCAATGTNCRRRRRRRRRRRRRRRCANAAAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTT  est-1.fa
40918  AGAGAGAGATAAGCCCCAATGTGCRRRRRRRRRRRRRRRCANAAANCTTCCCATNTTTATAAGAAAAGTGTGTATGTGTT  fei-0.fa
40918  NNNNNNAGATAAGCCCCAATGNGCRRRRRRRRRRRRRRRCANAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  got-7.fa
40918  NNNNAGAGATAAGCCCCAATGTGCRRRRRRRRRRRRRRRCANAAAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  ler-1.fa
40918  NNNNNGAGATAAGCCCCAATGTNNRRRRRRRRRRRRRRRCANAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTT  lov-5.fa
40918  AGAGAGAGATAAGCCCCAATGTGCRRRRRRRRRRRRRRRCANAAAGCTTCCNNNNNNTATAAGAAAANNNNNNNTGTGTT  nfa-8.fa
40918  NNNNAGAGATAAGCCCCAATGNGCRRRRRRRRRRRRRRRCACAAAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTT  rrs-10.fa
40918  NNNNAGAGATAAGCCCCAATGTGCRRRRRRRRRRRRRRRCACAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTT  rrs-7.fa
40918  AGAGAGAGATAAGCCCCAATGTGNRRRRRRRRRRRRRRRCNNAAANCTTCCNNNNNNNNNNNNNNNNNNNNNNNNGTGTT  sha.fa
40918  NNNNNGAGATAAGCCCCAATGTGCRRRRRRRRRRRRRRRCNNAAANCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTT  tamm-2.fa
40918  NGAGAGAGATAAGCCCCAATGTGNRRRRRRRRRRRRRRRCANAAAGCTTCCNNNNNNNNNNNNNNNNNNNNNNNNGTGTT  ts-1.fa
40918  NNNNAGAGATAAGCCCCAATGTNNRRRRRRRRRRRRRRRCANAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTT  tsu-1.fa
40918  NNNNNGAGATAAGCCCCAATGTGCRRRRRRRRRRRRRRRCANAAAGCTTNNNNNNNNNNNNNNNNNAGTGNNNNNNTGTT  van-0.fa
 
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTAACGTTAACCTATATTTTTATTCTCCTGAACTACTTATCTAAAATCTT  chr1.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTNACGTTAACCTATATTTTTATTCTCCTGAACTACTTATCTAAAATCTT  bay-0.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  br-0.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTAACGTTAACCTATATTNTTATTCTCCTGAACTACTTATCTAAAATCTT  bur-0.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTAACGTTAACCTATATTTTTNTTCTCCTGAACTACTTATCTAAAATCTT  c24.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTANNNNNNNNNNNNNNNNNNNNNNTCNNNNNNNNNNNNNNNNNNNNNTT  col-0.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTAACGTTAANNNNNNNTNTTNTTCTCCTGNACTACTTATNNNNNATCTT  cvi-0.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT  est-1.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTAACGTTAACCTATATNNNNNTTCTCCTGAACTNCTTATCTNAAATCTT  fei-0.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTT  ler-1.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTT  lov-5.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTAACGTTAACCTATNTNNNNNNNNTNNNNNNNNACTTANNNNNNATCTT  nfa-8.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  rrs-10.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT  rrs-7.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTNACGTTAACCTATNTTNTTNTTCTCCTGAACNACTTATNNNNNNTCTT  sha.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTT  tamm-2.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTT  ts-1.fa
40998  GTTCCACTTTGGACTTACTTAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
40998  GTTCCACTTTGGACTTACTTAGCTTTGACGTTAACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTT  van-0.fa
 
