Arabidopsis SNP Sequence Viewer

Chromosome : chr4 Coordinates : 13332919 - 13333015


Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
13332919  GAAAGAACAAAGTTCTTCATCAAGAGTAGCAAATATTTTTATTACATCACTGGCCTCATTCAAAAACAATTCAAAAGTGG  chr4.fa
13332919  NNNNNNNNNNNNNNNNTCNTCRRRRRRRRRRRRRRRRRNRNNNNCATCACTGGCCTCATTCAANNNNNNNNNNAAANNNN  bay-0.fa
13332919  NNNANNNNNNNNNNNNTCATCRRRRRRRRRRRRRRRRRNRNNNACATCACTGGCCTCATTCAAAAACAANTCNNNNNNNN  bor-4.fa
13332919  NNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRNRNNNNCATCACTGGCCTCATTCAANNNNNNNNNNNNNNNNN  br-0.fa
13332919  NNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRNRNNNNNNNNNNTGGCCTCATTCAAAANNNNNNNNNNNNNNN  bur-0.fa
13332919  NNNNNNNNNNNNNNNNTCNNCRRRRRRRRRRRRRRRRRNRNNNACATCACTGGCCTCATTCAANNNNNNNTCAAAAGTGG  c24.fa
13332919  GNNNNNNNNNNNNNNNTCANCRRRRRRRRRRRRRRRRRNRNTTACATCACTGGCCTCATTCAAAANNNNNNCAAAAGNGG  col-0.fa
13332919  NNNNNNNNNNNNNNNNTCNNNRRRRRRRRRRRRRRRRRNRNNNNNNTNACTGGCCTCATTCANNNNNNNNNNNNNNNNNN  cvi-0.fa
13332919  NNNNNNNNNNNNNNNNTCNTCRRRRRRRRRRRRRRRRRNRNNNNNNTCACTGGCCTCATTCAANNNNNNNNCNNNNNNNN  est-1.fa
13332919  NNNNNNNNNNNNNNNNNNNTCRRRRRRRRRRRRRRRRRNRNNNNNATCACTGGCCTCATTCAANNNNNNNNNNNNNNNNN  fei-0.fa
13332919  NNNNNNNNNNNNNNNNTCNTCRRRRRRRRRRRRRRRRRNRNNNACATCACTGGCCTCATTCAAAAANNNNNNNAANNNNN  got-7.fa
13332919  NNNNNNNNNNNNNNNNTCNNCRRRRRRRRRRRRRRRRRNRNNNNCATCACTGGCCTCATTCAAAANNNNNTCAAAAGTGN  ler-1.fa
13332919  NNNNNNNNNNNNNNNNTCANCRRRRRRRRRRRRRRRRRNRNNNNCATCACTGGCCTCATTCAAAANCAATTCAAAAGTGG  lov-5.fa
13332919  NNNANNNNNNNNNNNNTCATCRRRRRRRRRRRRRRRRRNRNNNNNATCACTGGCCTCATTCAAAAACNNNNNNNNNNNNN  nfa-8.fa
13332919  NNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRNRNNNNCATCACTGGCCTCATTCAAAAANNNNTCAAANNNNN  rrs-10.fa
13332919  NNNNNNNNNNNNNNNNTCNNCRRRRRRRRRRRRRRRRRNRNNNNNATCACTGGCCTCATTCAAAANCAATTCAAANNNNN  rrs-7.fa
13332919  NNNNNNNNNNNNNNNNNCNNNRRRRRRRRRRRRRRRRRNRNNNNNATCACTGGCCTCATTCANNNNNNNNNNNNNNNNNN  sha.fa
13332919  NNNNNNNNNNNNNNNNNCNNCRRRRRRRRRRRRRRRRRNRNNNACATCACTGGCCTCATTCAAAAANNNNNNNNNNNNNN  tamm-2.fa
13332919  NNNNNNNNNNNNNNNNTCATCRRRRRRRRRRRRRRRRRNRNNNACATCACTGGCCTCATTCAANNNNNNNNNNNNNNNNN  ts-1.fa
13332919  NNNNNNNNNNNNNNNTTCNTCRRRRRRRRRRRRRRRRRNRNNNNNATCACTGGCCTCATTCAANNNNNNNTCNNNNNNNN  tsu-1.fa
13332919  NNNNNNNNNNNNNNNTTCANCRRRRRRRRRRRRRRRRRNRNNNNCATCACTGGCCTCATTCAAAANNNNNNNNNNNNNNN  van-0.fa
 
13332999  AACTTATTTTGGGAAAT   chr4.fa
13332999  NNNNNNNNNNNNNNNNN   bay-0.fa
13332999  NNCTTATTTTGGNAAAT   bor-4.fa
13332999  NNNNNNNNNNNNNNNNN   br-0.fa
13332999  NACNNNNNNNNNNNNNN   bur-0.fa
13332999  AACTTATTTTGGGAAAT   c24.fa
13332999  AACTTATTTTGGGAAAT   col-0.fa
13332999  NNNNNNNNNNNNNNNNN   cvi-0.fa
13332999  NNNNNNNNNNNNNNNNN   est-1.fa
13332999  NNNNTATTTNNNNNNNT   fei-0.fa
13332999  NACTTATTTTNNNNNNT   got-7.fa
13332999  AACTTATNNNNNNNNNN   ler-1.fa
13332999  AACTTATNNNNNNNNNN   lov-5.fa
13332999  NNNNNNNNNNNNNNNNN   nfa-8.fa
13332999  NNNNTATTTTGGGAAAT   rrs-10.fa
13332999  NNNNNNNNNNNNNNNNN   rrs-7.fa
13332999  NNNNNNNNNNNNNNNNN   sha.fa
13332999  NNNNNATTTTGGNAAAT   tamm-2.fa
13332999  NNNNNNTTTTGNNNNNT   ts-1.fa
13332999  NNNNNNNNNNNNNNNNN   tsu-1.fa
13332999  NNNNNNNNNNNNNNNNN   van-0.fa
 
visited.