41078  ACTACAGCATATGCATTTGTTTTAATGAAAAGTTAATCAAGCACTTCATACTACACCCTTTAATTTTTTATGTGTACAAT  chr1.fa
41078  ACTACAGCATNTGCATTTGTTTTAATGAAAAGTTAATCAAGCACTTCATACTACACCCTTTAATTTTTTATGTGTACAAT  bay-0.fa
41078  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCANGCACTTCATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
41078  ACTACAGCATATGCATNNNNNNNNNNNNNAAGTTAATCAAGCACTTCATACTACNNNNNNNNNNNNNNNNNNNNNNNNAT  br-0.fa
41078  ACTACAGCATATGCATTTGTTTTAATGAAAAGTTAATCAAGCACTTCATACTACACCCNNNNNNNNNNGNNNNNNNNNAT  bur-0.fa
41078  ACTACAGCATATGCATTTGTTTTAATGAAAAGTTAATCAAGCACTTCATACTACACCNNNNNNNNNNNGNNNNNNNNAAT  c24.fa
41078  ACTACNNNNNNNGCATNNNNNNNNNNNNNNNGTTAATCAAGCACTTCATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
41078  ACTACAGCATATGCATTTGTTTTAATGNAAAGTTAATCAAGCACTTCATACTACACNNNNNNNNNNNNGNNNNNNNNNAT  cvi-0.fa
41078  ACTACAGCATNTNNNNNNNNNNNNNNNNNNNNNNNATCAAGCACTTCATACTNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
41078  ACTACAGCATATGCATTTGTTTTAATGNAAAGTTAATCAAGCACTTCNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNAT  fei-0.fa
41078  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
41078  ACTANNNNNNNNGCNNNNNNNNNNNNNNNNNNTNAATCAAGCACTTCATACTANNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
41078  ACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGCACTTCATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
41078  ACTACAGCATATGCATTTGTTTTAATGAAAAGTTAATCAAGCACTTCATACTACNCCCTTTAATTTTNNNNNNNNNCAAT  nfa-8.fa
41078  ACTACAGCNNNNGCATNNNNNNNNNNNNNNNGTTAATCAAGCACTTCATACTANNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
41078  ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATCAAGCACTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
41078  ACTACAGCANATGCATTTGTTTTAANNNNNNGTTAATCAAGCACTTCATACTACACCNNNNNNNNNNNGNNNNNNNNNNN  sha.fa
41078  ACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNTNAATCAAGCACTTCATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
41078  ACTACANNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCAAGCACTTCATACTACNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
41078  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
41078  ACTACAGCATATGCNNNNNNNNNNNNNNNNNNNTAATCAAGCACTTCATACTNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
41158  AGGATTTTCAAACGTTTAAAATAGCATAACATATTACTATATTCATCATATATCCAAATACTCTTTGCAAGATTCTAAGG  chr1.fa
41158  AGGATTTTCAAACGTTTAAAATAGCATAACATATTACTATATTCATCATATATCCAAATACTCTTTGCAAGATTCTAAGG  bay-0.fa
41158  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTNNNNNNNNNTNNNN  bor-4.fa
41158  AGGATTTTCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATACTCTTTGCAAGATTCTAAGG  br-0.fa
41158  AGGATTTTCAAANNNNNNNNGNNNNNNNNNNNNNNANTNNNNNNATCATATATCCAAATACTCTTTGCAAGATTCTAAGG  bur-0.fa
41158  AGGATTTTCAAACGTTTAAAATAGNNNNNNNNNNNNNNNNNNNNNNNNNNTATCCAAATACTCTTTGCAAGATTCTAAGG  c24.fa
41158  NNGATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTTTGCNAGATTCTAAGG  col-0.fa
41158  AGGATTTTCANNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAATACTCTTTGCAAGATTCTAAGG  cvi-0.fa
41158  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNNNNCTAAGG  est-1.fa
41158  AGGATTTTCAAACGTTTAAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAATACTCTTTGCAAGATTCTAAGG  fei-0.fa
41158  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
41158  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTNNNNNNNNTCTAANN  ler-1.fa
41158  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAANN  lov-5.fa
41158  AGGATTTTCAAACGTTTAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATACTCTTTGCAAGATTCTAAGG  nfa-8.fa
41158  NNNATNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNTTTGCAANNNNCTAAGG  rrs-10.fa
41158  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
41158  AGGATTTTCAANCGTTTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTCTTTGCAAGATTCTAAGG  sha.fa
41158  NNGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
41158  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAANN  ts-1.fa
41158  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
41158  NGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGCAAGATTCTAAGG  van-0.fa
 
41238  AAATTACATAGGTACATTACCACGCCGAAGCATTTGATTTTAATCTAACGAATTCGTTAACTTTTTTTTTTGGTGAATTA  chr1.fa
41238  AAATTACATAGGTACATTACCACGCCGAAGCATTTGATTTTAATCTNNNNNNNNNNNNNACTTTTTTTRRTNNNRNNTTA  bay-0.fa
41238  NNNNNNNNNNNGTACATTACCACGCCGAAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNRRNNNNRNNNNN  bor-4.fa
41238  AAATTACNTAGGTACATTACCACGCCGAAGCATTTGATNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNRRNNNNRNNNTA  br-0.fa
41238  AAATTACATAGGTACATTACCACGCCGAAGCATTTNNNNNNNNNNNNNNNNNNNNNTTAACTTTTTTTRRTNGTRAATTA  bur-0.fa
41238  AAATTACATAGGTACATTACCACGCCGAAGCATTTGATTTTAATCNNNNNNNNNNNNNAACTTTTTTTRRNNGNRNNTTA  c24.fa
41238  ANANNNNNNNGGTACATTACCACGCCGAAGCATTTGNNNNNNNNNNNNNNNNNNNNNNNNNNTTTNNNRRNNNNRNNNNN  col-0.fa
41238  AAATTACATAGGTACATTACCACGCCGAAGCATTNNGNNNNNNNNNNNNNNNNNNNNNNNNTTTTNNTRRNNNNRNNNTA  cvi-0.fa
41238  NNNNNNNATAGGTACATTACCACGCCGAAGCATTTGANNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNRRNNNNRNNNTA  est-1.fa
41238  AAATTACATAGGTACATTACCACGCCGAAGCATTTGATTTTNNNNNNNNNNNNNNNNNNANTTTTTTTRRTNNNRNNNTA  fei-0.fa
41238  NNNNNNNNNNNNNACATTACCACGCCGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNRRNNNNRNNNNN  got-7.fa
41238  NNNNNNNNNNNGTACATTACCACGCCGAAGCATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTRRNNNNRNNNNN  ler-1.fa
41238  NNNNNNNNNNNGTACATTACCACGCCGAAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNRRNNNNRNNNNN  lov-5.fa
41238  AAATTACATAGGTACATTACCACGCCGAAGCATTTGATNNNNNNNNNNNNNNNNNNNNNNNTTTTTNTRRTNNNRNNNTA  nfa-8.fa
41238  AAATNNNNNAGGTACATTACCACGCCGAAGCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNRRNNNNRNNNNN  rrs-10.fa
41238  NNNNNNNNNNNGTACATTACCACGCCGAAGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNRRNNNNRNNNNN  rrs-7.fa
41238  AAATTACATAGGTACATTACCACGCCGAAGCATTTGANNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTRRTNNNRNNNNN  sha.fa
41238  NNNNNNNNNNNGTACATTACCACGCCGAAGCATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNRRNNNNRNNNNN  tamm-2.fa
41238  NNNNNNNNNNNNTACATTACCACGCCGAAGCATTTGANNNNNNNNNNNNNNNNNNNNNNNNNTTTNNNRRNNNNRNNNNN  ts-1.fa
41238  NNNNNNNNNNNNNNCATTACCACGCCGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNRRNNNNRNNNNN  tsu-1.fa
41238  ANANNANNTAGGTACATTACCACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTNNNRRNNNNRNNNTA  van-0.fa
 
41318  CGAATTCGTTAACTTGGCATAGATTAATGTTCCCACAACCTGTTATATATATATATATATATATATATTTTCTTCTTTTT  chr1.fa
41318  CGAATTCGTTAACTTGGCATAGATTAATGTTCCCACAACCTGTNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNTTTTT  bay-0.fa
41318  NNNNNNCGTTAACTTGGCATAGATTAATGTTCCCACNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNN  bor-4.fa
41318  CGAATTCGTTAACTTGGCATAGATTAATGTTCCCACNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNTT  br-0.fa
41318  CGAATTCGTTAACTTGGCATAGATTAATGTTCCCACAACNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNT  bur-0.fa
41318  CGAATTCGTTAACTTGGCATAGATTAATGTTCCCACAACNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNN  c24.fa
41318  NNNNNNCGTTAACTTGGCATAGATTAATGTTCCCACAACCNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNTT  col-0.fa
41318  CGAATTCGTTAACTTGGCATAGATTAATGTTCCCACAANNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNTT  cvi-0.fa
41318  CNAATTCGTTAACTTGGCATNGATTAATGTTCCCACAACNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNT  est-1.fa
41318  CGAATTCGTTAACTTGGCATAGATTAATGTTCCCACAACNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNTTTT  fei-0.fa
41318  NNNNNNNNNNNNNNNNNNNNNNNNNANTGTTCCNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNN  got-7.fa
41318  NNNNNNCGTTAACTTGGCATAGATTAATGTTCCCANNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNTTT  ler-1.fa
41318  NNNNNNCGTTAACTTGGCATAGATTAATGTTCCCACNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNN  lov-5.fa
41318  CNAATTCGTTAACTTGGCATAGATTAATGTTCCCACAACNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNTT  nfa-8.fa
41318  NNNNNTCGTTAACTTGGCATAGATTAATGTTCCCACAACCNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNTT  rrs-10.fa
41318  NNNNNNNNTTAACTTGGCATAGATTAATGTTCCCACNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNN  rrs-7.fa
41318  NNNATTCGTTAACTTGGCATAGATTAATGTTCCCACANNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNN  sha.fa
41318  NNNNNNNNTTAACTTGGCATAGATTAATGTTCCCACANNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNN  tamm-2.fa
41318  NNNNNNNGTTAACTTGGCATAGATTAATGTTCCCACNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNT  ts-1.fa
41318  NNNNNNNNNNNACTTGNNNNNNNTTAATGTTCCCNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNN  tsu-1.fa
41318  CGAATTCGTTAACTTGGCATAGATTAATGTTCCCACNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNN  van-0.fa
 
41398  TTGATTCCACAGCACAGTATGTAAATTTCGTTTTGTCCGGCAAATTTGGCCTTTACCATAATTTTTTTCACCGCCTTCAG  chr1.fa
41398  TTGATTCCACAGCACAGTATGTAAATTTCGTTTTGTCCGGCNAATTTGGCCTTTACCATAATTTTTTTCACCGNCTTCAG  bay-0.fa
41398  NTGATTCCACAGCACAGTATGTNNNNNNCGTTTTGTCCGGCAAATTTGGCCNNNNNNNNNNNNNNNNNNACCGCCTTCAG  bor-4.fa
41398  TTGATTCCACAGCACAGTATGTAAATTTCGTTTTGTCCGGCAAATTTGGCNNNNNNNNNNNTTTTTTTCACCGCCTTCAG  br-0.fa
41398  TTGATTCCACAGCACAGTATGTNNNNNNNANTTTGTCCGGCAAATTTGGCCTTTACCATAATTTTTTTCACCGCCTTCAG  bur-0.fa
41398  TTGATTCCACAGCACAGTATGTAAATTTCGNTTTGTCCGGNAAATTTGGCCTTTACCATAATTTTTTTCACCGCCTTCAG  c24.fa
41398  TTGATTCCACAGCACAGTATGTAAATTTCGTTTTGTCCGGCAAATTTGGCCTTNANNANAATTTTTTTCACCGCCTTCAG  col-0.fa
41398  TTGATTCCACAGCACAGTATNNNNNNNNNANNNNNNNCGGCAAATTTGGCCTTTACCATAATTTTTTTCACCGCCTTCAG  cvi-0.fa
41398  TTGATTCCACAGCACAGTATGTAAATTTCGTTTTGTCCGGCAAATTTGGCCTTNNNNNNNNNNTTTTTCACCGCCTTCAG  est-1.fa
41398  TTGATTCCACAGCACAGTATGTAAATTTCGTTTTGTCCGGCAAATTTGGCCTTTACCATAATTTTTTTCACCGCCTTCAG  fei-0.fa
41398  NTGATTCCACAGCACAGNNNNNNNNNNNNNNNNNNNNNNNCAAATTTGGCNNNNNNNNNNNTTTTTTTCACCGCCTTCAG  got-7.fa
41398  TTGATTCCACAGCACANTATGTAAATTTCGTTTTGTCCGGCAANTTTGGCCTTTACCATAATTTTTTTCACCGCCTTCAG  ler-1.fa
41398  TTGATTCCACAGCACAGTNNNNNNNNNNNANNNNNNNNNNCAAATTTGGCNNNNNNNNNNNNNTTTTTCACCGCCTTCAG  lov-5.fa
41398  TTGATTCCACAGCACAGTATGTAAATTTCGTTTTGTCCGGCAAATTTGGCCTTTACCATAATTTTTTTCACCGCCTTCAG  nfa-8.fa
41398  TTGATTCCACAGCACANTATGTAAATTTCGTTTTGTCCGGCAAATTTGGCCTTNNNNNTAATTTTTTTCACCGCCTTCAG  rrs-10.fa
41398  NTGATTCCACAGCACNGTATGTAAATTTCGTTTTGTCCGGCAAATTTGGCNNNNNNNNNNNNNNNNNNNACCGCCTTCAG  rrs-7.fa
41398  NNNNNNNNNNNNCACAGTATGTAAATTTCGTTTTGTCCGGCAAATTTGGCCTTTACCATAATTTTTTTCACCGCCTTCAG  sha.fa
41398  NNNNNNNNNNNNNNNAGTATGTNNNNNNCGTTTTGTCCGGCAAATTTGGCCNNNNNNNNNNNNTTTTTCACCGCCTTCAG  tamm-2.fa
41398  TTGATTCCACAGCACAGTATGTAAATTTCGTTTTGTCCGGCNAATTTGGCCTTTNCNNTNATTTTTTTCACCGCCTTCAG  ts-1.fa
41398  NNNNNTCCACAGCANNNNNNNNNNNNNNNNNNNNNNNNGGCAAATTTGGCNNNNNNNNNNNNNTTTTTCACCGCCTTCAG  tsu-1.fa
41398  TTGATTCCACAGCACAGTNNNNNNNNNNNANNNNNNNCGGCAAATTTGGCCTTNNNNNNNNNNTTTTTCACCGCCTTCAG  van-0.fa
 
41478  TGCCGTAGACAAATCAAAGCTCAAAAATAATTACGGAGTTTTAAATTATTTCAAATGCTATAGTAAAGTTGTAAATATAT  chr1.fa
41478  TGCCGTAGACAAATCAAANCTCAAAAATAATTACGGAGTTTTAAARTNTTTCAAATGCTATAGTAAAGTTGTANNNRRRR  bay-0.fa
41478  TGCCGTAGACAAATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRR  bor-4.fa
41478  TGCCGTAGACAAATCAANNNNNAAAANNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRR  br-0.fa
41478  TGCCGTAGACAAATCAAAGCTCAAAAATAATTNNNNNNNNNANNNRNNNNNNNNATGCTATAGNNNNNNNNNNNNNRRRR  bur-0.fa
41478  TGCCGTAGACAAATCAAAGCTCAAAAATAATTACNNNNNNNTNNNRNNNTTCAAATGCTATAGTAAANNNNNNNNNRRRR  c24.fa
41478  TGCCGTAGACAAATCAANNNNNNNNAANNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNTNGTNNNNNNNNNNNNRRRR  col-0.fa
41478  TGCCGTAGACAAATCAANNNNNAAAAANAANNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRR  cvi-0.fa
41478  TGCCGTAGACAAATCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRR  est-1.fa
41478  TGCCGTAGACAAATCAAAGCTCAAAAATAANNNNNNNNNNNNNNNRNNNNNNNNNNNCTATAGTAAAGNNNNNNNNRRRR  fei-0.fa
41478  TGCCGTAGACAAATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRR  got-7.fa
41478  TGCCGTAGACAAATCAANNNNNNNANATNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRR  ler-1.fa
41478  TGCCGTAGACAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRR  lov-5.fa
41478  TGCCGTAGACAAATCAANNNNNAAAAANANNNNNNNNNNNNNNNNRNNNNNNNNNNNNNATAGTAANNNNNNNNNNRRRR  nfa-8.fa
41478  TGCCGTAGACAAATCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRR  rrs-10.fa
41478  TGCCGTAGACAAATCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRR  rrs-7.fa
41478  TGCCGTAGACAAATCAANNNNNAAANNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNATAGTAAANNNNNNNNNRRRR  sha.fa
41478  TGCCGTAGACAAATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRR  tamm-2.fa
41478  TGCCGTAGACAAATCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRR  ts-1.fa
41478  TGCCGTAGACAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRR  tsu-1.fa
41478  TGCCGTAGACAAATCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRR  van-0.fa
 
41558  ATATATATATCAATTAAACTCCCTTAACCCCATAAGACAAGTTTTTTTATTAGTGGTTTTACTGAAAAAATGATTATTGG  chr1.fa
41558  NRNRRRRRRNNNATTAAACTCCCTTAACCCCATAAGACAAGTTTTTTTNNNNGTGGTTTTACTGAAAAAATGATTATTGG  bay-0.fa
41558  NRNRRRRRRNNNNNNNNNCTCCCTTAACCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  bor-4.fa
41558  NRNRRRRRRNNNNNNNNACTCCCTTAACCNCANAANNNNNNNNTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  br-0.fa
41558  NRNRRRRRRNNNATTAAACTCCCTTAACCCCATAAGACAAGTTTTTTTNNNNGTNGTNTTACTGAAAAAATGATTATTGG  bur-0.fa
41558  NRNRRRRRRNNNNNNAAACTCCCTTAACCCCATAAGACAAGTTTTTTTNNNNGNNGTTTTACTGAAAAAATGATTATTGG  c24.fa
41558  NRNRRRRRRNNNNNNNNNCTCCCTTAACCCCATAANANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  col-0.fa
41558  NRNRRRRRRNNNNNNNNNCTCCCTTAACCCCATNAGACAAGTTTTNNNNNNNNNNNNNNTACTNNNNNNATGATTATTGG  cvi-0.fa
41558  NRNRRRRRRNNNNNNNNACTCCCTTAACCCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  est-1.fa
41558  NRNRRRRRRNNNNNNNNACTCCCTTAACCCCATAAGACAAGTTTTTTTNNNNNNNNTTTTACTGAAAAAATGATTNNNNN  fei-0.fa
41558  NRNRRRRRRNNNNNNNNNNTCCCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
41558  NRNRRRRRRNNNNNNNNNCTCCCTTAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ler-1.fa
41558  NRNRRRRRRNNNNNNNNNNTCCCTTAACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
41558  NRNRRRRRRNNNNNNNNACTCCCTTAACCCCATAAGACAAGTTTTNNNNNNNNNNNNNNNACTGAAAAAATGATNNNNNN  nfa-8.fa
41558  NRNRRRRRRNNNNNNNNNCTCCCTTAACCCCATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
41558  NRNRRRRRRNNNNNNNNNCTCCCTTAACCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
41558  NRNRRRRRRNNNNNNNNACTCCCTTAACCCCATAAGACAAGTTTTNNNNNNNNNNNNNNNACTGAAAAAATGATTANNNN  sha.fa
41558  NRNRRRRRRNNNNNNNNNNTCCCTTAACCCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tamm-2.fa
41558  NRNRRRRRRNNNNNNNNNCTCCCTTAACCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
41558  NRNRRRRRRNNNNNNNNNNNCCCTTAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
41558  NRNRRRRRRNNNNNNNNNCTCCCTTAACCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  van-0.fa
 
41638  TGTTATGTAAATGATAATATATTAAGGAAAATTTTTAGAACTTTTATTATATATTATCGTAATATACGACTCGAATTTAA  chr1.fa
41638  TGTTATGTAAATGATAANATATTAAGGAAAATTTTTAGAACRTNNNTTNNNNNNNNNNNNAATATACGACTCGAATTTAA  bay-0.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNGNCTNGNNNNNNN  bor-4.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNTATACGACTCGAATTTNN  br-0.fa
41638  TGTTNTGTAANNNNNNNNNNNNNNNNNNNNNNTTTTANNNNRNNNNNNNNNNNNNNNNNNNNTATACGACTCGAATTTAA  bur-0.fa
41638  TGTTNTGTANNNNNNNNNNNNNNNNNNNNNNNNTTTANNNNRNNNNNNNNNNNNNNNNNNNATATACGACTCGAATTTAA  c24.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNATACGACTCGAATTTNN  col-0.fa
41638  TNNNNNNTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNTATACGACTCGAATTTAN  cvi-0.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNACGACNNNNNTTTNN  est-1.fa
41638  TGTTATGTANNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNRNNNNNNNNNNNNNNNNNNNNTATACGACTCGAATTTAA  fei-0.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNCGACTCGAATTTNN  ler-1.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNTATACGACTCGAATTTNN  nfa-8.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-10.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNCGACTCGAATNNNN  rrs-7.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNATATACGACTCGAATTTNN  sha.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNGACTCGAATNNNN  tamm-2.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNCGACTCGAATNNNN  ts-1.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
41638  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNATATACGACTCGAANNNNN  van-0.fa
 
41718  AATAGAAATCAAAATAAAAGTGTTAGTAAAGGAAAAAAAAAAAGGTTGTGAATTCTATCACGACAAGTCATATATATTAC  chr1.fa
41718  AATANNNNNCANAANAAAAGTGTTNNNNNNNNNNNRRNNNNNNRNNTGTGAATTCTATCACGACAAGTCATATANATTAC  bay-0.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNNNNNATTCTATCACGACANNNNNNNNNNNNNNN  bor-4.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNNNNAATTCTATCACGACAAGTCANNNNNNNNNN  br-0.fa
41718  NNNNNNNNNNNNAANAAAAGNNNNNNNNNNNNNNNRRNNNNNNRNNNGTNAATTCTATCACGACAAGTCATATNNNNNNN  bur-0.fa
41718  NNNNNNNNNNNNNANANNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNGTGAATTCTATCACGACAAGTCATNNNNNNNNN  c24.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNNNNNNNTCTATCACGACAAGNNNNNNNNNNNNN  col-0.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNNTGAATTCTATCACGACAAGTCATNNNNNNNNN  cvi-0.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNNNNAATTCTATCACGACAAGTNNNNNNNNNNNN  est-1.fa
41718  NNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNGTGAATTCTATCACGACAAGTCATNNNNNNNNN  fei-0.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNNNNNNNNNNNTCACGACNNNNNNNNNNNNNNNN  got-7.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNGNNAANTCTATCACGACAAGNNNNNNNNNNNNN  ler-1.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNANNNRNNNNNNNNNNNNATCACGACAANNNNNNNNNNNNNN  lov-5.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNANNNRNNNNNGAATTCTATCACGACAAGTCNNNNNNNNNNN  nfa-8.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNNNNNNNNCTATCACGACAANNNNNNNNNNNNNN  rrs-10.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNNNNNATTCTATCACGACAANNNNNNNNNNNNNN  rrs-7.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNGTGAATTCTATCACGACAAGTCANNNNNNNNNN  sha.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNNNNNNNTCTATCACGACNNNNNNNNNNNNNNNN  tamm-2.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNNNNNANNCTATCACGACAAGNNNNNNNNNNNNN  ts-1.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNNNNNNNNNNNNCACGNNNNNNNNNNNNNNNNNN  tsu-1.fa
41718  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRNNNNNNRNNNNNNNATTCTATCACGACAAGTCANNNNNNNNNN  van-0.fa
 
41798  AAATATCATTTTCTGTTAAGGTTAACAGAAAATTCTAAGTTGCGGTCTATTTGTCTTTTAAATCAAACACGAATGAGAAA  chr1.fa
41798  AAATATCATTTTCTGNNNNRRNNNACAGAAAATTCNAAGTTGCGGTCTATTTGTCTTTTAAATCAAACACGAATGAGAAA  bay-0.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNTTCTAAGTTGCGGTCTATTTNNNNNNNNNNNNNNNNNNNAATGAGAAA  bor-4.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNTTCTAAGTTGCGGTCTATTTNNNNNNNNNATCAAANACGAATGAGAAA  br-0.fa
41798  NNNNNTCATTTTCTGNNNNRRNNNACAGAAAATTCTAAGTTGCGGTCTATTTGTNNNNNNNACCNNANACGAATGAGAAA  bur-0.fa
41798  NNNNNNNNTTTTCTGNNNNRRNNNNCAGAAAATTCTAAGTTGCGGTCTATTTGTCTTTTAAATCAAACACGAATGAGAAA  c24.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNATTCTAAGTTGCGGTCTATTTGTCNTNTAAATCAAACACGAATGAGAAA  col-0.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNCAGAAAATTCTAAGTTGCGGTCTATTTGNNNNNNNNNCNNNNNNNNAATGAGAAA  cvi-0.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNTTCTAAGTTGCGGTCTATTTNNNNNNNNNNNNAAACACGAATGAGAAA  est-1.fa
41798  NNNNNNNNNNNTCTGNNNNRRNNNNCAGAAAATTCTAAGTTGCGGTCNATTTGTCTTTTAAATCAAACACGAATGAGAAA  fei-0.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNTCTAAGTTGCGGTCTATNNNNNNNNNNNNCNNNNNNNNNNTGAGAAA  got-7.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNNNNAATTCTAAGTTGCGGTCTATTTGTNNNNNNNNTCAAACACGAATGAGAAA  ler-1.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNATTCTAAGTTGCGGTCTATTNNNNNNNNNNNCNNNNNNNNNNTGAGAAA  lov-5.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNGAAAATTCTAAGTTGCGGTCTATTTGTCTTTTAAATCAAACACGAATGAGAAA  nfa-8.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNTTCTAAGTTGCGGTCTATTTGTCNNNNNNNNNNNNNACGAATGAGAAA  rrs-10.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNNNNAATTCTAAGTTGCGGTCTATTTGNNNNNNNNATCAAACACGAATGAGAAA  rrs-7.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNGAAAATTCTAAGTTGCGGTCTATTTGTCTNTTAAATCAAACACGAATGAGAAA  sha.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNTTCTAAGTTGCGGTCTATTTNNNNNNNNNNTCAAACACNAATGAGAAA  tamm-2.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNTTCTAAGTTGCGGTCTATTTGTNNNNTAAATCAAACACGAATGAGAAA  ts-1.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNNNNNNNNCNAAGTTGCGGTCTATNNNNNNNNNNNNCNNNNNNNNNNTGAGAAA  tsu-1.fa
41798  NNNNNNNNNNNNNNNNNNNRRNNNNNNNNNAATTCTAAGTTGCGGTCTATTTNNNNNNNNNNCNNNNNNNNNATGAGAAA  van-0.fa
 
41878  TTGCCACTCATTTACTAATATTATATTGCGTATTCTTTGCAGATTATGTCTCTTTATAATCATCTTGCAAATTGACCCTT  chr1.fa
41878  TTGCCACTCATTTACTAATATTATATTGCGTATTCTTTGCAGATTNTRTCTCTTTATAATCATCTTGCAAATTGACCCTT  bay-0.fa
41878  TTGCCACNNNNNNNNNNNNNNNNNNNNNNNTATTCTTTGCAGANNNNRNNNNNNNNNNNNNNNNNTGCAAATTGACCCNN  bor-4.fa
41878  TTGCCACTCNNNNNNNNNNNNNNNNNNNNNTATTCTTTGCAGNNNNNRNNNNNNNNNNNNNNNNNTGCAAATTGACCCTT  br-0.fa
41878  TTGCCACNNGNNNNNNNNNNNNATATTGCGTATTCTTTGCAGATTATRTCTCTTTATAATCATCTTGCAAATTGACCCTT  bur-0.fa
41878  TTGCCACTCATTTACTNATATTATNTTGCGTATTCTTTGCAGATTNTRTCTCTTTATAATCATCTTGCAAATTGACCCTT  c24.fa
41878  TTGCCACTCANNNNNNNNNNNNNNNNNNCGTATTCTTTGCANNNNNNRNNNNNNNNNNNNNANCTTGCAAATTGACCCTT  col-0.fa
41878  TTGCCANNNGNNNNNNNNNNNNNNNNNGCGTATTCTTTGCAGATTNTRNNNCNNNATAATCATCTTGCAAATTGACCCTT  cvi-0.fa
41878  TTGCCACTCANNNNNNNNNNNNNNNNNNCGTATTCTTTGCAGATNNNRNNNNNNNNNNNNNNNNNTGCAAATTGACCCTT  est-1.fa
41878  TTGCCACTCATTTANNNNNNNNNNNNTGCGTATTCTTTGCAGATTNTRTCTCNTTATAATCATCTTGCAAATTGACCCTT  fei-0.fa
41878  TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGNNNNNNNNRNNNNNNNNNNNNNNNNNTGCAAATTNNNNNNN  got-7.fa
41878  TTGCCACTNNNNNNNNNNNNNNNNNNNNNNTATTCTTTGCAGNTNNNRNNNNNNNNNNNNCANCTTGCAAATTGACCCTT  ler-1.fa
41878  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGCANNNNNNRNNNNNNNNNNNNNNNNNNNCAAATTGACCCNN  lov-5.fa
41878  TTGCCACTCATTNNNNNNNNNNNNNNNGCGTATTCTTTGCAGATTNTRTNNCNNNATAATCATCTTGCAAATTGACCCTT  nfa-8.fa
41878  TTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNATTCTTTGCAGANNNNRNNNNNNNNNNNNNNNNNNNCAAATTGANNNNN  rrs-10.fa
41878  TTGCCACTCNNNNNNNNNNNNNNNNNNNNGTATTCTTTGNNNNNNNNRNNNNNNNNNNNNNNNNNTGCAAATTGACCCNN  rrs-7.fa
41878  TTGCCACTCATTTNNNNNNNNNNNNNNGCGTATTCTTTGCAGNNNNTRNNNNNNNNNAATCATCTTGCAAATTGACCCTT  sha.fa
41878  TTGCCACTCNNNNNNNNNNNNNNNNNNNNNTATTCTTTGCNNNNNNNRNNNNNNNNNNNNNNNNNNGCAAATTGNCCCTT  tamm-2.fa
41878  TTGCCACTCNNNNNNNNNNNNNNNNNNNNNTATTCTTTGNNNNNNNNRNNNNNNNNNNNNNNNNTTGCAAATTGACCCTT  ts-1.fa
41878  TTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNGCNANNNNNNNNNN  tsu-1.fa
41878  TTGCCACTCNNNNNNNNNNNNNNNNNNNCGTATTCTTTGCAGANNNNRNNNNNNNNNNNNNNNNNNGCAAATTGACCCTT  van-0.fa
 
41958  AATTTTAACATGTGGGTGGTAAAAAAAAAACTAAAAGAAGAAACATTACTATTTCCATTGATAAGATTGATCGCAATCTA  chr1.fa
41958  AATTTTAACATGTGGGTGGNAAAANNNRNNRNNNNRRNNRNNNCATTACTATTTCCATTGATAAGATTNNNNNNNNNNNN  bay-0.fa
41958  NNNNNNNNNNNNNNNNNNNNNAAANNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNNNNNNNNGATNNNNNNNNNNNNN  bor-4.fa
41958  AATTTTNNNNNNNNNNNNNNAANANNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNNNNATAAGATTGATCGNNNNNNN  br-0.fa
41958  AATTTTAACATGTGGGTGGTAAAANNNRNNRNNNNRRNNRNNNNATTACTATTTCCATTGATAAGATTGANNNNNNNNTA  bur-0.fa
41958  AATTTTAACATGTGGGTGGTAAAANNNRNNRNNNNRRNNRNNNNNTTACTATTNCCATTGATAAGATTGATNNNNNNNNN  c24.fa
41958  AATTTTNNNNNNNNNNNNNNNNAANNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNNNNNNAAGATTGNNNNNNNNNNN  col-0.fa
41958  AATTTTAACATGTGGGTGGNAAAANNNRNNRNNNNRRNNRNNNNNNNNNNNNNNCCATTGATAAGATTGNNNNNNNNNNN  cvi-0.fa
41958  ANNNNNNNNNNNNNNNNNNNAAAANNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNNNNNTAAGATNNNNNNNNNNNNN  est-1.fa
41958  AATTTTAACATGTGGGTGGTAAAANNNRNNRNNNNRRNNRNNNNNNNNNTATNNNNNNTGATAAGATTGNNNNNANTCNA  fei-0.fa
41958  NNNNNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
41958  AATTTTAACNNNNNNNNGGNAAAANNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNNNNNTAAGANNNNNNNNNNNNNN  ler-1.fa
41958  NNNNNNNNNNNNNNNNNNNNNNNANNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNNNNNTAAGANNNNNNNNNNNNNN  lov-5.fa
41958  AATTTTAACATGNNNNNGGNAAAANNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNTTGATAAGATTNNNNNNNNNNNN  nfa-8.fa
41958  NNNNNNNNNNNNNNNNNNNNNANNNNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNNNNNTAAGATNNNNNNNNNNNNN  rrs-10.fa
41958  NNNNNNNNNNNNNNNNNNGNAAAANNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  rrs-7.fa
41958  AATTTTAACNNNNNNNNGGNAAAANNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNNNGANAAGANNNNNNNNNNNNNN  sha.fa
41958  AATTNNNNNNNNNNNNNNNNNNNNNNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNNNNNNNNGATNNNNNNNNNNNNN  tamm-2.fa
41958  AATTTTNNNNNNNNNNNNNNNNNANNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNNNNNTAAGNNNNNNNNNNNNNNN  ts-1.fa
41958  NNNNNNNNNNNNNNNNNNNNNNAANNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  tsu-1.fa
41958  AATTTTAANNNNNNNNNNNNNNNNNNNRNNRNNNNRRNNRNNNNNNNNNNNNNNNNNNNGATAAGATTNNNNNNNNNNNN  van-0.fa
 
42038  TCTAGATTGAACTTGACAAAACTTTTGTGATACGAAAAAAAGAAGGAAAAGACAAAAAGGAGTTGGTATTGCTATCTGAG  chr1.fa
42038  NNNNNNTTGAACTTGACAAAACTTTTGTGATACGAAAAAAANNNRRRNNNNNNNNAAAGGAGTTGGTNTTGCTATCTGAG  bay-0.fa
42038  NNNNNNNNNNNNNNGACAAAACTTTTGTNNNNNNNNNNNNNNNNRRRNNNNNNNNAAAGGAGTTGGTNTTGCTATCTGAG  bor-4.fa
42038  NNNNNATTGAACTTGACAAAACTTTTGTGATACGAAAANNNNNNRRRNNNNNNNNAAAGGAGTTGGTNTTGCTATCTGAG  br-0.fa
42038  TCTAGATTGAACTTGACAAAACTTTTGTGATACGAAAAAAANNNRRRNNNNNNNAAAAGGAGTTGGTNTTGCTATCTGAG  bur-0.fa
42038  NNNNNATTGAACTTGACAAAACTTTTGTGATACGAAAAAANNNNRRRNNNNNNNNAAAGGAGTTGGTATTGCTATCTGAG  c24.fa
42038  NNNNNNNNNNNCTTGACAAAACTTTTGTGATACGAAANNNNNNNRRRNNNNNNNNNAAGGAGTTGGTNTTGCTATCTGAG  col-0.fa
42038  NNNAGATTGAACTTGACAAAACTTTTGTGATACGAAAAAANNNNRRRNNNNNNNNAAAGGAGTTGGTATTGCTATCTGAG  cvi-0.fa
42038  NNNNNNNNNNNCTTGACAAAACTTTTGTGATACGAAAANNNNNNRRRNNNNNNNAAAAGGAGTTGGTNTTGCTATCTGAG  est-1.fa
42038  TCTAGNTTGAACTTGACAAAACTTTTGTGATACGAAANNNNNNNRRRNNNNNNNNNAAGGAGTTGGTNTTGCTATCTGAG  fei-0.fa
42038  NNNNNNNNNNNNNNNACAAAANNNNNNNNNNNNNNNNNNNNNNNRRRNNNNNNNNNNNNNNGTTGGTNTTGCTATCTGAG  got-7.fa
42038  NNNNNNNNNNNCTTGACAAAACTTTTGTGATNCGAAAAANNNNNRRRNNNNNNNAAAAGGAGTTGGTNTTGCTATCTGAG  ler-1.fa
42038  NNNNNNNNNNNCTTGACAAAACTTTTGTGATACGAAAAANNNNNRRRNNNNNNNNNNNNNAGTTGGTNTTGCTATCTGAG  lov-5.fa
42038  NNNNNNNNNAACTTGACAAAACTTTTGTGATACGAAAAAAANNNRRRNNNNNNNNNAAGGAGTTGGTATTGCTATCTGAG  nfa-8.fa
42038  NNNNNNNNNAACTTGACAAAACTTNTGTGATNCGAAANNNNNNNRRRNNNNNNNNNAAGGAGTTGGTATTGCTATCTGAG  rrs-10.fa
42038  NNNNNNNNNNNCTTGACAAAACTTTTGTGATANGNNANNNNNNNRRRNNNNNNNANAANGAGTTGGTNTTGCTATCTGAG  rrs-7.fa
42038  NNNNNNNNNAACTTGACAAAACTTTTGTGATACGAAAANNNNNNRRRNNNNNNNNNNAGGAGTTGGTNTTGCTATCTGAG  sha.fa
42038  NNNNNNNNNNNNTNGACAAAACTTTTGNGNNNNNNNNNNNNNNNRRRNNNNNNNNNAAGGAGTTGGNNNNNCTATCTGAG  tamm-2.fa
42038  NNNNNNNNGAACTTGACAAAACTTTTGTGATANGANAANNNNNNRRRNNNNNNNNNNNNGAGTTGGTNTTGCTATCTGAG  ts-1.fa
42038  NNNNNNNNNNNNNNGACAAAACTTTTNNNNNNNNANAANNNNNNRRRNNNNNNNNNNNNNAGTTNNNNNNGCTATCTGAG  tsu-1.fa
42038  NNNNNNNNNAACTTGACAAAACTTTTGTGANNNNNAANNNNNNNRRRNNNNNNNNAAAGGAGTTGGTATTGCTATCTGAG  van-0.fa
 
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGAATTAATTTGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGACA  chr1.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGAATTAATTTGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGACA  bay-0.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTNNNNNNNNNNNNGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGNNN  bor-4.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGANNNNNNNNGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGACA  br-0.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGAATTAATTTGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGACA  bur-0.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGAATTAATTTGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGACA  c24.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGAANNNNNNTGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGNCA  col-0.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGAATTAATTTGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGNNN  cvi-0.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGNNNNNNNNTGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGNNN  est-1.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGAATTAATTTGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGNCA  fei-0.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTNNNNNNNNNNNNNNNNATGCCTACTTATGCATGGCTTCAGAGTTGNNNNNNNN  got-7.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTNNNNNNNNNTTGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGACA  ler-1.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGNNNNNNNNNNNGANATNCCNACTTATGCATGGCTTCAGAGTTGGTNNNNNN  lov-5.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGAATTAATTTGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGACA  nfa-8.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGNNNNNNNNTGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGANN  rrs-10.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGNNNNNNNTTGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGACA  rrs-7.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGANNNNNNNTGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGACA  sha.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTNNNNNNNNNNNNNNATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGNNN  tamm-2.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGNNNNNNTTTGGGANATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGACA  ts-1.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGGCTTCAGAGTTGGTTNNNNN  tsu-1.fa
42118  TTCGAGTGCATGAGTGGTCGTGAAAGTGGANNNNNNTTGGGATATGCCTACTTATGCATGGCTTCAGAGTTGGTTTGACN  van-0.fa
 
42198  TAATTTTTCAGAAACAAGTGTCTAAGCCTTTCATACACGTCTTGATTTTAGAAGTTAGACTGATTTTCTCTATGTTCATG  chr1.fa
42198  TAATTTTTCAGAAACAAGTGTCTAAGCCTTTCATACACGTCTTGATTTTAGAAGTTAGACTGATTTTCTCTATGTTCATG  bay-0.fa
42198  NNNNNNNNNNGNNACAAGTGTCTAAGCCTTTCATACACGTCTTGATTTNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNN  bor-4.fa
42198  TNATTTTTCAGAAACAAGTGTCTAAGCCTTTCATACACGTCTTGATTTNNNNNNNNNNNNNNNTTTTCTCTATGTNNNNN  br-0.fa
42198  TAATTTTTCAGAAACAAGTGTCTAAGCCTTTCATACACGTCTTGATTTTAGAAGTTAGACTGATTTTCTCTATGTTCATG  bur-0.fa
42198  TAATTTTTCAGAAACAAGTGTCTAAGCCTTTCATACACGTCTTGATTTTAGAAGTTAGACTGATTTTCTCTATGTTCATG  c24.fa
42198  TAATTTTTCAGAAACAAGTGTCTAAGCCTTTCATACACGTCTTGATTTNNNNNNNNNNACTGATTTTCTCTATGTTNATG  col-0.fa
42198  NNATTTTTCAGAAACAAGTGTCTAAGCCTTTCATACACGTCTTGATTTTAGAAGTTAGACTGATTTTCTCTATGTTCATG  cvi-0.fa
42198  NNANNTNTCAGAAANAAGTGTCTAAGCCTTTCATACACGTCTTGATTNNNNNNNNNNNNNNNNNTTTCTCTNNNNNNNNN  est-1.fa
42198  TAATTTTTCAGAAACAAGTGTCTAAGCCTTTCATACACGTCTTGATTTTAGAAGTTAGACTGATTTTCTCTATGTTCATG  fei-0.fa
42198  NNNNNNNNNNNNNNNNNNTGNCTAAGCCTTTCATACACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
42198  TAATTTTTCAGAAACAAGTGTCTAAGCCTTTCATACACGTCTTGATTTNNNNNNNTNNACTNANTNNCNCTATNNNNNNN  ler-1.fa
42198  NNANNNNN